JBC Ideal method for primary cell transfection

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, L.
Right arrow Articles by Plow, E. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, L.
Right arrow Articles by Plow, E. F.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 28, Issue of July 11, 1997 pp. 17558-17564
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Identification and Reconstruction of the Binding Site within alpha Mbeta 2 for a Specific and High Affinity Ligand, NIF*

(Received for publication, January 30, 1997, and in revised form, April 4, 1997)

Li Zhang Dagger and Edward F. Plow

From the Joseph J. Jacobs Center for Thrombosis and Vascular Biology, Department of Molecular Cardiology, The Cleveland Clinic Foundation, Cleveland, Ohio 44195

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES


ABSTRACT

Engagement of the alpha Mbeta 2 (CD11b/CD18, Mac-1) integrin on neutrophils supports adhesion and induces various cellular responses. These responses can be blocked by a specific ligand of alpha Mbeta 2, neutrophil inhibitory factor (NIF). The molecular basis of alpha Mbeta 2-NIF interactions was studied. The single chain alpha M subunit, expressed on the surface of human 293 cells, bound NIF with an affinity equivalent to that of alpha Mbeta 2 heterodimer. This observation, coupled with previous data showing that the alpha MI domain alone supported high affinity NIF binding, indicated that the binding site for NIF is restricted to the I domain. Guided by the crystal structure of the alpha MI domain, 16 segments corresponding to the entire outer hydrated surface of alpha MI domain were switched to their counterparts sequences in alpha L, which does not bind NIF. Surface expression and heterodimer formation were achieved for all mutants, and correct folding was confirmed. Of the 16 switches, only 5 affected NIF binding substantially, reducing affinity by 8-300-fold. These data confined the NIF-binding site to a narrow region composed of Pro147-Arg152, Pro201-Lys217, and Asp248-Arg261 of alpha M. Verifying this localization, when these segments were introduced into the alpha XI-domain, the resulting chimeric receptor was converted into a high affinity NIF-binding protein.


INTRODUCTION

alpha Mbeta 21 (Mac-1, CR3, CD11b/CD18) is a member of the beta 2 integrin subfamily, which includes alpha Lbeta 2 (LFA-1, CD11a/CD18), alpha Xbeta 2 (p150, 95, CD11c/CD18), and alpha Dbeta 2. These integrins share a common beta  subunit of 95 kDa which is noncovalently linked to distinct but homologous alpha  subunits (1, 2). The physiological functions of alpha Mbeta 2 include roles in adhesion and transmigration of leukocytes through endothelium (3), phagocytosis of foreign materials (4), and activation of neutrophils and monocytes (5). Excessive activation of alpha Mbeta 2 contributes to sustained inflammation, reperfusion injury, and tissue damage (6). The importance of the beta 2 integrin subfamily is underscored by the severe phenotype of individuals with congenital deficiencies of these integrins (7).

NIF (neutrophil inhibitory factor), a novel glycoprotein isolated from canine hookworms, was originally identified as an inhibitor of a number of neutrophil functions, such as adhesion to endothelial cells and adhesion-dependent release of hydrogen peroxide (8). These functional effects resulted from its specific binding to alpha Mbeta 2 but not to other beta 2 integrins. Subsequently, we and others have reported that NIF completely blocked alpha Mbeta 2-mediated binding of C3bi (9), ICAM-1(10), and adhesion to protein-coated surfaces (11), and partially blocked fibrinogen binding (12) to alpha Mbeta 2-bearing cells. As an antagonist, NIF has been shown effective in attenuating the deleterious effects of excessive neutrophil activation, such as tissue damage and ischemia-reperfusion injury in animal models (13, 14).

The I domain, an inserted region of ~200 amino acids in the alpha M subunit (alpha MI-domain), contributes to NIF binding to alpha Mbeta 2 (10, 12). I domains with highly conserved amino acid sequences are also found in several other integrin alpha -subunits as well as in other proteins, such as vWF, and mediate a variety of protein-protein interactions, including ligand binding to integrins (15). Using blocking mAbs which map to the I domain or recombinant alpha MI domain itself, this region has been implicated in the binding of ICAM-1, fibrinogen (16), and C3bi (9), as well as NIF, to alpha Mbeta 2. Collectively, these data suggest that the alpha MI domain is an independent structural unit, capable of interacting with many different proteins. Nevertheless, the ligand binding functions of alpha Mbeta 2 are not solely a property of its I domain. We (11) and Bajt et al. (17) have shown that mutations of Asp134, Ser136, or Ser138 in beta 2 subunit abrogated the binding of alpha Mbeta 2 to C3bi and adhesion to protein-coated surfaces, suggesting that, in addition to I domain, the beta  subunit also is involved in the recognition of certain ligands by alpha Mbeta 2.

In this study, we have utilized NIF as a model alpha Mbeta 2 ligand and have sought to delineate the molecular basis for its interaction with alpha Mbeta 2. Homolog-scanning mutagenesis (18) in which sequences within the alpha MI domain have been switched to the homologous sequences within the alpha LI domain has been used to map the NIF-binding site in alpha Mbeta 2. The NIF-binding site identified through the loss-of-function mutations was confirmed by a gain-in-function experiment, whereby the I domain of alpha X was converted into a NIF-binding protein. Given the ability of NIF to inhibit the binding of many ligands to alpha Mbeta 2 and the structural similarities among I domains, the molecular details of NIF-alpha Mbeta 2 interactions may also apply to other ligands of alpha Mbeta 2 and to other I domain containing intergrins.


EXPERIMENTAL PROCEDURES

Materials

Human kidney 293 cells and the expression vector, pCIS2M, were generous gifts from Dr. F. J. Castellino (Notre Dame, IN). The cDNA of CD11b and CD18 were obtained from Dr. B. Karan-Tamir (Amgen, Thousand Oaks, CA). NIF was a gift from Corvas Int., San Diego, CA. TS1/18, OKM1, M1/70, IB4, 44a, 904, and LM2/1 were from ATCC (ATCC, Rockville, MD). G418, Dulbecco's modified Eagle's medium/F-12, HBSS (Hank's balanced solution), DH5alpha cell, and restriction enzymes were from Life Technologies, Inc. (Grand Island, NY). All other reagents were the highest grade available from Sigma unless otherwise noted.

Segment Switches by Site-directed Mutagenesis

Stretches of 7-12 amino acids within the alpha MI domain were switched to the corresponding sequences in alpha L. All such segment switches were created by oligonucleotide-directed mutagenesis using uracil-containing single stranded M13mp18 DNA (19). To facilitate the mutagenesis, two unique restriction sites, ClaI at position 535 (Ile139), and NheI, at position 1141 (Ala342), flanking the I domain of alpha M, have been introduced into alpha M previously (11). To switch a segment of 7-11 amino acids from alpha M to alpha L, the mutagenic primer was designed to contain the corresponding mutations and 15 additional unchanged bases at each end. The length of the primer was typically 54 bases. The site-directed mutagenesis was performed according to our published procedure using T7 DNA polymerase (19). The mutant was identified by DNA sequencing of 5 randomly picked plaques. DNA sequencing of the entire I domain was conducted, confirming the presence of the desired mutations and the correctness of the rest of the I domain. The mutated I domain was transferred back to the expression vector pCIS2M-alpha M using the unique ClaI and NheI restriction sites. The cDNA of alpha M and beta 2 were inserted separately in the pCIS2M expression vector employing XbaI and XhoI sites; and expression of alpha M or beta 2 was under the control of the human cytomegalovirus promoter and enhancer.

To generate the chimeric molecule, alpha M(I/alpha X)beta 2, where the alpha MI domain was replaced with alpha XI domain, the fragment of the alpha XI-domain (Ile137 to Val340) containing ClaI and NheI restriction sites was prepared by reverse transcription and polymerase chain reaction using total RNA from polymorphonuclear cells and the following two primers: 5'-CCCAAGACAGGAGCAGGACATTG-3' (forward) and 5'-TGTGAAGCTAGCGCTGAAGCCCTC-3' (reverse). The reverse primer contains a NheI site (GCTAGC), and a naturally occurring ClaI site exists in the alpha X cDNA at nucleotide position 530.

To graft the NIF-binding site in the alpha XI domain, five segments of alpha MI domain (I142PHDFRR, K200PITQLLG207, R208THTATGI, D248PLGY, and E253DVIP) were substituted sequentially for their counterparts (SSRNFAT, ASVHQLQG, FTYTATAI, DSLDY, and KDVIP, respectively) in alpha XI domain using M13mp19 vector and the following primers: 5'-GATGGCTCAGGCAGCATTATCCCCCTGACTTTCGCAGAATGATGAACTTCGTG-3', 5'-CCCCTCAGCCTGTTGAAGCCTATCACACAGCTGCAAGGGTTT-3', 5'-CCTATCACACAGCTGCTGGGACGCACACACACGGCCACCGCCATC-3', and 5'-AAGAAAGAAGGCGACCCACTTGGCTACGAAGATGTCATCCCCATG-3'. The modified alpha XI domain was sequenced, confirming not only the intended switches but also the correctness of the entire I domain. The new chimera containing the grafted I domain, alpha M(I'/alpha X)beta 2, was created by transferring the modified alpha XI-domain back into the chimeric integrin alpha M(I/alpha X)beta 2 employing the ClaI and NheI sites identified above.

Expression of alpha Mbeta 2 in 293 Cells

The expression vectors containing wild-type and mutated alpha M (pCIS2M-alpha M) and beta 2 (pCIS2M-beta 2) were purified using CsCl gradients and transfected, together with pRSVneo (neomycin-resistant gene), into 293 cells according to our established procedures (19). G418 (600 µg/ml)-resistant colonies were pooled and alpha Mbeta 2-expressing cells were sorted by FACS (FACStar, Becton-Dickinson, San Jose, CA), using alpha M-specific mAb, OKM1, which recognizes an epitope outside of the I domain (20).

FACS Analysis

Approximately 106 cells in HBSS containing 1 mM Mg2+ were incubated with 5 µg of mAb for 30 min at 4 °C. A subtype-matched mouse IgG served as a control. After 3 washes with PBS (10 mM NaPO4, 150 mM NaCl, pH 7.4), cells were mixed with fluorescein isothiocyanate goat anti-mouse IgG(H+L) F(ab')2 fragment (1:20 dilution) (Zymed Laboratory, San Francisco, CA), kept at 4 °C for another 30 min, washed with PBS, and then resuspended in 500 µl of PBS. The FACS analysis was performed using FACScan, counting 10,000 events. For dual color FACS analysis, the cells (106) were stained with OKM1 (5 µg) and biotinylated NIF (0.5 µg) for 30 min at 4 °C, followed by three washes with PBS. These cells were then mixed with fluorescein isothiocyanate-avidin conjugate and phycoerythrin goat anti-mouse IgG(H+L) F(ab')2 fragment (1:20 dilution) (Zymed Laboratory), kept at 4 °C for another 30 min, washed with PBS, and then resuspended in 500 µl of PBS. FACS analyses was performed as described above. The same procedure was used for mAb 24 staining, except that 1 mM Mn2+ was substituted for the 1 mM Mg2+ and incubations were at 37 °C.

Analytical Procedures

The procedures used for NIF binding, and surface labeling and immunoprecipitation of cells have been described (11). Briefly, different concentration of NIF (0-20 µg) were incubated with 2 × 106 alpha Mbeta 2-expressing cells at 4 °C for 30 min. The bound NIF was separated from the free NIF by centrifugation through a 20% sucrose solution and counted with a gamma -counter. The NIF titration data were fitted to a single site binding model using the equation: [NIF]bound Bmax*[NIF]/(Kd + [NIF]), where Bmax is the maximal NIF binding and Kd is the dissociation constant, using a program in SigmaPlot (Jandel Co., San Rafael, CA).


RESULTS

The alpha M Subunit Is Capable of High Affinity NIF Binding

When introduced into human kidney 293 cells in the absence of transfected beta 2, the alpha M subunit was expressed on the cell surface, albeit at low levels relative to the heterodimer. Immunoprecipitation of surface-labeled cells with OKM1 yielded a band of 165 kDa on polyacrylamide gels in SDS under both reducing and nonreducing conditions (Fig. 1A). No bands in the vicinity of 95 (beta 2) or 120 (beta 1) kDa were observed, suggesting that the surface-expressed alpha M is not complexed with its natural partner, beta 2, or with other typical integrin beta  subunits. No bands were observed for mock transfection with either OKM1 or TS1/18 (Fig. 1B), verifying the specificity of the immunoprecipitation. The presence of alpha M was confirmed by FACS analysis. The transfected cells were positive with OKM1, LM2/1, 2LPM19c, 44a, and 904, mAbs to the alpha  subunit, whereas mAbs to the beta 2 subunit, TS1/18, IB4, or MHM23 were unreactive. Bilsland et al. (21) also detected surface expression of the alpha M subunit in the absence of beta 2 in COS cells. The ability of the alpha M subunit to interact with soluble 125I-NIF was assessed. As shown in Fig. 1C, the alpha M-expressing cells bound NIF in a dose-dependent and saturable fashion. The specificity of this binding was verified by addition of a 20-fold excess of unlabeled NIF or 1 mM EDTA: in both cases, 125I-NIF binding was reduced by more than 99%. Scatchard plots of the NIF binding isotherms were consistent with a single class of binding sites with respect to affinity and yielded a dissociation constant (Kd) of 2.1 nM. This value is very similar to the Kd of 7 nM for NIF binding to heterodimeric alpha Mbeta 2. To determine the nature of the molecule on the cell surface that binds NIF, lysate of surface-labeled alpha M-transfected cells were incubated with biotinylated NIF. The NIF-receptor complex was captured with avidin-agarose resin and analyzed on 7% SDS-PAGE. As shown in Fig. 1B, only one band of 165 kDa was present. In contrast, two bands (165 and 95 kDa) were observed for the alpha Mbeta 2-expressing cells. The specificity of this assay was demonstrated by the absence of any band for the mock transfectant. These data indicate that, unlike other alpha Mbeta 2 ligands (C3bi and adhesion (11)), all major contributing elements of the binding site for NIF reside in the alpha  subunit of alpha Mbeta 2. Consistent with this conclusion, we also found that: 1) mutations in the beta 2 subunit, which abrogated binding of other ligands, did not affect NIF binding of alpha Mbeta 2 complex (11); and 2) replacement of the alpha M with the alpha XI domain in the context of the alpha Mbeta 2 heterodimer completely abrogated NIF binding (see below, Fig. 5).


Fig. 1. Immunoprecipitation and NIF binding to cells transfected with the alpha M subunit. For panels A and B, alpha M-expressing or mock transfected 293 cells (1 × 106) were surface labeled with Na125I and lactoperoxidase. Immunoprecipitation was performed as follows. A, alpha M-expressing cells were immunoprecipitated with 10 µg of OKM1, a mAb to alpha M (lanes 1 and 2), or TS1/18, a mAb to beta 2 (lane 3), overnight at 4 °C. B, alpha M-expressing cells (lanes 1 and 2) or mock transfectant (lanes 3-5) were precipitated with 0.5 µg of biotinylated NIF (lanes 1 and 3), 10 µg of IV.3, an irrelevant mAb (lane 2), 10 µg of OKM1 (lane 4), and 10 µg of TS1/18 (lane 5). The wild-type heterodimer, alpha Mbeta 2, precipitated with 0.5 µg of biotinylated NIF (lane 6) was included as a control. After washing, the immunoprecipitates were subjected to 7% SDS-PAGE and exposed to Kodak XAR-5 film for 72 h. Lane 2 in panel A is run under reducing condition. C, alpha M-expressing cells (bullet ) or mock-transfected 293 cells (open circle ) at 5 × 106 cells/ml were incubated with different concentrations of 125I-NIF in HBSS containing 2.5 mM Ca2+ for 30 min at 22 °C. Bound and free ligands were separated by centrifugation through 20% sucrose, and the cell associated radioactivity was measured by gamma -counter. The data are representative of two independent experiments.
[View Larger Version of this Image (22K GIF file)]


Fig. 5. The chimeric alpha M(I'/alpha X)/beta 2 receptor, created by grafting of the identified NIF-binding site into alpha XI domain, acquires the ability to interact with NIF with high affinity. Cells (2 × 106) expressing the chimeric receptor, alpha M(I/alpha X)/beta 2, containing the wild-type alpha XI (open circle ) or the five segments implicated in NIF binding (bullet ) were incubated with different concentrations of 125I-NIF in HBSS containing 2.5 mM Ca2+ for 30 min at 22 °C. Bound and free ligands were separated by centrifugation through 20% sucrose, and the cell associated radioactivity was measured. The data are representative of two independent experiments.
[View Larger Version of this Image (14K GIF file)]

The I Domain Peptide N232AFKILVVITDGEK Is Not Required for NIF Binding

Rieu et al. (10) had previously used synthetic peptides and implicated two candidate alpha M sequences in NIF binding: the A7 peptide, N232AFKILVVITDGEK, was the most potent inhibitor of NIF binding to the alpha MI domain (10). To test the role of this sequence in NIF binding, we created two switch mutants in which the amino- and carboxyl-terminal portions of this peptide were changed individually to the corresponding sequences in alpha L (alpha Lbeta 2 does not bind NIF (8): alpha M (K231NAFKILVVITDGEK245FG) to alpha L (PDATKVLIIITDGEATD). Thus, the first mutant, alpha M(K231NAF), changed the amino-terminal non-conserved KNAF to PDAT, and the second mutant, alpha M(K245FG), changed to non-conserved KFG to ATD. The hydrophobic cluster in the center of the peptide sequence is well conserved and was not altered. The mutant alpha M vectors were transfected together with beta 2 into 293 cells. Both mutants were expressed well on the cell surface as judged by FACS analysis, and surface labeling and immunoprecipitation with OKM1 (data not shown). When stained with LM2/1 mAb, the mean fluorescence for the alpha M(K231NAF)beta 2 mutant was 392.0, compared with 398.4 for wild-type. A similar result was obtained for the alpha M(K245FG)beta 2 mutant. When stained with OKM1, the mean fluorescence was 377.2 for the mutant and 380.1 for the wild-type. Both mutants also bound NIF with high affinity (Fig. 2, and Table II), indicating that this peptide is not centrally involved in NIF binding when placed in the context of the intact receptor.


Fig. 2. NIF binding to transfected cells expressing wild-type and mutant alpha Mbeta 2. Cells (2 × 106/ml) expressing wild-type or mutant (K231NAF to PDAT or K245FG to ATD) alpha Mbeta 2 were incubated with 125I-NIF (0.5 µg) in the presence (filled bar) or absence (open bar) of 10 µg of unlabeled NIF in HBSS containing 2.5 mM Ca2+ for 30 min at 22 °C. Bound and free ligands were separated by centrifugation through 20% sucrose, and the cell associated radioactivity was measured in a gamma -counter. The data are the means ± S.D. of two independent experiments.
[View Larger Version of this Image (21K GIF file)]

Table II. Kd values for binding of NIF to the wild-type and mutant alpha Mbeta 2 receptors


Mutant Segment switched Kd
nM S.D.

1 WT 7.0 1.6
2 P147-R152 PHDFRR 232.4 63.3
3 M153-T159 MKEFVST 11.5 0.5
4 E162-L170 EQLKKSKTL 5.0 2.7
5 E178-T185 EEFRIHFT 28.9 11.0
6 Q190-S197 QNNPNPRS 14.3 8.0
7 P201-G207 PITQLLG 2153.4 723
8 R208-K217 RTHTATGIRK 1451.1 378
9 K231-NAF KNAF 11.8 0.9
10 K245FG KFG 5.4 1.3
11  Delta D248-Y252 DPLGY 89.5 2.4
12 E253-R261 EDVIPEADR 55.9 8.5
13  Delta E262G EG 21.0 2.7
14 D273-K279 DAFRSEK 15.3 5.4
15 R281-I287 RQELNTI 22.5 5.1
16 F297-T307 FQVNNFEALKT 12.2 4.6
17 Q309-E314 QNQLRE 14.3 4.9
18  alpha M 2.1 0.5

Homolog-scanning Mutagenesis

To systematically define the NIF-binding site in alpha M, a homolog-scanning mutagenesis (18) strategy was implemented. Accordingly, guided by the crystal structure (15), the entire hydrated surface of the alpha MI domain was replaced with sequences of the alpha LI domain in segments of 7-11 amino acids. To apply this approach to the I domain of alpha M (~200 amino acids), 16 segments were switched. The primers used are listed in Table I. The efficiency of mutagenesis was typically 60%, with the 7-amino acid segment switches having substantially higher efficiency (>90%) than the longer 10-amino acid segment switches (~30%). The appropriate DNA sequence of the entire I domain (from Ile139 to Ala332) was confirmed for each mutant before transferring back into the alpha M subunit cDNA.

Table I. Mutagenic primers used in the homolog-scanning mutagenesis of the alpha MI domain


Mutant name Position From To Mutagenic primer (from 5' to 3')

1 P147-R152 147 -152 PHDFRR IEDFEL        GACAAACTCCTTCATGAGCTCAAAGTCCTCGATGATGATGCTACCAGA
2 M153-T159 153 -159 MKEFVST ILDFMKD       TAATTGCTCCATCACGTCTTTCATGAAGTCCAGGATCCGCCGAAAGTCATG
3 E162-L170 162 -170 EQLKKSKTL KKLSNTSYQ    CTGCATCAAAGAGAACTGGTAGCTGGTGTTGCTTAATTTCTTCATCACAGTTGAGAC
4 E178-T185 178 -185 EEFRIHFT TSYKTEFD     CTGGAACTCTTTGAAGTCGAACTCGGTTTTGTAGCTGGTAGAGTACTGCATCAA
5 Q190-S197 190 -197 QNNPNPRS VKWKDPDA     TATTGGCTTCACCAGTGCGTCGGGGTCTTTCCATTTAACGAACTCTTTGAAGGT
6 P201-G207 201 -207 PITQLLG HVKHMLL      GGCCGTGTGTGTCCGCAGAAGCATGTGTTTGACGTGTTTCACCAGTGATCTT
7 R208-K217 208 -217 RTHTATGIRK LTNTFGAINY  CAGCTCTCGTACCACGTAGTTGATGGCCCCGAACGTGTTTGTCAGCCCAAGCAGCTGCGT
8 K231NAF 231 -234 KNAF PDAT               ACTAGGATCTTAGTGGCATCAGGTCGGGCTCCGTT
9 K245FG 245 -247 KFG ATD             ATATCCCAAGGGATCGTCTGTGGCTTCTCCATCCGTGAT
10  Delta D248-Y252 248 -252 DPLGY                  AGGGATGACATCCTCGCCAAACTTTTCTCC
11 E253-R261 253 -261 EDVIPEADR SGNIDAAKD    GCGAATGACTCCCTCGTCTTTTGCAGCATCGATGTTGCCGCTATATCCCAAGGGATC
12  Delta E262G 262 -263 EG                  GACGTAGCGAATGACTCTGTCTGCCTCAGG
13 D273-K279 273 -279 DAFRSEK KHFQTKE       AGCTCTTGGCGGGATTCCTTAGTCTGAAAGTGCTTGCCCACCCCAATGACG
14 R281-I287 281 -287 RQELNTI QETLHKF       AGGCGGCTTGGATGCGAATTTGTGAAGTGTTTCCTGGGATTTCTCACTGCG
15 F297-T307 297 -307 FQVNNFEALKT KILDTFEKLKD AAGCTGGTTCTGAATGTCCTTGAGTTTTTCGAATGTATCCAGGATTTTCACGTGATCACGAGG
16 Q309-E314 309 -314 QNQLRE FTELQK        GATCGCAAAGATCTTCTTCTGCAGCTCGGTAAAAATGGTCTTCAGAGC

The functional consequences of these segment switches were initially investigated by transient expression in 293 cells. Forty-eight hours after transfection of alpha M, together with beta 2 subunit, the cells were detached from tissue culture dish and double stained with OKM1 and biotinylated NIF. A representative dual-color FACS analysis is shown in Fig. 3. With wild-type alpha Mbeta 2 transfectant, 1.83% of the cells were positive with both OKM1 and NIF, whereas less than 0.02% of mock transfected cells were positive. Two distinct patterns were observed for the mutants. One, represented by alpha M(E178-T185) in Fig. 3, in which a similar percentage (1.12%) of the cells were positive for both markers, i.e. exhibiting a pattern similar to the wild-type alpha Mbeta 2 cells. The second pattern is represent by alpha M(Delta D248-Y252), in which a substantial percentage of cells were positive with OKM1 (22.5%) but negative with NIF (<0.05%), indicating a loss in NIF-binding function. The following mutants belonged to the first category: alpha M(M153-T159), alpha M(E162-L170), alpha M(E178-T185), alpha M(Q190-S197), alpha M(K231NAF), alpha M(K245FG), alpha M(Delta E262G), alpha M(D273-K279), alpha M(R281-I287), alpha M(F297-T307), and alpha M(Q309-E314). Belonging to the second category were: alpha M(P147-R152), alpha M(P201-G207), alpha M(R208-K217), alpha M(Delta D248-Y252), and alpha M(E253-R261).


Fig. 3. Dual-color FACS analysis of cell transiently expressing wild-type or mutant alpha Mbeta 2 receptors. alpha Mbeta 2-expressing cells (106) were stained with OKM1 (5 µg) and biotinylated NIF (0.5 µg) in the presence of 1 mM Mg2+ for 30 min, washed with PBS, and then mixed with fluorescein isothiocyanate-avidin and phycoerythrin goat anti-mouse IgG conjugate. After an additional 30 min, the cells were washed with PBS and analyzed using a FACScan, counting 10,000 events. The percentage of cells falling within each quadrant is indicated. A, mock; B, alpha Mbeta 2; C, alpha M(Delta D248-Y252)beta 2; D, alpha M(E178-T185)beta 2.
[View Larger Version of this Image (55K GIF file)]

The NIF-binding Site Is Composed of Segments P147-R152, P201-G207, R208-K217, D248-T252, and E253-R261

To quantitate the binding affinities of each mutant receptor for NIF, stable cell lines were established. All 16 alpha Mbeta 2 mutants were cell surface expressed as heterodimers: immunoprecipitations of 125I-surface-labeled cells with OKM1 yielded alpha  subunits of 165 kDa and beta  subunits of 95 kDa on 7% SDS-PAGE (a representative gel is shown in Fig. 4A), similar to the patterns obtained with that of recombinant wild-type and naturally-occurring alpha Mbeta 2 (11). Identical patterns were obtained when the immunoprecipitations were performed with TS1/18, a mAb to the beta 2 subunit (data not shown). The specificity of this assay was verified by the absence of any band when 125I-surface-labeled mock transfected cells were immunoprecipitated with either OKM1 or TS1/18 (Fig. 1B), or when wild-type alpha Mbeta 2-expressing cells were immunoprecipitated with IV.3, an irrelevant mAb (11). NIF binding was measured as a function of ligand concentrations, and representative binding isotherms are presented in Fig. 4B. With all mutants, dose-dependent and saturable binding of 125I-NIF was observed, which could be inhibited by unlabeled NIF and EDTA. The binding isotherms could be fitted to a one-site model as described under "Experimental Procedures." The Kd values calculated from these binding data are summarized in Table II. The Kd of 7 nM for wild-type alpha Mbeta 2 was nearly identical to the Kd of 5 nM reported for naturally-occurring alpha Mbeta 2 on neutrophils (8). The expression levels, reflected by the maximal NIF binding, were similar for all mutants, differing by less than 4-fold. The following mutants had similar Kd values (<4-fold different than wild-type alpha Mbeta 2): alpha M(M153-T159), alpha M(E162-L170), alpha M(E178-T185), alpha M(Q190-S197), alpha M(K231NAF), alpha M(K245FG), alpha M(Delta E262G), alpha M(D273-K279), alpha M(R281-I287), alpha M(F297-T307), and alpha M(Q309-E314). The most dramatic increases in Kd values were found for five mutants: alpha M(P147-R152) (33-fold), alpha M(P201-G207) (305-fold), alpha M(R208-K217) (206-fold), alpha M(Delta D248-Y252) (13-fold), and alpha M(E253-R261) (8-fold).


Fig. 4. A, immunoprecipitation of 125I-surface-labeled stable cell lines expressing wild-type and mutant alpha Mbeta 2. alpha Mbeta 2-expressing cells (1 × 106) were surface labeled with Na125I and lactoperoxidase, and immunoprecipitated with 10 µg of OKM1. After washing, the immunoprecipitates were subjected to SDS-PAGE (7% gels under nonreducing conditions) and exposed to Kodak XAR-5 film for 48 h. Lane 1, alpha M(Delta E262G)beta 2; lane 2, alpha M(K245FG)beta 2; lane 3, alpha M(Delta D248-Y252)beta 2; lane 4, alpha M(E253-R261)beta 2; lane 5, alpha M(D273-K279)beta 2; lane 6, alpha M(R281-I287)beta 2. The selected patterns are representative of all 16 cell lines expressing the various alpha Mbeta 2 mutants. B, binding of NIF to wild-type and mutant alpha Mbeta 2 transfectants. Titrational analysis of NIF binding to wild-type and mutant alpha Mbeta 2-expressing cells was conducted as described in Fig. 1C. The wild-type (bullet ) and two representative mutants, alpha M(P147-R152)beta 2 (open circle ) and alpha M(R208-K217)beta 2 (black-down-triangle ), are shown. The data are representative of at least two independent experiments. C, reactivity of alpha Mbeta 2 mutants with mAb 24. alpha Mbeta 2-expressing cells were incubated with mAb 24 or OKM1 in the presence of 1 mM Mn2+ for 30 min at 37 °C. Cells were washed, then mixed with fluorescein isothiocyanate goat anti-mouse IgG(H+L) F(ab')2 fragment for another 30 min, washed, and analyzed by FACScan, counting 10,000 events. The ratios of the mean fluorescence intensities of each mutant cell line with mAb 24 and OKM1 were quantitated. The ratio for wild-type alpha Mbeta 2 receptor was assigned a value of 100%, and the OKM1 mAb fluorescence was used to normalize the expression levels of the alpha Mbeta 2 receptors on the different cell lines. Addition of 1 mM EDTA abolished mAb 24 reactivity toward all five mutants. The data are the means ± S.D. of two independent experiments.
[View Larger Version of this Image (47K GIF file)]

The Defective Mutants Possess Correct Conformations

Given the similarities in the three-dimensional structures of alpha MI and alpha LI domains (15, 22), it is unlikely that the defects in NIF binding of the five identified mutants arise from incorrect folding of their alpha MI domain. This assertion was supported by a series of additional experiments. First, FACS analyses were performed for all 16 mutants with a panel of mAbs against alpha Mbeta 2, including OKM1, LM2/1, M1/70, TS1/18, and MHM23. The former three are alpha M-specific, and the latter two are beta 2-specific. In all cases, the mAbs reacted well with wild-type and all five mutant receptors. Second, the reactivity of the five mutants with a conformation-dependent antibody, mAb 24, which has been used to probe the cation-dependent conformational integrity of alpha MI domain (23, 24), was assessed. FACS analyses were performed on the five mutants, together with the wild-type receptor. As a control, FACS analyses were performed in parallel with OKM1, a conformation-independent mAb. The ratios of the mean fluorescence intensities of the various cell lines with mAb 24 and OKM1 are shown in Fig. 4C. All of the mutants defective in NIF binding exhibited the capacity to bind mAb 24. Mutant alpha M(P201-G207) showed a slightly attenuated reactivity with mAb 24, suggesting a subtle perturbation of its structure. Nevertheless, binding of mAb 24 to this and the other mutants remained cation-dependent; addition of 1 mM EDTA completely abrogated mAb 24 binding. Thus, all mutants retained the cation-dependent conformation reported by mAb 24.

Reconstruction of NIF-binding Site in alpha XI Domain

When the I domain of alpha M (Ile139 to Ala342) was replaced with that of alpha X (Ile137 to Val340), the most closely related I domain to alpha MI domain in terms of primary structure but which still does not bind NIF (8), the expressed heterodimeric receptor, alpha M(I/alpha X)beta 2, had no NIF binding capacity (Fig. 5), albeit expressed well on 293 cell surface. When stained with mAb OKM1, the mean fluorescence of the alpha M(I/alpha X)beta 2 chimera was 281.2, compared with 279.0 for wild-type alpha Mbeta 2 receptor. This chimeric receptor continued to recognize the alpha Xbeta 2 mAb, clone 3.9, and to rosette with C3bi (data not shown), indicating the retention of functional integrity. To provide direct evidence that the identified segments (Pro147-Arg152, Pro201-Gly207, Arg208-Lys217, Asp248-Thr252, and Glu253-Arg261) constitute a functional NIF-binding site, we sought to impart NIF binding function to the chimeric receptor, alpha M(I/alpha X)beta 2, by grafting the five segments from alpha M into their counterparts' sequences in the alpha XI domain. The chimeric molecule, alpha M(I'/alpha X)beta 2, containing the reconstructed alpha XI domain, was expressed in 293 cells, and NIF binding was assessed using different concentrations of 125I-NIF (Fig. 5). While the chimeric receptor, alpha M(I/alpha X)beta 2, containing the wild-type alpha XI domain, did not bind NIF, upon grafting the five alpha M segments into alpha XI domain, full NIF binding function was imparted to the modified receptor. The reconstructed I domain has a Kd of 2 nM for NIF binding, essentially identical to that of the original wild-type alpha MI domain (7 nM). This interaction was blocked completely by EDTA (1 mM) or unlabeled NIF (10 µg), verifying that NIF binding to the reconstructed alpha XI domain remained cation-dependent and specific.


DISCUSSION

In this study, we have sought to map the binding site for NIF, a model ligand for the I domain of alpha Mbeta 2. First, we have demonstrated that the binding surface for NIF is located exclusively in the I domain of the receptor. This conclusion is supported by the observations that alpha M alone (Fig. 1C) or the expressed I domain (10, 12) support NIF binding with an affinity similar to that of the intact alpha Mbeta 2 heterodimer; that mutations in beta 2 subunit, known to abolish the binding of several other ligands to alpha Mbeta 2 (11, 17), have no effect on NIF binding; and that a swap of the alpha MI domain for the alpha XI domain in the context of the intact alpha Mbeta 2 receptor completely abolishes the NIF binding activity of the resulting chimeric receptor (Fig. 5). These observations also distinguish NIF binding from C3bi binding and adhesion to protein substrates mediated by alpha Mbeta 2, interactions which require both subunits (11). Second, we have scanned the entire hydrated surface of I domain by substituting 16 alpha L segments of 7-10 amino acids for their corresponding sequences in the I domain of alpha Mbeta 2. The approach of homolog-scanning mutagenesis had been previously employed to identify receptor and antibody epitopes in human growth hormone (18). Since the homologous segments of alpha M and alpha L adopted similar structures (15, 22), and the structurally important residues involved in cation coordination (Asp140, Ser142, Ser144, Thr209, and Asp242) are preserved, the structural integrity and the essential cation-binding site was maintained. Therefore, any functional changes resulting from the switches should reflect sequences that have a direct role in NIF binding. This strategy does not exclude a role for residues conserved among the two homologous proteins in NIF binding. Nevertheless, our study does identify segments that are required for a high affinity interaction with this ligand. Of these 16 segment-switch mutants, only five (P147-R152, P201-G207, R208-K217, D248-Y252, and E253-R261) lost their ability to bind NIF with high affinity, suggesting that the NIF-binding site is composed of these five short segments, two of which are contiguous (Fig. 4B, Table II). The loss of NIF binding function in these five mutants is unlikely to arise from incorrect conformational folding since: 1) these, as well as all 16 mutants, were expressed on the cell surface and heterodimeric complexes were formed (Fig. 4A); and 2) they all reacted with a panel of alpha Mbeta 2 mAbs, including the conformation-dependent antibody, mAb 24 (Fig. 4C). The reactivity of this mAb has been shown to depend on an intact conformation of the I domain (23). For mutant P201-G207, an attenuated reactivity with mAb 24 was observed, although its binding to mAb 24 remained cation-dependent. It is possible that this mutant has a slightly altered conformation; however, when this segment was grafted together with the other four segments into alpha XI domain, cation-dependent NIF binding activity was observed.

Recently, the crystal structures of both the alpha MI and alpha LI domains have been solved (15, 22). These two I domains adopt very similar folds (alpha /beta Rossmann folds), and both contain a unique metal-binding site (MIDAS motif) on their surface. The similarity in three-dimensional structures of alpha MI and alpha LI domains is in agreement with their highly homologous primary sequences and suggest that these regions have a common evolutionary origin. Based on the alpha MI domain structure (15) and the data from homolog-scanning, the binding interface for NIF is located in a very narrow region on the I domain surface (see Fig. 6). This region entails the beginning portion of helix 1, the loop between helix 3 and helix 4, the small segment leading to helix 5, and the entire helix 5. The binding site for Mg2+ is located at the edge of this binding surface. As a result, coordination to Mg2+ ion by NIF may provide additional energy for alpha Mbeta 2-NIF interactions. Such a ligation mechanism has been suggested for other integrin-ligand interactions (25); is consistent with the availability of additional coordination sites for a cation bound within a MIDAS motif (15); and may explain the cation dependence of NIF binding to alpha Mbeta 2. In support of our findings, while our study was in progress, Rieu et al. (26) recently identified several specific residues which are important for NIF-alpha Mbeta 2 interaction. Their study implicated residues Gly143 and Asp149, which reside in the Pro147-Arg152 segment, and Arg208 which resides in the Arg208-Lys217 segment. However, a discrepancy exists regarding the roles of Glu178 and Glu179; Rieu et al. (26) found that mutation of these two residues disrupted NIF binding, whereas we found that the Glu178-Tyr185 segment which contains these residues, was nonessential. As one possible explanation, in the study of Rieu et al., Glu178-Glu179 both were mutated to Ala, whereas we changed them to Thr and Ser, corresponding to their homologous sequences in alpha L; the former substitutions may indirectly disrupt the conformation of the spatially adjacent loop between helix 3 and 4 (see Fig. 6) which are directly involved in NIF binding.


Fig. 6. The NIF-binding site in the alpha MI domain. The structure of the I domain is modeled according to the crystal coordinates of the alpha MI domain (15) using the Biosym software. The backbone of the alpha MI domain is shown with oxygen atoms in red, hydrogen atoms in yellow, carbon atoms in green, and nitrogen atoms in blue. The NIF-binding site, as mapped in this study, is composed of three segments (P147-R152, P201-K217, and D248-R261) and is shown as a red ribbon.
[View Larger Version of this Image (114K GIF file)]

Since NIF blocks the interactions of alpha Mbeta 2 with many of its ligands, such as C3bi, ICAM-1, fibrinogen, and many immobilized substrates, the binding sites for these ligands are overlapping. Nevertheless, we have previously shown that the contact regions for these ligands are not identical (11). Thus, it is expected that the NIF-binding site identified here will constitute at least part of the binding surface for other alpha Mbeta 2 ligands. Indeed, both we (11) and Bajt's group (23) have shown that the Asp248-Tyr252 region is required for rosetting of EC3bi with alpha Mbeta 2 receptor. The binding interface on the alpha LI domain for ICAM-1 has been partially identified (25): key amino acids involved in this interaction are Met140, Glu146, Thr243, and Ser245. These residues reside within the regions corresponding to Pro147-Arg152 and Asp248-Tyr252 of alpha M, which we have implicated in NIF binding. The importance of the regions corresponding to Pro201-Gly207, Arg208-Lys217, and Glu253-Arg261 in alpha M were not tested for their involvement in ICAM-1 binding to alpha Lbeta 2.

As demonstrated in Fig. 5, grafting of the Pro147-Arg152, Pro201-Gly207, Arg208-Lys217, Asp248-Tyr252, and Glu253-Arg261 segments into alpha XI domain imparted NIF binding capacity to the chimeric receptor. The affinity of this chimeric receptor for NIF, 2 nM, was essentially the same as that for the alpha MI domain, suggesting that the NIF contact site is dependent upon the swapped regions. Thus, the loss-in-function identified by the homolog-scanning mutagenesis is supported by this gain-in-function experiment and is not due to disruption of conformation or loss of cation binding functions of the resultant alpha MI domain mutants. The successful implantation of the homolog-scanning mutagenesis strategy marks the first time that a ligand-binding domain within any integrin molecule has been systemically probed over its entire surface. With these analyses serving as proof of principle, the homolog-scanning strategy should allow mapping of the ligand binding site for other alpha Mbeta 2 ligands and other I domain-containing integrins. Experiments to test this hypothesis are in progress.


FOOTNOTES

*   This work was supported by grants from the National Institutes of Health, the American Heart Association, Northeast Ohio Affiliate, and the Arthritis Foundation.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Dagger    To whom correspondence should be addressed: Mail Code: FF20. Tel.: 216-445-8213; Fax: 216-445-8204.
1   The abbreviations used are: alpha Mbeta 2, wild-type receptor; FACS, fluorescence activated cell sorting; HBSS, Hank's balanced salt solution; mAb, monoclonal antibody; NIF, neutrophil inhibitory factor; PBS, phosphate-buffered saline; PAGE, polyacrylamide gel electrophoresis; alpha M(P147-R152)beta 2, the indicated segment within the alpha MI domain was switched to its homologous counterpart of the alpha LI domain; alpha M(I/alpha X)beta 2, the alpha MI domain within the alpha Mbeta 2 receptor was replaced by the alpha XI domain; alpha M(I'/alpha X)beta 2, the alpha MI domain within the alpha Mbeta 2 receptor was replaced by the modified alpha XI domain in which identified alpha MI domain segments involved in NIF binding have been inserted.

ACKNOWLEDGEMENTS

We thank Corvas International Inc. for NIF, Dr. N. Hogg of Imperial Cancer for mAb 24, and Dr. B. Karan-Tamir of Amgen for the cDNA for alpha M and beta 2. We are very grateful to Xiaohua (Sue) Wu for excellent technical support.


REFERENCES

  1. Springer, T. A. (1990) Nature 346, 425-434 [CrossRef][Medline] [Order article via Infotrieve]
  2. Arnaout, M. A. (1990) Blood 75, 1037-1050 [Free Full Text]
  3. Smith, C. W., Marlin, S. D., Rothlein, R., Toman, C., and Anderson, D. C. (1989) J. Clin. Invest. 83, 2008-2017
  4. Anderson, D. C., Miller, L. J., Schmalstieg, F. C., Rothlein, R., and Springer, T. A. (1986) J. Immunol. 137, 15-27 [Abstract]
  5. Shappell, S. B., Toman, C., Anderson, D. C., Taylor, A. A., Entman, M. L., and Smith, C. W. (1990) J. Immunol. 144, 2702-2711 [Abstract]