JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yao, J.
Right arrow Articles by Fan, S.-T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yao, J.
Right arrow Articles by Fan, S.-T.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 28, Issue of July 11, 1997 pp. 17795-17801
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Lipopolysaccharide Induction of the Tumor Necrosis Factor-alpha Promoter in Human Monocytic Cells
REGULATION BY Egr-1, c-Jun, AND NF-kappa B TRANSCRIPTION FACTORS*

(Received for publication, January 22, 1997, and in revised form, May 7, 1997)

Jin Yao , Nigel Mackman , Thomas S. Edgington and Sao-Tah Fan Dagger

From the Department of Immunology, The Scripps Research Institute, La Jolla, California 92037

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES


ABSTRACT

Biosynthesis of tumor necrosis factor-alpha (TNF-alpha ) is predominantly by cells of the monocytic lineage. This study examined the role of various cis-acting regulatory elements in the lipopolysaccharide (LPS) induction of the human TNF-alpha promoter in cells of monocytic lineage. Functional analysis of monocytic THP-1 cells transfected with plasmids containing various lengths of TNF-alpha promoter localized enhancer elements in a region (-182 to -37 base pairs (bp)) that were required for optimal transcription of the TNF-alpha gene in response to LPS. Two regions were identified: region I (-182 to -162 bp) contained an overlapping Sp1/Egr-1 site, and region II (-119 to -88) contained CRE and NF-kappa B (designated kappa B3) sites. In unstimulated THP-1, CRE-binding protein and, to a lesser extent, c-Jun complexes were found to bind to the CRE site. LPS stimulation increased the binding of c-Jun-containing complexes. In addition, LPS stimulation induced the binding of cognate nuclear factors to the Egr-1 and kappa B3 sites, which were identified as Egr-1 and p50/p65, respectively. The CRE and kappa B3 sites in region II together conferred strong LPS responsiveness to a heterologous promoter, whereas individually they failed to provide transcriptional activation. Furthermore, increasing the spacing between the CRE and the kappa B3 sites completely abolished LPS induction, suggesting a cooperative interaction between c-Jun complexes and p50/p65. These studies indicate that maximal LPS induction of the TNF-alpha promoter is mediated by concerted participation of at least two separate cis-acting regulatory elements.


INTRODUCTION

Tumor necrosis factor (TNF-alpha ),1 produced primarily by cells of monocytic lineage, is involved in a plethora of cell regulatory and differentiative processes. TNF-alpha is also a vital mediator of the host defense against infection and tumor formation. On the other hand, TNF-alpha is involved in the pathophysiology of numerous diseases including septic shock, cachexia, and various autoimmune diseases (1). Therefore, TNF-alpha exhibits both beneficial and pathologic effects, a feature that requires rigorous control of its expression. Regulation of human TNF-alpha expression in cells of monocytic lineage is quite complex, involving controls at both transcriptional and post-transcriptional levels (2). In addition, both 5' and 3' nucleotide sequences influence LPS-induced transcription of human TNF-alpha cDNA transfected into the murine macrophage RAW264.7 cell line (3).

The promoter region of the human TNF-alpha gene contains a complex array of potential regulatory elements. In T cells, cooperation between the CRE and the adjacent kappa B3 sites is required for calcium-mediated TNF-alpha promoter activity (4), and cooperation between the CRE and the adjacent Ets sites for PMA-induced activity (5). However, the role or these regulatory elements in transcriptional activation of the TNF-alpha gene in human monocytes remains unclear. To date, published reports indicate that activation of TNF-alpha gene transcription in human monocytes in response to various stimuli is mediated by a region within -200 bp upstream of the transcriptional start site (6-12). Using a promonocytic leukemia cell line, U937, several nuclear factor binding elements, including AP-1 (6), Egr-1 (7), CRE (8), C/EBPbeta (9), and AP-2 (10), have been suggested to mediate TNF-alpha transcription in response to PMA or cytokines. These results appear to be incomplete and often conflicting. No consensus has been reached, and no cooperation between these regulatory elements was established. Although the reasons for these discrepancies are unclear, the U937 cell line may be too poorly differentiated to serve as a suitable model of gene expression in cells of monocytic lineage.

Transcriptional activation of the murine TNF-alpha gene in murine macrophages has been demonstrated to be predominantly dependent on a region in the murine TNF-alpha promoter upstream of -451 bp, which contains NF-kappa B DNA binding motifs (13, 14). A major histocompatibility complex class II Y box was also inferred to play a role in LPS inducibility (13, 14). To date, the role of NF-kappa B in the transcriptional activation of the human TNF-alpha gene in human monocytes in response to LPS is controversial. An early study using murine monocytic cells failed to identify a role for the kappa B sites in transcriptional activation of human TNF-alpha in response to LPS or virus (15). However, recent reports employing pharmacological agents that block the nuclear translocation of NF-kappa B, such as pyrrolidine dithiocarbamate (16), and sodium salicylate (17), demonstrated a suppression of TNF-alpha gene expression. Moreover, LPS induction of the human TNF-alpha promoter in human monocytic THP-1 leukemia cells was mediated by the kappa B3 site at -97 bp (11). Taken together, these results suggest a likelihood that murine monocytic cells are not suitable for the analysis of the regulation of the human TNF-alpha promoter.

In this study, we have employed a line of THP-1 cells that exhibits high inducibility for TNF-alpha gene transcription similar to that of freshly isolated human monocytes. We have performed a comprehensive analysis of the role of various cis-acting regulatory elements in the transcriptional regulation of the human TNF-alpha gene. Using LPS stimulation as a paradigm, we find that a mechanism involving several transcription factors is required for maximal TNF-alpha promoter activity in human monocytes.


EXPERIMENTAL PROCEDURES

Cell and Reagents

THP-1 monocytic cells were maintained in medium RPMI 1640 with 8% fetal calf serum. Human peripheral blood monocytes were isolated by gradient centrifugation as described (18). Antibodies used in electrophoretic mobility shift assay (EMSA): anti-Egr-1, anti-CREB, anti-ATF-2, anti-c-Jun, anti-JunB, anti-JunD, anti-c-Fos, anti-Fos B, anti-p50, anti-p65, anti-c-Rel, and anti-Ets1/2 were form Santa Cruz Biotechnology (Santa Cruz, CA).

Plasmids

5'-Deletion Series

pTNF(-1311)Luc, pTNF(-1185)Luc, pTNF(-615)Luc, pTNF(-479)Luc, pTNF(-295)Luc, pTNF(-120)Luc, pTNF(-95) Luc, and pTNF(-36)Luc (19) were generously provided by Dr. J. Economou (UCLA, Los Angeles, CA). pTNF(-182)Luc and pTNF(-161)Luc were produced by cloning polymerase chain reaction fragments containing sequences of -182 to +15 or -161 to +15, respectively, into the SmaI site of the pXP1 expression vector.

Mutant Series

Plasmids containing site-specific mutations at AP-1, AP-2, or CRE sites (6) were provided by Dr. J. Economou. Additional mutant plasmids in this series were produced according to methods described in the Transformer site-directed mutagenesis kit (CLONTECH, Palo Alto, CA). The sequences of the oligonucleotides with site-specific mutations used for these constructs are listed in Table I.

Table I. Oligonucleotides used in this study

Respective binding sequences are in bold type. Base substitutions or insertions are underlined.
Name Position Sequence (5'-3')

Egr-1  -168 to -145 CCCCGCCCCCGCGATGGAGAAGAA
Egr-1m  -168 to -145 CCCCGCCCCAGATATCGAGAAGAA
CRE  -112 to -92 TCCAGATGAGCTCATGGGTTC
CREm1  -112 to -92 TCCAGATGAGTGTATGGGTTC
CREm2  -112 to -92 TCCAGATCTCATCATGGGTTC
 kappa B1  -594 to -577 AAGCCTGGGACAGCCCCG
 kappa B2  -217 to -200 TGTGAGGGGTATCCTTGA
 kappa B3  -103 to -86 GCTCATGGGTTTCTCCAC
 kappa B3m1  -103 to -86 GCTCATTTATTTCTCCAC
 kappa B3m2  -105 to -82 CAGCTCATGGATATCTCCACCAAG
 -182/-157  -182 to -157 CTTCCAAATCCCCGCCCCCGCGATG
 -182/-157ml  -182 to -157 CTTTCCAAATATTCGCCCCCGCGATG
 -110/-86  -110 to -86 CAGATGAGCTCATGGGTTTCTCCAC
 -110/-86ml  -110 to -86 CAGATCTCATCATGGGTTTCTCCAC
 -110/-86m2  -110 to -86 CAGATGAGCTCATGAATTTCTAAAC
 -110/-86+5  -110 to -86 CAGATGAGCTCATATCGTGGGTTTCTCCAC
 -110/-86+10  -110 to -86 CAGATGAGCTCATATCGTATCGTGGGTTTCTCCAC
 -110/-86+15  -110 to -86 CAGATGAGCTCATATCGTATCGTATCGTGGGTTTCTCCAC

Heterologous Promoter Series

Multiple copies of oligonucleotides containing sequences from the human TNF-alpha promoter were cloned upstream of the minimal SV40 promoter driving expression of the luciferase reporter gene in pGL2-promoter (Promega Corp.). Sequences of oligonucleotides used for producing these constructs are listed in Table I. All plasmids were verified by DNA sequencing.

DNA Transfection

A DEAE-dextran transfection procedure (18, 20) was used. Briefly, 3 × 107 THP-1 cells were resuspended in 1 ml of Tris-buffered saline and incubated for 10 to 20 min at 37 °C with 5 µg of plasmid DNA and 80 µg of DEAE-dextran (Pharmacia, Uppsala, Sweden). During incubation, cells were monitored closely for permeability to trypan blue. Transfection was stopped by adding large volumes of Tris-buffered saline, usually after 10 min, when 20-30% of cells are permeable to trypan blue. After washing with Tris-buffered saline, cells were cultivated in media for 48 h. Cells were stimulated with 5 µg/ml LPS (Escherichia coli O111:B4 purchased from Calbiochem, La Jolla, CA) in a 96-well plate at 1 × 106 cells/well. After 7 h of incubation at 37 °C, cells were harvested and luciferase activity was determined using an assay kit (Promega) and the Monolight 2010 luminometer (Analytical Luminescence Laboratory, San Diego, CA).

Nuclear Extracts and EMSA

Nuclear extracts were prepared from 5 × 106 THP-1 cells or peripheral blood monocytes stimulated under various conditions as described (18, 20). Protein concentrations in nuclear extracts were determined by BCA protein assay (Pierce). Oligonucleotide probes were radiolabeled using [alpha -32P]dCTP (Amersham). Nuclear extracts (1-5 µg) were incubated with radiolabeled oligonucleotide probes (0.2-1 × 106 cpm) in 2 × binding buffer (100 mM KCl, 1 mM EDTA, 10% glycerol, 2 mM dithiothreitol, 2 mg/ml bovine serum albumin, 0.2% Nonidet P-40, and 40 mM Hepes) for 20 min at room temperature. Samples were subjected to electrophoresis through 6% non-denaturing acrylamide gels (Novex, San Diego, CA) in 0.5 × Tris borate-EDTA buffer. For antibody supershift experiments, nuclear extracts were preincubated 20 min with 2 µg of antibody before the addition of the labeled probe.


RESULTS

Localization of DNA Elements Involved in the Transcriptional Activation of the TNF-alpha Gene in Response to LPS

To define the 5' boundary of LPS responsive elements, THP-1 cells were transiently transfected with a series of plasmids containing progressive truncations of the 5' promoter sequence between -1311 bp and -36 bp. Deletion of sequences upstream of -182 had no significant effect on LPS-induction of the TNF-alpha promoter activity (Fig. 1). Removal of a region from -182 to -162, which contains an Sp1/Egr-1 overlapping site, reduced LPS inducibility by 50% (from 13.3-fold to 7.8-fold). Removal of a region between -161 and -121 had no significant effect on the LPS inducibility. In contrast, deletion to -95, which removes Ets, CRE, and kappa B (kappa B3) sites, further reduced LPS inducibility (Fig. 1). Finally, deletion to -36 removed a region containing a Sp1 site and abolished basal promoter activity. These results provide new and substantial evidence that LPS induction of the TNF-alpha gene in monocytes involves at least two regulatory elements; region I (-182 to -162) and region II (-120 to -96).


Fig. 1. LPS induction of the TNF-alpha promoter from a 5' deletion series. The 5' boundaries of plasmids containing various truncations of the TNF-alpha promoter are shown. The average fold induction of luciferase activity expressed by each plasmid in transiently transfected THP-1 cells in response to LPS (10 µg/ml) is shown with S.D. Results of a representative experiment are shown. The basal luciferase activity (light units) levels per 106 cells are as follows: pTNF(1311)Luc, 13,546; pTNF(-1135)Luc, 12,606; pTNF(-615)Luc, 19,319; pTNF(-479)Luc, 12,311; pTNF(-295)Luc, 17,636; pTNF(-182)Luc, 13,288; pTNF(-161)Luc, 13,333; pTNF(-120)Luc, 11,813; pTNF(-95)Luc, 9457; pTNF(-36)Luc, 1659; the background is 425 light units. Similar results were observed in two independent experiments.
[View Larger Version of this Image (16K GIF file)]

Determination of the Roles of Various Binding Sites in the Human TNF-alpha Promoter by Functional Analysis of Mutant Plasmids

To determine the functional role of nuclear binding motifs in the region identified by 5'-truncation analysis, plasmids with specific site-directed mutations were examined. Mutation in the Egr-1 site (-169 bp), the CRE site (-106 bp), as well as the kappa B3 site (-97 bp), markedly reduced LPS induction. In contrast, mutation of the AP-1 (-57 bp) or AP-2 (-36 bp) had no effect on LPS induction of the TNF-alpha promoter (Fig. 2). These results are consistent with our findings using the 5'-deletion series of plasmids shown in Fig. 1.


Fig. 2. LPS induction of TNF-alpha promoter from mutant series. The position of mutations in corresponding regulatory motifs are marked. Oligonucleotides used for producing these plasmids are listed in Table I. The kappa B3 mutant was generated using the kappa B3 m2 oligonucleotide (Table I). Fold induction of luciferase activity expressed by each plasmid in transiently transfected THP-1 cells in response to LPS of duplicate samples with S.D. are shown. Results are representative of four independent experiments.
[View Larger Version of this Image (15K GIF file)]

Functional Analysis of the CRE and kappa B3 Sites in Heterologous Promoter Plasmids

To further explore the potential of these nuclear factor binding motifs to function as enhancer elements, we examined their ability to confer inducibility to heterologous promoter. Neither four tandem copies of the kappa B3 nor two copies of the CRE sites alone conferred LPS inducibility to a SV40 minimal promoter (Fig. 3A). However, when two or three copies of a DNA fragment spanning both the CRE and the kappa B sites were cloned upstream of the SV40 promoter strong LPS inducibility was observed (Fig. 3, A and B). Mutation of either the CRE site (-110/-86 m1) or the kappa B3 site (-110/-86 m2) completely abolished LPS inducibility (Fig. 3B). These results suggest that the LPS induction of human TNF-alpha transcription requires cooperative interaction between proteins bound to the CRE and kappa B sites. There is only 1 base pair separating the CRE and kappa B3 sites. Whether the close proximity of the CRE site and the kappa B3 site is required for the optimal transactivation of TNF-alpha was investigated. For these experiments, 5, 10, or 15 additional base pairs were added between CRE and kappa B3 sites and oligonucleotides were cloned into pGL2-promoter. These insertions created 1/2, 1, or 1 1/2 extra turns of the DNA helix between these two sites. Fig. 3C shows that insertion of DNA between these two sites abolished LPS inducibility.


Fig. 3. Induction of the TNF-alpha promoter from heterologous promoter series by LPS. Plasmids of this series contain the minimal SV40 promoter upstream of luciferase gene in pGL2-promoter vector. A, multiple tandem copies of DNA fragments containing sequences of interest are cloned upstream of the SV40 minimal promoter. B, two tandem copies of DNA fragments (-110 to -86) containing both the CRE and the kappa B sites, or DNA fragments containing bp substitutions in either site (marked with x) are cloned upstream of the SV40 minimal promoter. C, three tandem copies of DNA fragments (-110 to -86) with wild type sequence or with 5, 10, or 15 extra bases inserted between the CRE and the kappa B3 sites were cloned upstream of SV40 minimal promoter. The average fold induction of luciferase activity expressed by each plasmids in transiently transfected THP-1 cells in response to LPS is shown. Results are representative of three independent experiments.
[View Larger Version of this Image (23K GIF file)]

Identification of Transcription Factors That Bind to the Egr-1, CRE, and kappa B3 Sites

EMSA were performed to determine which transcription factors bind to sites in regions I and II of the human TNF-alpha promoter.

Region I: Egr-1 and Sp1

An oligonucleotide containing only the Egr-1 site bound an LPS and phorbol ester-inducible complex (Fig. 4A). This complex was not observed when an oligonucleotide containing a mutant Egr-1 site was used as the probe (Fig. 4A, lanes 4-6). In addition, this LPS-inducible complex was supershifted by anti-Egr-1 antibody (Fig. 4A, lane 9), demonstrating that Egr-1 bound to this site.


Fig. 4. LPS induction of Egr-1 nuclear factor. A, nuclear extract from unstimulated THP-1 or THP-1 stimulated with LPS (10 µg/ml) or PMA (10 nM) for 1 h were probed with labeled oligonucleotide probes of either wild type sequence or mutant sequence of Egr-1 site (Table I). B, probes used were oligonucleotide spanning overlapping Sp1/Egr-1 site (-182 to -157) or oligonucleotide containing base substitutions in Sp1 site, Sp1mut/Egr-1 (-182/-157 m1, Table I). For antibody supershift experiment, nuclear extracts were incubated with antibody (2 µg) for 20 min before addition of probes.
[View Larger Version of this Image (53K GIF file)]

A prominent complex was observed when nuclear extracts from unstimulated cells were incubated with an oligonucleotide spanning the overlapping Sp1/Egr-1 sites (-182 to -157 bp) (Fig. 4B, lane 1). This complex was not induced by LPS (lane 2) but was supershifted using an anti-Sp1 antibody (lane 3). In addition, this complex was not observed using an oligonucleotide containing a mutated Sp1 site (Fig. 4B, lanes 5-8). Taken together, these results demonstrated that Sp1 bound to this site. In addition to the constitutively expressed Sp1 complex, LPS stimulation of cells resulted in the formation of an Egr-1 complex that bound to the oligonucleotide containing overlapping Sp1/Egr-1 sites (Fig. 4B, lane 2). Similarly, this LPS inducible Egr-1 complex was observed using the Sp1mut/Egr-1 oligonucleotide as a probe (Fig. 4B, lane 6). The Egr-1 complex was not affected by the addition of an anti-Sp1 antibody (Fig. 4B, lanes 3 and 7), but was supershifted with an anti-Egr-1 antibody (Fig. 4B, lanes 4 and 8).

Region II: kappa B3 and CRE

EMSA were performed with oligonucleotides spanning three putative kappa B sites: kappa B1 (-594 to -577), kappa B2 (-216 to -199), and kappa B3 (-104 to -87) (Table I). As depicted in Fig. 5A, LPS stimulation of cells resulted in the formation of nuclear protein-DNA complexes with kappa B1 (lane 2) and kappa B3 (lane 6), but not with kappa B2 (lane 4). More protein bound to kappa B1 that kappa B3. Similar results were found using nuclear extracts from human peripheral blood monocytes (Fig. 5B). Monospecific anti-p50 and anti-p65 antibodies were used in supershift experiments to identify the protein composition of the complexes formed with the kappa B1 and kappa B3 sites. As shown in Fig. 5C, the LPS induced complex binding either to the kappa B1 or to the kappa B3 oligonucleotides were supershifted by anti-p50 and also by anti-p65 antibodies (Fig. 5C), indicating that they were composed of p50/p65 heterodimers. Furthermore, mutation of the kappa B3 site (kappa B3 m2, Table I) abolished binding of p50/p65 (data not shown). Importantly, the same mutation significantly reduced LPS inducibility of the TNF-alpha promoter (Fig. 2).


Fig. 5. LPS induction of NF-kappa B (p50/p65). Nuclear extracts from THP-1 (A) or peripheral blood monocytes (B) were probed with oligonucleotide spanning kappa B1, kappa B2, or kappa B3 site (Table I). C, nuclear extracts were preincubated with antibodies (2 µg) for 20 min before adding probes.
[View Larger Version of this Image (50K GIF file)]

Using a prototypic CRE site as a probe, we demonstrated that CREB was constitutively expressed in unstimulated THP-1 cells and that CREB binding was not induced by LPS (Fig. 6A). In contrast, LPS stimulation increased the amount of protein binding to the non-consensus CRE site from the TNF-alpha promoter (Fig. 6B, compare lanes 1 and 4). Antibody supershift experiments were performed to determine the proteins that bound to the CRE site (Fig. 6B). In unstimulated cells, the majority of the complex was supershifted using an anti-CREB antibody, whereas only a minor supershift was observed using an anti-c-Jun antibody. In LPS-stimulated cells, the anti-c-Jun antibody supershift the majority of the complex, whereas the anti-CREB antibody formed a minor supershift band. These results suggest that LPS does not increase the binding of CREB, consistent with our results using a prototype CRE site (Fig. 6A), and that LPS increases binding of c-Jun-containing complexes to the CRE site from the TNF-alpha promoter.


Fig. 6. LPS induction of nuclear factors binding to CRE site. Nuclear extracts from unstimulated or LPS-stimulated THP-1 cells were probed with oligonucleotide probe spanning the prototypic CRE sequence (A), TNF-alpha promoter wild type CRE sequence (B), or mutant CRE sequence (CREm2, C). Sequences of these oligonucleotides are shown in Table I. For antibody supershift experiments, nuclear extracts were incubated with various antibodies (2 µg) for 20 min before adding probes.
[View Larger Version of this Image (53K GIF file)]

Using an oligonucleotide containing a mutated CRE site (CREm2, Table I), we observed a reduction in the total amount of protein binding (Fig. 6C, lane 2). In addition, LPS stimulation did not increase complex formation (lane 3). This complex was supershifted by an anti-CREB antibody (lane 4) but was not recognized by an anti-c-Jun antibody (lane 5), suggesting that small amounts of CREB still bound to the mutated CRE site. Since these same base substitutions completely abolished the functional activity of the CRE site in transfected cells (Fig. 3B), these results provide additional evidence that c-Jun-containing complexes, rather than CREB, play a crucial role in LPS induction of the TNF-alpha promoter.


DISCUSSION

In this report, we have defined two cis-acting regulatory elements in the human TNF-alpha promoter that mediated maximal LPS induction of TNF-alpha gene expression in cells of monocytic lineage. Region I contained an overlapping Sp1/Egr-1 site (-182 to -162), whereas region II (-120 to -96) contained CRE and kappa B sites.

Functional studies demonstrated that Egr-1 binding to region I was required for LPS induction of the TNF-alpha promoter in monocytes. Egr-1 protein expression was induced by LPS stimulation (21). The Egr-1 site at -169 bp is part of the Sp1/Egr-1 overlapping sequence motif. In unstimulated monocytes, Sp1 binds to this site, whereas upon LPS stimulation it is likely that Egr-1 displaces Sp1 to mediate induction of TNF-alpha promoter activity. Previously, we have shown that Egr-1 can displace Sp1 from a similar overlapping Sp1/Egr-1 site (22). The role of Sp1 bound to this upstream Sp1 site at -172 is unknown, although our results using a plasmid containing a mutation in the Sp1 site suggest that it does not mediate basal expression. In contrast, mutation of the Sp1 site at -56 bp dramatically reduces basal expression by 65%.2

Further functional studies showed that the CRE and kappa B3 sites in region II were required for LPS induction of the TNF-alpha promoter. We demonstrated that kappa B3 (-97) bound p50/p65 heterodimers. In contrast, we found no role for kappa B1 (-588) despite its ability to bind p50/p65. A recent study by Trede et al. (11) also showed a role for kappa B3 in LPS induction of the TNF-alpha promoter in THP-1 cells. However, these investigators did not identify other regulatory regions, possibly due to the low level of induction (about 4-fold) of the TNF-alpha promoter (11). In addition, our studies are in agreement with an earlier report (16), showing that p50/p65 binds with much less avidity to kappa B3 than kappa B1 (Fig. 5). Therefore, it is possible that protein-protein interaction of p50/p65 with c-Jun proteins bound to the adjacent CRE site is required to stabilize the formation of a transcriptional complex that mediates induction of the TNF-alpha promoter.

In monocytic cells, the CRE site in the TNF-alpha promoter constitutively bound CREB (Fig. 6). Upon LPS stimulation, the amount of CREB binding remains unchanged, but there was a marked increase in c-Jun binding. LPS induces c-jun expression (23), suggesting that the increases in c-Jun-containing complexes observed in this study were due to de novo protein synthesis. Furthermore, the transactivating activity of these c-Jun complexes may be increased due to post-translational phosphorylation (24). As reported recently, LPS stimulation of THP-1 cells resulted in rapid activation of JNK (25). The phosphorylation of c-Jun by JNK significantly enhances the transactivation potential of these factors (26). The non-consensus CRE sequence of TNF-alpha promoter TGAGCTCA was shown to have a lower binding affinity for c-Jun/ATF-2 complex than a consensus CRE sequence (27). These variations of sequences and the resulting variation in binding of these bZIP proteins could play a role in the modulation of TNF-alpha expression in response to various signals. Importantly, base substitution in the CRE site that reduced CREB binding but abolished c-Jun binding abrogated the functional activity of this site, suggesting that c-Jun-containing complexes bound to region II are required for LPS induction of the TNF-alpha promoter. The molecular mechanisms by which binding of the nuclear proteins at this CRE site regulate the activation of TNF-alpha gene expression await further elucidation.

Parallel to our findings for monocytic cells, it was demonstrated recently that both the kappa B3 site and the adjacent upstream CRE site are required for the calcium-stimulated TNF-alpha transcription in human T cells (4). However, in contrast to our data for monocytes, these investigators reported that the kappa B3 site bound NFATp and not p50/p65 (28). Moreover, contrary to our findings in monocytes, no constitutive or induced CREB protein binding to the CRE site was observed in T cells (4). Instead, the CRE-binding complex was shown to consist almost exclusively of c-Jun/ATF-2 heterodimers. Furthermore, both the CRE site and adjacent upstream Ets site were essential for both basal promoter activity in T cells and responsiveness to PMA (5). It appears that the Ets site did not play a significant role in basal TNF-alpha promoter activity in monocytes, since it was not affected by mutation of the Ets site.2 Together, these results demonstrate the marked difference in the regulation of the TNF-alpha promoter in human T cells and monocytes.

In this study, we showed that LPS induction of a heterologous promoter by region II required both the CRE and kappa B3 sites, suggesting a functional cooperation between the transcription factors bound to these sites. Similar cooperation has also been demonstrated in the induction of another cytokine gene, IFN-beta (29), as well as in the expression of E-selectin (30). In both cases, ATF-2/Jun proteins were shown to interact with p50/p65 proteins. In addition, p50/p65 has been shown to physically interact with ATF-2 (29), and c-Jun (31). These direct associations are considered an important mechanism by which transcriptional factors cooperate to induce gene expression.

The novel findings presented here support the notion that concerted participation of proteins bound to the Egr-1, CRE, and kappa B3 sites mediates the induction of the TNF-alpha promoter in human monocytic THP-1 cells in response to LPS. Future studies will determine if similar regulatory pathways control TNF-alpha gene expression in monocytes and macrophages. Further elucidation of the cooperative interactions of transcription factors bound to these cis-acting regulatory elements are essential to our understanding of the transcriptional regulation of the TNF-alpha gene in human monocytes. Understanding of the molecular mechanisms by which these nuclear factors regulate TNF-alpha gene expression should lead to design of specific inhibitors that will counteract the pathological effects of TNF-alpha in various diseases.


FOOTNOTES

*   This work was supported by National Institutes of Health Grants HL-16411 and HL-48872.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Dagger    To whom correspondence should be addressed: Dept. of Immunology, IMM 17, The Scripps Research Institute, 10550 N. Torrey Pines Rd., La Jolla, CA 92037. Tel.: 619-784-8226; Fax: 619-784-8480; E-mail: stfan{at}scripps.edu.
1   The abbreviations used are: TNF-alpha , tumor necrosis factor-alpha ; LPS, lipopolysaccharide; bp, base pair(s); PMA, phorbol 12-myristate 13-acetate; EMSA, electrophoretic mobility shift assay; CRE, cAMP-responsive element; CREB, CRE-binding protein.
2   J. Yao and S.-T. Fan, submitted for publication.

ACKNOWLEDGEMENTS

We thank Dr. James S. Economou for the generous gift of plasmids, and Dr. Craig Dickinson and Paul Oeth for advice.


REFERENCES

  1. Tracey, K. J., and Cerami, A. (1994) Annu. Rev. Med. 45, 491-503 [CrossRef][Medline] [Order article via Infotrieve]
  2. Han, J., Brown, T., and Beutler, B. (1990) J. Exp. Med. 171, 465-475 [Abstract/Free Full Text]
  3. Han, J., Huez, G., and Beutler, B. (1991) J. Immunol. 146, 1843-1848 [Abstract]
  4. Tsai, E. Y., Jain, J., Pesavento, P. A., Rao, A., and Goldfeld, A . E. (1996) Mol. Cell. Biol. 16, 459-467 [Abstract]
  5. Kramer, B., Weigmann, K., and Kronke, M. (1995) J. Biol. Chem. 270, 6577-6583 [Abstract/Free Full Text]
  6. Rhoades, K. L., Golub, S. H., and Economou, J. S. (1992) J. Biol. Chem. 267, 22102-22107 [Abstract/Free Full Text]
  7. Kramer, B., Meichle, A., Hensel, G., Charnay, P., and Kronke, M. (1994) Biochim. Biophys. Acta 1219, 413-421 [Medline] [Order article via Infotrieve]
  8. Leitman, D. C., Ribeiro, R. C. J., Mackow, E. R., Baxter, J. D., and West, B. L. (1991) J. Biol. Chem. 266, 9343-9346 [Abstract/Free Full Text]
  9. Pope, R. M., Leutz, A., and Ness, S. A. (1994) J. Clin. Invest. 94, 1449-1455 .
  10. Rhoades, K. L., Cai, S., Golub, S. H., and Economou, J. S. (1995) Cell. Immunol. 161, 125-131 [CrossRef][Medline] [Order article via Infotrieve]
  11. Trede, N. S., Tsytsykova, A. V., Chatila, T., Goldfeld, A. E., and Geha, R. S. (1995) J. Immunol. 155, 902-908 [Abstract]
  12. Leitman, D. C., Mackow, E. R., Williams, T., Baxter, J. D., and West, B. L. (1992) Mol. Cell. Biol. 12, 1352-1356 [Abstract/Free Full Text]
  13. Shakhov, A. N., Collat, M. A., Vassalli, P., Nedospasov, S. A., and Jongeneel, V. (1990) J. Exp. Med. 171, 35-47 [Abstract/Free Full Text]
  14. Collart, M. A., Baeuerle, P., and Vassalli, P. (1990) Mol. Cell. Biol. 10, 1498-1506 [Abstract/Free Full Text]
  15. Goldfeld, A. E., Doyle, C., and Maniatis, T. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 9769-9773 [Abstract/Free Full Text]
  16. Ziegler-Heitbrock, L. H. W., Sternsdorf, T., Liese, J., Belohradsky, B., Weber, C., Wedel, A., Schreck, R., Bauerle, P., and Strobel, M. (1993) J. Immunol. 151, 6986-6993 [Abstract]
  17. Oeth, P., and Mackman, N. (1995) Blood 86, 4144-4152 [Abstract/Free Full Text]
  18. Fan, S.-T., Mackman, N., Cui, M.-J., and Edgington, T. S. (1995) J. Immunol. 154, 3266-3274 [Abstract]
  19. Economou, J. S., Rhoades, K., Essner, R., McBride, W. H., Gasson, J. C., and Morton, D. L. (1989) J. Exp. Med. 170, 321-326 [Abstract/Free Full Text]
  20. Mackman, N., Brand, K., and Edgington, T. S. (1991) J. Exp. Med. 174, 1517-1526 [Abstract/Free Full Text]
  21. Coleman, D. L., Bartiss, A. H., Sukhatme, V. P., Liu, J., and Rupprecht, H. D. (1992) J. Immunol. 149, 3045-3051 [Abstract]
  22. Cui, M.-Z., Parry, G. C. N., Oeth, P., Larson, H., Smith, M., Huang, R.-P., Adamson, E. D., and Mackman, N. (1996) J. Biol. Chem. 271, 2731-2739 [Abstract/Free Full Text]
  23. Dokter, W. H. A., Esselink, M. T., Halie, M. R., and Vellenga, E. (1993) Blood 81, 337-343 [Abstract/Free Full Text]
  24. Karin, M. (1995) J. Biol. Chem. 270, 16483-16486 [Free Full Text]
  25. Hambleton, J., Weinstein, S. L., Lem, L., and DeFranco, A. L. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 2774-2778 [Abstract/Free Full Text]
  26. Smeal, T., Binetruy, B., Mercola, D., Grover-Bardwick, E., Heidecker, G., Rapp, U. R., and Karin, M. (1992) Mol. Cell. Biol. 12, 3507-3513 [Abstract/Free Full Text]
  27. Newell, C. L., Deisseroth, A. B., and Lopez-Berestein, G. (1994) J. Leukocyte Biol. 56, 27-35 [Abstract]
  28. McCaffrey, P. G., Goldfeld, A. E., and Rao, A (1994) J. Biol. Chem. 269, 30445-30450 [Abstract/Free Full Text]
  29. Du, W., Thanos, D., and Maniatis, T. (1993) Cell 74, 887-898 [CrossRef][Medline] [Order article via Infotrieve]
  30. Whitley, M. J., Thanos, D., Read, M. A., Maniatis, T., and Collins, T. (1994) Mol. Cell. Biol. 14, 6464-6475 [Abstract/Free Full Text]
  31. Kaszubska, W., Hoof van Huijsduijnen, R., Ghersa, P., DeRaemy-Schenk, A. M., Chen, B. P. C., Hei, T., DeLamarter, J. F., and Whelan, J. (1993) Mol. Cell. Biol. 13, 7180-7190 [Abstract/Free Full Text]

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Immunol.Home page
S. A. Rushworth, D. J. MacEwan, and M. A. O'Connell
Lipopolysaccharide-Induced Expression of NAD(P)H:Quinone Oxidoreductase 1 and Heme Oxygenase-1 Protects against Excessive Inflammatory Responses in Human Monocytes
J. Immunol., November 15, 2008; 181(10): 6730 - 6737.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
B. H. Kim, S. S. Hong, S. W. Kwon, H. Y. Lee, H. Sung, I.-J. Lee, B. Y. Hwang, S. Song, C.-K. Lee, D. Chung, et al.
Diarctigenin, a Lignan Constituent from Arctium lappa, Down-Regulated Zymosan-Induced Transcription of Inflammatory Genes through Suppression of DNA Binding Ability of Nuclear Factor-{kappa}B in Macrophages
J. Pharmacol. Exp. Ther., November 1, 2008; 327(2): 393 - 401.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P.-H. Park, H. Huang, M. R. McMullen, P. Mandal, L. Sun, and L. E. Nagy
Suppression of Lipopolysaccharide-stimulated Tumor Necrosis Factor-{alpha} Production by Adiponectin Is Mediated by Transcriptional and Post-transcriptional Mechanisms
J. Biol. Chem., October 3, 2008; 283(40): 26850 - 26858.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
G. Zhang, M. A. Park, C. Mitchell, H. Hamed, M. Rahmani, A. P. Martin, D. T. Curiel, A. Yacoub, M. Graf, R. Lee, et al.
Vorinostat and Sorafenib Synergistically Kill Tumor Cells via FLIP Suppression and CD95 Activation
Clin. Cancer Res., September 1, 2008; 14(17): 5385 - 5399.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
M. Sozio and D. W. Crabb
Alcohol and lipid metabolism
Am J Physiol Endocrinol Metab, July 1, 2008; 295(1): E10 - E16.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Wang, S. Wu, X. Jin, M. Li, S. Chen, J. L. Teeling, V. H. Perry, and J. Gu
Retinoic Acid-Inducible Gene-I Mediates Late Phase Induction of TNF-{alpha} by Lipopolysaccharide
J. Immunol., June 15, 2008; 180(12): 8011 - 8019.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Hoffmann, J. Ashouri, S. Wolter, A. Doerrie, O. Dittrich-Breiholz, H. Schneider, E. F. Wagner, J. Troppmair, N. Mackman, and M. Kracht
Transcriptional Regulation of EGR-1 by the Interleukin-1-JNK-MKK7-c-Jun Pathway
J. Biol. Chem., May 2, 2008; 283(18): 12120 - 12128.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Garrett, K. Dietzmann-Maurer, L. Song, and K. E. Sullivan
Polarization of Primary Human Monocytes by IFN-{gamma} Induces Chromatin Changes and Recruits RNA Pol II to the TNF-{alpha} Promoter
J. Immunol., April 15, 2008; 180(8): 5257 - 5266.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
B. H. Kim, E. Roh, H. Y. Lee, I.-J. Lee, B. Ahn, S.-H. Jung, H. Lee, S.-B. Han, and Y. Kim
Benzoxathiole Derivative Blocks Lipopolysaccharide-Induced Nuclear Factor-{kappa}B Activation and Nuclear Factor-{kappa}B-Regulated Gene Transcription through Inactivating Inhibitory {kappa}B Kinase {beta}
Mol. Pharmacol., April 1, 2008; 73(4): 1309 - 1318.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. P. Luyendyk, G. A. Schabbauer, M. Tencati, T. Holscher, R. Pawlinski, and N. Mackman
Genetic Analysis of the Role of the PI3K-Akt Pathway in Lipopolysaccharide-Induced Cytokine and Tissue Factor Gene Expression in Monocytes/Macrophages
J. Immunol., March 15, 2008; 180(6): 4218 - 4226.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. J. Skinner, K. M. Deleault, R. Fecteau, and S. A. Brooks
Extracellular Signal-regulated Kinase Regulation of Tumor Necrosis Factor-{alpha} mRNA Nucleocytoplasmic Transport Requires TAP-NxT1 Binding and the AU-rich Element
J. Biol. Chem., February 8, 2008; 283(6): 3191 - 3199.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
M. T. Pritchard, S. Roychowdhury, M. R. McMullen, L. Guo, G. E. Arteel, and L. E. Nagy
Early growth response-1 contributes to galactosamine/lipopolysaccharide-induced acute liver injury in mice
Am J Physiol Gastrointest Liver Physiol, December 1, 2007; 293(6): G1124 - G1133.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Baranek, R. Debret, F. Antonicelli, B. Lamkhioued, A. Belaaouaj, W. Hornebeck, P. Bernard, M. Guenounou, and R. Le Naour
Elastin Receptor (Spliced Galactosidase) Occupancy by Elastin Peptides Counteracts Proinflammatory Cytokine Expression in Lipopolysaccharide-Stimulated Human Monocytes through NF-{kappa}B Down-Regulation
J. Immunol., November 1, 2007; 179(9): 6184 - 6192.
[Abstract] [Full Text] [PDF]


Home page