|
|
||||||||
(Received for publication, January 22, 1997, and in revised form, May 7, 1997)
From the Department of Immunology, The Scripps Research Institute,
La Jolla, California 92037
Biosynthesis of tumor necrosis factor- Tumor necrosis factor (TNF- The promoter region of the human TNF- Transcriptional activation of the murine TNF- In this study, we have employed a line of THP-1 cells that exhibits
high inducibility for TNF- Cell and Reagents
THP-1 monocytic cells were maintained in medium RPMI 1640 with
8% fetal calf serum. Human peripheral blood monocytes were isolated by
gradient centrifugation as described (18). Antibodies used in
electrophoretic mobility shift assay (EMSA): anti-Egr-1, anti-CREB,
anti-ATF-2, anti-c-Jun, anti-JunB, anti-JunD, anti-c-Fos, anti-Fos B,
anti-p50, anti-p65, anti-c-Rel, and anti-Ets1/2 were form Santa Cruz
Biotechnology (Santa Cruz, CA).
Plasmids
pTNF( Plasmids containing site-specific
mutations at AP-1, AP-2, or CRE sites (6) were provided by Dr. J. Economou. Additional mutant plasmids in this series were produced
according to methods described in the Transformer site-directed
mutagenesis kit (CLONTECH, Palo Alto, CA). The
sequences of the oligonucleotides with site-specific mutations used for
these constructs are listed in Table I.
Table I.
Oligonucleotides used in this study
Volume 272, Number 28,
Issue of July 11, 1997
pp. 17795-17801
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.
Promoter in Human Monocytic Cells
REGULATION BY Egr-1, c-Jun, AND NF-
B TRANSCRIPTION
FACTORS*

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
(TNF-
) is predominantly by cells of the monocytic lineage. This
study examined the role of various cis-acting regulatory
elements in the lipopolysaccharide (LPS) induction of the human TNF-
promoter in cells of monocytic lineage. Functional analysis of
monocytic THP-1 cells transfected with plasmids containing various
lengths of TNF-
promoter localized enhancer elements in a region
(
182 to
37 base pairs (bp)) that were required for optimal
transcription of the TNF-
gene in response to LPS. Two regions were
identified: region I (
182 to
162 bp) contained an overlapping
Sp1/Egr-1 site, and region II (
119 to
88) contained CRE and NF-
B
(designated
B3) sites. In unstimulated THP-1, CRE-binding protein
and, to a lesser extent, c-Jun complexes were found to bind to the CRE
site. LPS stimulation increased the binding of c-Jun-containing
complexes. In addition, LPS stimulation induced the binding of cognate
nuclear factors to the Egr-1 and
B3 sites, which were identified as
Egr-1 and p50/p65, respectively. The CRE and
B3 sites in region II
together conferred strong LPS responsiveness to a heterologous
promoter, whereas individually they failed to provide transcriptional
activation. Furthermore, increasing the spacing between the CRE and the
B3 sites completely abolished LPS induction, suggesting a
cooperative interaction between c-Jun complexes and p50/p65. These
studies indicate that maximal LPS induction of the TNF-
promoter is
mediated by concerted participation of at least two separate
cis-acting regulatory elements.
),1
produced primarily by cells of monocytic lineage, is involved in a
plethora of cell regulatory and differentiative processes. TNF-
is
also a vital mediator of the host defense against infection and tumor
formation. On the other hand, TNF-
is involved in the
pathophysiology of numerous diseases including septic shock, cachexia,
and various autoimmune diseases (1). Therefore, TNF-
exhibits both
beneficial and pathologic effects, a feature that requires rigorous
control of its expression. Regulation of human TNF-
expression in
cells of monocytic lineage is quite complex, involving controls at both transcriptional and post-transcriptional levels (2). In addition, both
5
and 3
nucleotide sequences influence LPS-induced transcription of
human TNF-
cDNA transfected into the murine macrophage RAW264.7 cell line (3).
gene contains a complex
array of potential regulatory elements. In T cells, cooperation between
the CRE and the adjacent
B3 sites is required for calcium-mediated TNF-
promoter activity (4), and cooperation between the CRE and the
adjacent Ets sites for PMA-induced activity (5). However, the role or
these regulatory elements in transcriptional activation of the TNF-
gene in human monocytes remains unclear. To date, published reports
indicate that activation of TNF-
gene transcription in human
monocytes in response to various stimuli is mediated by a region within
200 bp upstream of the transcriptional start site (6-12). Using a
promonocytic leukemia cell line, U937, several nuclear factor binding
elements, including AP-1 (6), Egr-1 (7), CRE (8), C/EBP
(9), and
AP-2 (10), have been suggested to mediate TNF-
transcription in
response to PMA or cytokines. These results appear to be incomplete and
often conflicting. No consensus has been reached, and no cooperation
between these regulatory elements was established. Although the reasons
for these discrepancies are unclear, the U937 cell line may be too poorly differentiated to serve as a suitable model of gene expression in cells of monocytic lineage.
gene in murine
macrophages has been demonstrated to be predominantly dependent on a
region in the murine TNF-
promoter upstream of
451 bp, which
contains NF-
B DNA binding motifs (13, 14). A major histocompatibility complex class II Y box was also inferred to play a
role in LPS inducibility (13, 14). To date, the role of NF-
B in the
transcriptional activation of the human TNF-
gene in human monocytes
in response to LPS is controversial. An early study using murine
monocytic cells failed to identify a role for the
B sites in
transcriptional activation of human TNF-
in response to LPS or virus
(15). However, recent reports employing pharmacological agents that
block the nuclear translocation of NF-
B, such as pyrrolidine
dithiocarbamate (16), and sodium salicylate (17), demonstrated a
suppression of TNF-
gene expression. Moreover, LPS induction of the
human TNF-
promoter in human monocytic THP-1 leukemia cells was
mediated by the
B3 site at
97 bp (11). Taken together, these
results suggest a likelihood that murine monocytic cells are not
suitable for the analysis of the regulation of the human TNF-
promoter.
gene transcription similar to that of
freshly isolated human monocytes. We have performed a comprehensive
analysis of the role of various cis-acting regulatory elements in the transcriptional regulation of the human TNF-
gene.
Using LPS stimulation as a paradigm, we find that a mechanism involving
several transcription factors is required for maximal TNF-
promoter
activity in human monocytes.
-Deletion Series
1311)Luc, pTNF(
1185)Luc,
pTNF(
615)Luc, pTNF(
479)Luc, pTNF(
295)Luc, pTNF(
120)Luc,
pTNF(
95) Luc, and pTNF(
36)Luc (19) were generously provided by
Dr. J. Economou (UCLA, Los Angeles, CA). pTNF(
182)Luc and
pTNF(
161)Luc were produced by cloning polymerase chain reaction
fragments containing sequences of
182 to +15 or
161 to +15,
respectively, into the SmaI site of the pXP1 expression
vector.
Name
Position
Sequence
(5
-3
)
Egr-1
168 to
145CCCCGCCCCCGCGATGGAGAAGAA
Egr-1m
168
to
145CCCCGCCCCAGATATCGAGAAGAA
CRE
112
to
92TCCAGATGAGCTCATGGGTTC
CREm1
112 to
92TCCAGATGAGTGTATGGGTTC
CREm2
112 to
92TCCAGATCTCATCATGGGTTC
B1
594 to
577AAGCCTGGGACAGCCCCG
B2
217 to
200TGTGAGGGGTATCCTTGA
B3
103 to
86GCTCATGGGTTTCTCCAC
B3m1
103 to
86GCTCATTTATTTCTCCAC
B3m2
105 to
82CAGCTCATGGATATCTCCACCAAG
182/
157
182
to
157CTTCCAAATCCCCGCCCCCGCGATG
182/
157ml
182
to
157CTTTCCAAATATTCGCCCCCGCGATG
110/
86
110
to
86CAGATGAGCTCATGGGTTTCTCCAC
110/
86ml
110
to
86CAGATCTCATCATGGGTTTCTCCAC
110/
86m2
110
to
86CAGATGAGCTCATGAATTTCTAAAC
110/
86+5
110
to
86CAGATGAGCTCATATCGTGGGTTTCTCCAC
110/
86+10
110
to
86CAGATGAGCTCATATCGTATCGTGGGTTTCTCCAC
110/
86+15
110
to
86CAGATGAGCTCATATCGTATCGTATCGTGGGTTTCTCCAC
Multiple copies of
oligonucleotides containing sequences from the human TNF-
promoter
were cloned upstream of the minimal SV40 promoter driving expression of
the luciferase reporter gene in pGL2-promoter (Promega Corp.).
Sequences of oligonucleotides used for producing these constructs are
listed in Table I. All plasmids were verified by DNA sequencing.
DNA Transfection
A DEAE-dextran transfection procedure (18, 20) was used. Briefly, 3 × 107 THP-1 cells were resuspended in 1 ml of Tris-buffered saline and incubated for 10 to 20 min at 37 °C with 5 µg of plasmid DNA and 80 µg of DEAE-dextran (Pharmacia, Uppsala, Sweden). During incubation, cells were monitored closely for permeability to trypan blue. Transfection was stopped by adding large volumes of Tris-buffered saline, usually after 10 min, when 20-30% of cells are permeable to trypan blue. After washing with Tris-buffered saline, cells were cultivated in media for 48 h. Cells were stimulated with 5 µg/ml LPS (Escherichia coli O111:B4 purchased from Calbiochem, La Jolla, CA) in a 96-well plate at 1 × 106 cells/well. After 7 h of incubation at 37 °C, cells were harvested and luciferase activity was determined using an assay kit (Promega) and the Monolight 2010 luminometer (Analytical Luminescence Laboratory, San Diego, CA).
Nuclear Extracts and EMSA
Nuclear extracts were prepared from 5 × 106
THP-1 cells or peripheral blood monocytes stimulated under various
conditions as described (18, 20). Protein concentrations in nuclear
extracts were determined by BCA protein assay (Pierce). Oligonucleotide probes were radiolabeled using [
-32P]dCTP (Amersham).
Nuclear extracts (1-5 µg) were incubated with radiolabeled
oligonucleotide probes (0.2-1 × 106 cpm) in 2 × binding buffer (100 mM KCl, 1 mM EDTA, 10%
glycerol, 2 mM dithiothreitol, 2 mg/ml bovine serum
albumin, 0.2% Nonidet P-40, and 40 mM Hepes) for 20 min at
room temperature. Samples were subjected to electrophoresis through 6%
non-denaturing acrylamide gels (Novex, San Diego, CA) in 0.5 × Tris borate-EDTA buffer. For antibody supershift experiments, nuclear
extracts were preincubated 20 min with 2 µg of antibody before the
addition of the labeled probe.
Gene in Response to LPS
To define the
5
boundary of LPS responsive elements, THP-1 cells were transiently
transfected with a series of plasmids containing progressive
truncations of the 5
promoter sequence between
1311 bp and
36 bp.
Deletion of sequences upstream of
182 had no significant effect on
LPS-induction of the TNF-
promoter activity (Fig. 1). Removal of a region from
182 to
162, which contains an Sp1/Egr-1 overlapping site, reduced LPS inducibility by 50% (from 13.3-fold to
7.8-fold). Removal of a region between
161 and
121 had no significant effect on the LPS inducibility. In contrast, deletion to
95, which removes Ets, CRE, and
B (
B3) sites, further reduced LPS inducibility (Fig. 1). Finally, deletion to
36 removed a region
containing a Sp1 site and abolished basal promoter activity. These
results provide new and substantial evidence that LPS induction of the
TNF-
gene in monocytes involves at least two regulatory elements;
region I (
182 to
162) and region II (
120 to
96).
promoter from a
5
deletion series. The 5
boundaries of plasmids containing
various truncations of the TNF-
promoter are shown. The average fold
induction of luciferase activity expressed by each plasmid in
transiently transfected THP-1 cells in response to LPS (10 µg/ml) is
shown with S.D. Results of a representative experiment are shown. The
basal luciferase activity (light units) levels per 106
cells are as follows: pTNF(1311)Luc, 13,546; pTNF(
1135)Luc, 12,606;
pTNF(
615)Luc, 19,319; pTNF(
479)Luc, 12,311; pTNF(
295)Luc, 17,636;
pTNF(
182)Luc, 13,288; pTNF(
161)Luc, 13,333; pTNF(
120)Luc, 11,813;
pTNF(
95)Luc, 9457; pTNF(
36)Luc, 1659; the background is 425 light
units. Similar results were observed in two independent experiments.
Determination of the Roles of Various Binding Sites in the Human TNF-
Promoter by Functional Analysis of Mutant Plasmids
To
determine the functional role of nuclear binding motifs in the region
identified by 5
-truncation analysis, plasmids with specific
site-directed mutations were examined. Mutation in the Egr-1 site
(
169 bp), the CRE site (
106 bp), as well as the
B3 site (
97
bp), markedly reduced LPS induction. In contrast, mutation of the AP-1
(
57 bp) or AP-2 (
36 bp) had no effect on LPS induction of the
TNF-
promoter (Fig. 2). These results are consistent
with our findings using the 5
-deletion series of plasmids shown in Fig. 1.
promoter from mutant
series. The position of mutations in corresponding regulatory
motifs are marked. Oligonucleotides used for producing these plasmids
are listed in Table I. The
B3 mutant was generated using the
B3 m2 oligonucleotide (Table I). Fold induction of luciferase activity expressed by each plasmid in transiently transfected THP-1 cells in
response to LPS of duplicate samples with S.D. are shown. Results are
representative of four independent experiments.
Functional Analysis of the CRE and
B3 Sites in Heterologous
Promoter Plasmids
To further explore the potential of these
nuclear factor binding motifs to function as enhancer elements, we
examined their ability to confer inducibility to heterologous promoter.
Neither four tandem copies of the
B3 nor two copies of the CRE sites alone conferred LPS inducibility to a SV40 minimal promoter (Fig. 3A). However, when two or three copies of a
DNA fragment spanning both the CRE and the
B sites were cloned
upstream of the SV40 promoter strong LPS inducibility was observed
(Fig. 3, A and B). Mutation of either the CRE
site (
110/
86 m1) or the
B3 site (
110/
86 m2) completely
abolished LPS inducibility (Fig. 3B). These results suggest
that the LPS induction of human TNF-
transcription requires
cooperative interaction between proteins bound to the CRE and
B
sites. There is only 1 base pair separating the CRE and
B3 sites.
Whether the close proximity of the CRE site and the
B3 site is
required for the optimal transactivation of TNF-
was investigated.
For these experiments, 5, 10, or 15 additional base pairs were added
between CRE and
B3 sites and oligonucleotides were cloned into
pGL2-promoter. These insertions created 1/2, 1, or 1 1/2 extra turns of
the DNA helix between these two sites. Fig. 3C shows that
insertion of DNA between these two sites abolished LPS
inducibility.
promoter from
heterologous promoter series by LPS. Plasmids of this series
contain the minimal SV40 promoter upstream of luciferase gene in
pGL2-promoter vector. A, multiple tandem copies of DNA
fragments containing sequences of interest are cloned upstream of the
SV40 minimal promoter. B, two tandem copies of DNA fragments
(
110 to
86) containing both the CRE and the
B sites, or DNA
fragments containing bp substitutions in either site (marked with
x) are cloned upstream of the SV40 minimal promoter.
C, three tandem copies of DNA fragments (
110 to
86) with
wild type sequence or with 5, 10, or 15 extra bases inserted between
the CRE and the
B3 sites were cloned upstream of SV40 minimal
promoter. The average fold induction of luciferase activity expressed
by each plasmids in transiently transfected THP-1 cells in response to
LPS is shown. Results are representative of three independent
experiments.
Identification of Transcription Factors That Bind to the Egr-1, CRE, and
B3 Sites
EMSA were performed to determine which
transcription factors bind to sites in regions I and II of the human
TNF-
promoter.
An oligonucleotide containing only
the Egr-1 site bound an LPS and phorbol ester-inducible complex (Fig.
4A). This complex was not observed when an
oligonucleotide containing a mutant Egr-1 site was used as the probe
(Fig. 4A, lanes 4-6). In addition, this
LPS-inducible complex was supershifted by anti-Egr-1 antibody (Fig.
4A, lane 9), demonstrating that Egr-1 bound to
this site.
182 to
157) or oligonucleotide containing base substitutions in
Sp1 site, Sp1mut/Egr-1 (
182/
157 m1, Table I). For
antibody supershift experiment, nuclear extracts were incubated with
antibody (2 µg) for 20 min before addition of probes.
A prominent complex was observed when nuclear extracts from
unstimulated cells were incubated with an oligonucleotide spanning the
overlapping Sp1/Egr-1 sites (
182 to
157 bp) (Fig. 4B,
lane 1). This complex was not induced by LPS (lane
2) but was supershifted using an anti-Sp1 antibody (lane
3). In addition, this complex was not observed using an
oligonucleotide containing a mutated Sp1 site (Fig. 4B,
lanes 5-8). Taken together, these results demonstrated that
Sp1 bound to this site. In addition to the constitutively expressed Sp1
complex, LPS stimulation of cells resulted in the formation of an Egr-1
complex that bound to the oligonucleotide containing overlapping
Sp1/Egr-1 sites (Fig. 4B, lane 2). Similarly, this LPS inducible Egr-1 complex was observed using the
Sp1mut/Egr-1 oligonucleotide as a probe (Fig.
4B, lane 6). The Egr-1 complex was not affected
by the addition of an anti-Sp1 antibody (Fig. 4B,
lanes 3 and 7), but was supershifted with an
anti-Egr-1 antibody (Fig. 4B, lanes 4 and
8).
B3 and CRE
EMSA were performed with
oligonucleotides spanning three putative
B sites:
B1 (
594 to
577),
B2 (
216 to
199), and
B3 (
104 to
87) (Table
I). As depicted in Fig. 5A,
LPS stimulation of cells resulted in the formation of nuclear
protein-DNA complexes with
B1 (lane 2) and
B3
(lane 6), but not with
B2 (lane 4). More
protein bound to
B1 that
B3. Similar results were found using
nuclear extracts from human peripheral blood monocytes (Fig. 5B). Monospecific anti-p50 and anti-p65 antibodies were used
in supershift experiments to identify the protein composition of the
complexes formed with the
B1 and
B3 sites. As shown in Fig. 5C, the LPS induced complex binding either to the
B1 or
to the
B3 oligonucleotides were supershifted by anti-p50 and also by anti-p65 antibodies (Fig. 5C), indicating that they were
composed of p50/p65 heterodimers. Furthermore, mutation of the
B3
site (
B3 m2, Table I) abolished binding of p50/p65 (data not shown). Importantly, the same mutation significantly reduced LPS inducibility of the TNF-
promoter (Fig. 2).
B (p50/p65).
Nuclear extracts from THP-1 (A) or peripheral blood
monocytes (B) were probed with oligonucleotide spanning
B1,
B2, or
B3 site (Table I). C, nuclear extracts
were preincubated with antibodies (2 µg) for 20 min before adding
probes.
Using a prototypic CRE site as a probe, we demonstrated that CREB was
constitutively expressed in unstimulated THP-1 cells and that CREB
binding was not induced by LPS (Fig. 6A). In
contrast, LPS stimulation increased the amount of protein binding to
the non-consensus CRE site from the TNF-
promoter (Fig.
6B, compare lanes 1 and 4). Antibody
supershift experiments were performed to determine the proteins that
bound to the CRE site (Fig. 6B). In unstimulated cells, the
majority of the complex was supershifted using an anti-CREB antibody,
whereas only a minor supershift was observed using an anti-c-Jun
antibody. In LPS-stimulated cells, the anti-c-Jun antibody supershift
the majority of the complex, whereas the anti-CREB antibody formed a
minor supershift band. These results suggest that LPS does not increase
the binding of CREB, consistent with our results using a prototype CRE
site (Fig. 6A), and that LPS increases binding of
c-Jun-containing complexes to the CRE site from the TNF-
promoter.
promoter wild type CRE
sequence (B), or mutant CRE sequence (CREm2,
C). Sequences of these oligonucleotides are shown in Table
I. For antibody supershift experiments, nuclear extracts were incubated
with various antibodies (2 µg) for 20 min before adding probes.
Using an oligonucleotide containing a mutated CRE site (CREm2, Table
I), we observed a reduction in the total amount of protein binding
(Fig. 6C, lane 2). In addition, LPS stimulation
did not increase complex formation (lane 3). This complex
was supershifted by an anti-CREB antibody (lane 4) but was
not recognized by an anti-c-Jun antibody (lane 5),
suggesting that small amounts of CREB still bound to the mutated CRE
site. Since these same base substitutions completely abolished the
functional activity of the CRE site in transfected cells (Fig.
3B), these results provide additional evidence that
c-Jun-containing complexes, rather than CREB, play a crucial role in
LPS induction of the TNF-
promoter.
In this report, we have defined two cis-acting
regulatory elements in the human TNF-
promoter that mediated maximal
LPS induction of TNF-
gene expression in cells of monocytic lineage.
Region I contained an overlapping Sp1/Egr-1 site (
182 to
162),
whereas region II (
120 to
96) contained CRE and
B sites.
Functional studies demonstrated that Egr-1 binding to region I was
required for LPS induction of the TNF-
promoter in monocytes. Egr-1
protein expression was induced by LPS stimulation (21). The Egr-1 site
at
169 bp is part of the Sp1/Egr-1 overlapping sequence motif. In
unstimulated monocytes, Sp1 binds to this site, whereas upon LPS
stimulation it is likely that Egr-1 displaces Sp1 to mediate induction
of TNF-
promoter activity. Previously, we have shown that Egr-1 can
displace Sp1 from a similar overlapping Sp1/Egr-1 site (22). The role
of Sp1 bound to this upstream Sp1 site at
172 is unknown, although
our results using a plasmid containing a mutation in the Sp1 site
suggest that it does not mediate basal expression. In contrast,
mutation of the Sp1 site at
56 bp dramatically reduces basal
expression by 65%.2
Further functional studies showed that the CRE and
B3 sites in
region II were required for LPS induction of the TNF-
promoter. We
demonstrated that
B3 (
97) bound p50/p65 heterodimers. In contrast,
we found no role for
B1 (
588) despite its ability to bind p50/p65.
A recent study by Trede et al. (11) also showed a role for
B3 in LPS induction of the TNF-
promoter in THP-1 cells. However,
these investigators did not identify other regulatory regions, possibly
due to the low level of induction (about 4-fold) of the TNF-
promoter (11). In addition, our studies are in agreement with an
earlier report (16), showing that p50/p65 binds with much less avidity
to
B3 than
B1 (Fig. 5). Therefore, it is possible that
protein-protein interaction of p50/p65 with c-Jun proteins bound to the
adjacent CRE site is required to stabilize the formation of a
transcriptional complex that mediates induction of the TNF-
promoter.
In monocytic cells, the CRE site in the TNF-
promoter constitutively
bound CREB (Fig. 6). Upon LPS stimulation, the amount of CREB binding
remains unchanged, but there was a marked increase in c-Jun binding.
LPS induces c-jun expression (23), suggesting that the
increases in c-Jun-containing complexes observed in this study were due
to de novo protein synthesis. Furthermore, the transactivating activity of these c-Jun complexes may be increased due
to post-translational phosphorylation (24). As reported recently, LPS
stimulation of THP-1 cells resulted in rapid activation of JNK (25).
The phosphorylation of c-Jun by JNK significantly enhances the
transactivation potential of these factors (26). The non-consensus CRE
sequence of TNF-
promoter TGAGCTCA was shown to have a
lower binding affinity for c-Jun/ATF-2 complex than a consensus CRE
sequence (27). These variations of sequences and the resulting
variation in binding of these bZIP proteins could play a role in the
modulation of TNF-
expression in response to various signals.
Importantly, base substitution in the CRE site that reduced CREB
binding but abolished c-Jun binding abrogated the functional activity
of this site, suggesting that c-Jun-containing complexes bound to
region II are required for LPS induction of the TNF-
promoter. The
molecular mechanisms by which binding of the nuclear proteins at this
CRE site regulate the activation of TNF-
gene expression await
further elucidation.
Parallel to our findings for monocytic cells, it was demonstrated
recently that both the
B3 site and the adjacent upstream CRE site
are required for the calcium-stimulated TNF-
transcription in human
T cells (4). However, in contrast to our data for monocytes, these
investigators reported that the
B3 site bound NFATp and not p50/p65
(28). Moreover, contrary to our findings in monocytes, no constitutive
or induced CREB protein binding to the CRE site was observed in T cells
(4). Instead, the CRE-binding complex was shown to consist almost
exclusively of c-Jun/ATF-2 heterodimers. Furthermore, both the CRE site
and adjacent upstream Ets site were essential for both basal promoter
activity in T cells and responsiveness to PMA (5). It appears that the
Ets site did not play a significant role in basal TNF-
promoter
activity in monocytes, since it was not affected by mutation of the Ets site.2 Together, these results demonstrate the marked
difference in the regulation of the TNF-
promoter in human T cells
and monocytes.
In this study, we showed that LPS induction of a heterologous promoter
by region II required both the CRE and
B3 sites, suggesting a
functional cooperation between the transcription factors bound to these
sites. Similar cooperation has also been demonstrated in the induction
of another cytokine gene, IFN-
(29), as well as in the expression of
E-selectin (30). In both cases, ATF-2/Jun proteins were shown to
interact with p50/p65 proteins. In addition, p50/p65 has been shown to
physically interact with ATF-2 (29), and c-Jun (31). These direct
associations are considered an important mechanism by which
transcriptional factors cooperate to induce gene expression.
The novel findings presented here support the notion that concerted
participation of proteins bound to the Egr-1, CRE, and
B3 sites
mediates the induction of the TNF-
promoter in human monocytic THP-1
cells in response to LPS. Future studies will determine if similar
regulatory pathways control TNF-
gene expression in monocytes and
macrophages. Further elucidation of the cooperative interactions of
transcription factors bound to these cis-acting regulatory
elements are essential to our understanding of the transcriptional
regulation of the TNF-
gene in human monocytes. Understanding of the
molecular mechanisms by which these nuclear factors regulate TNF-
gene expression should lead to design of specific inhibitors that will
counteract the pathological effects of TNF-
in various diseases.
To whom correspondence should be addressed: Dept. of Immunology,
IMM 17, The Scripps Research Institute, 10550 N. Torrey Pines Rd., La
Jolla, CA 92037. Tel.: 619-784-8226; Fax: 619-784-8480; E-mail:
stfan{at}scripps.edu.
, tumor
necrosis factor-
; LPS, lipopolysaccharide; bp, base pair(s); PMA,
phorbol 12-myristate 13-acetate; EMSA, electrophoretic mobility shift
assay; CRE, cAMP-responsive element; CREB, CRE-binding protein.
We thank Dr. James S. Economou for the generous gift of plasmids, and Dr. Craig Dickinson and Paul Oeth for advice.
This article has been cited by other articles:
![]() |
S. A. Rushworth, D. J. MacEwan, and M. A. O'Connell Lipopolysaccharide-Induced Expression of NAD(P)H:Quinone Oxidoreductase 1 and Heme Oxygenase-1 Protects against Excessive Inflammatory Responses in Human Monocytes J. Immunol., November 15, 2008; 181(10): 6730 - 6737. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. H. Kim, S. S. Hong, S. W. Kwon, H. Y. Lee, H. Sung, I.-J. Lee, B. Y. Hwang, S. Song, C.-K. Lee, D. Chung, et al. Diarctigenin, a Lignan Constituent from Arctium lappa, Down-Regulated Zymosan-Induced Transcription of Inflammatory Genes through Suppression of DNA Binding Ability of Nuclear Factor-{kappa}B in Macrophages J. Pharmacol. Exp. Ther., November 1, 2008; 327(2): 393 - 401. [Abstract] [Full Text] [PDF] |
||||
![]() |
P.-H. Park, H. Huang, M. R. McMullen, P. Mandal, L. Sun, and L. E. Nagy Suppression of Lipopolysaccharide-stimulated Tumor Necrosis Factor-{alpha} Production by Adiponectin Is Mediated by Transcriptional and Post-transcriptional Mechanisms J. Biol. Chem., October 3, 2008; 283(40): 26850 - 26858. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Zhang, M. A. Park, C. Mitchell, H. Hamed, M. Rahmani, A. P. Martin, D. T. Curiel, A. Yacoub, M. Graf, R. Lee, et al. Vorinostat and Sorafenib Synergistically Kill Tumor Cells via FLIP Suppression and CD95 Activation Clin. Cancer Res., September 1, 2008; 14(17): 5385 - 5399. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sozio and D. W. Crabb Alcohol and lipid metabolism Am J Physiol Endocrinol Metab, July 1, 2008; 295(1): E10 - E16. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Wang, S. Wu, X. Jin, M. Li, S. Chen, J. L. Teeling, V. H. Perry, and J. Gu Retinoic Acid-Inducible Gene-I Mediates Late Phase Induction of TNF-{alpha} by Lipopolysaccharide J. Immunol., June 15, 2008; 180(12): 8011 - 8019. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Hoffmann, J. Ashouri, S. Wolter, A. Doerrie, O. Dittrich-Breiholz, H. Schneider, E. F. Wagner, J. Troppmair, N. Mackman, and M. Kracht Transcriptional Regulation of EGR-1 by the Interleukin-1-JNK-MKK7-c-Jun Pathway J. Biol. Chem., May 2, 2008; 283(18): 12120 - 12128. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Garrett, K. Dietzmann-Maurer, L. Song, and K. E. Sullivan Polarization of Primary Human Monocytes by IFN-{gamma} Induces Chromatin Changes and Recruits RNA Pol II to the TNF-{alpha} Promoter J. Immunol., April 15, 2008; 180(8): 5257 - 5266. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. H. Kim, E. Roh, H. Y. Lee, I.-J. Lee, B. Ahn, S.-H. Jung, H. Lee, S.-B. Han, and Y. Kim Benzoxathiole Derivative Blocks Lipopolysaccharide-Induced Nuclear Factor-{kappa}B Activation and Nuclear Factor-{kappa}B-Regulated Gene Transcription through Inactivating Inhibitory {kappa}B Kinase {beta} Mol. Pharmacol., April 1, 2008; 73(4): 1309 - 1318. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. Luyendyk, G. A. Schabbauer, M. Tencati, T. Holscher, R. Pawlinski, and N. Mackman Genetic Analysis of the Role of the PI3K-Akt Pathway in Lipopolysaccharide-Induced Cytokine and Tissue Factor Gene Expression in Monocytes/Macrophages J. Immunol., March 15, 2008; 180(6): 4218 - 4226. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Skinner, K. M. Deleault, R. Fecteau, and S. A. Brooks Extracellular Signal-regulated Kinase Regulation of Tumor Necrosis Factor-{alpha} mRNA Nucleocytoplasmic Transport Requires TAP-NxT1 Binding and the AU-rich Element J. Biol. Chem., February 8, 2008; 283(6): 3191 - 3199. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T. Pritchard, S. Roychowdhury, M. R. McMullen, L. Guo, G. E. Arteel, and L. E. Nagy Early growth response-1 contributes to galactosamine/lipopolysaccharide-induced acute liver injury in mice Am J Physiol Gastrointest Liver Physiol, December 1, 2007; 293(6): G1124 - G1133. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Baranek, R. Debret, F. Antonicelli, B. Lamkhioued, A. Belaaouaj, W. Hornebeck, P. Bernard, M. Guenounou, and R. Le Naour Elastin Receptor (Spliced Galactosidase) Occupancy by Elastin Peptides Counteracts Proinflammatory Cytokine Expression in Lipopolysaccharide-Stimulated Human Monocytes through NF-{kappa}B Down-Regulation J. Immunol., November 1, 2007; 179(9): 6184 - 6192. [Abstract] [Full Text] [PDF] |
||||
![]() |