|
Volume 272, Number 28,
Issue of July 11, 1997
pp. 17802-17809
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.
PU.1 Is Essential for p47phox Promoter
Activity in Myeloid Cells*
(Received for publication, February 26, 1997)
Sen-Lin
Li
,
Anthony J.
Valente
,
Shu-Jie
Zhao
and
Robert A.
Clark
From the Department of Medicine, University of Texas Health Science
Center and South Texas Veterans Health Care System, Audie L. Murphy
Division, San Antonio, Texas 78284-7870
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
ABSTRACT
Expression of the phagocyte cytosolic protein
p47phox, a component of NADPH oxidase, is restricted mainly to
myeloid cells. To study the cis-elements and trans-acting
factors responsible for its gene expression, we have cloned and
characterized the p47phox promoter. A predominant
transcriptional start site was identified 21 nucleotides upstream of
the translation initiation codon. To identify the gene promoter
sequences, transient transfections of HL-60 human myeloid cells were
performed with a series of 5 -deletion p47phox-luciferase reporter constructs that
extended as far upstream as 3050 bp relative to the transcriptional
start site. The 224 and 86 constructs had the strongest
p47phox promoter activity, whereas the 46
construct showed a major reduction in activity and the 36 construct a
complete loss of activity. DNase I footprint analysis identified a
protected region from 37 to 53. This region containing a consensus
PU.1 site bound specifically both PU.1 present in nuclear extracts from
myeloid cells and PU.1 synthesized in vitro. Mutations of
this site eliminated PU.1 binding and abolished the ability of the
p47phox promoter to direct expression of the
reporter gene. The p47phox promoter was active in
all myeloid cell lines tested (HL-60, THP-1, U937, PLB-985), but not in
non-myeloid cells (HeLa, HEK293). Finally, PU.1 trans-activated the
p47phox-luciferase constructs in HeLa cells. We
conclude that, similar to certain other myeloid-specific genes,
p47phox promoter activity in myeloid cells requires
PU.1.
INTRODUCTION
Polymorphonuclear neutrophils constitute the first line of host
defense against many pathogenic bacteria and fungi. Their ability to
kill invading microorganisms depends to a large extent on reactive
oxygen intermediates generated by the phagocyte NADPH oxidase (1-3).
The importance of the NADPH oxidase in the host defense system is
emphasized by the genetic disorder chronic granulomatous disease,
wherein victims suffer severe and recurrent infections because of a
functionally defective NADPH oxidase (1, 2, 4-7). On the other hand,
these highly toxic reactive oxygen species can cause significant tissue
injury during inflammation (8-10). Thus, it is essential that their
generation and the activity of the NADPH oxidase are tightly
regulated.
The leukocyte superoxide-generating NADPH oxidase is a coordinated
assemblage of the membrane-associated heterodimeric flavocytochrome b558 (gp91phox plus p22phox)
with four cytosolic factors, p67phox, p47phox,
p40phox, and a small GTP-binding protein (Rac1/2) (7). As a
general rule, the full complement of oxidase constituents is expressed only in phagocytic cells of the myeloid lineage, although exceptions have been noted. The gp91phox subunit of the cytochrome was
found to be myeloid-specific, whereas p22phox is widely
expressed, but not incorporated into membranes in the absence of the
large subunit (11). Early studies on p47phox and
p67phox showed expression restricted to neutrophils, other
phagocytes, and B lymphocytes (12, 13), and similar myeloid specificity was subsequently reported for p40phox (14). Rac1 and Rac2, on
the other hand, are widely expressed (15).
Systems or individual components similar to the phagocyte NADPH oxidase
have been described in a number of other types of cells, including
human fibroblasts (16-18), human glomerular mesangial cells (19, 20),
rat glomerular epithelial cells (21), rat osteoclasts (22), and bovine
(23) and human (24) endothelial cells. In at least some cases, these
systems are not identical to the phagocyte NADPH oxidase. For example,
the cytochrome b component in fibroblasts was reported to be
structurally and genetically distinct from that in phagocytes (17).
Moreover, the functional status of these non-phagocyte oxidase systems
has not always been clear, as for instance in the case of human
endothelial cells, which express the oxidase components at the
transcript and protein levels, but lack the cytochrome b
heme spectrum (24). In summary, current evidence indicates that
p22phox and the Rac proteins are widely expressed, whereas the
other oxidase components are expressed selectively, although not
exclusively in myeloid phagocytic cells.
Transcriptional regulation of NADPH oxidase components has been
described in most detail for the gp91phox subunit of cytochrome
b (25, 26). The distal promoter region contains a CCAAT box
motif that binds the transcription factor CP1. However, this
interaction is prevented by a CCAAT displacement protein that binds to
the region surrounding the CCAAT box, thereby repressing transcription.
Down-regulation of the repressor appears to be required for expression
of gp91phox.
Specific factors involved in the transcription of other components of
NADPH oxidase have not been characterized. We have focused on the
regulation of expression of p47phox, an essential cytosolic
component of the phagocyte oxidase. In general, immature myeloid cells
express little or no p47phox, whereas during differentiation
transcripts and protein are induced in parallel with the acquisition of
superoxide-generating activity (13, 27). The induction of
p47phox gene expression occurs at the
transcriptional level (13). Tumor necrosis factor, retinoic acid,
1,25(OH)2-vitamin D3, lipoteichoic acid, and
lipopolysaccharide up-regulate p47phox gene
expression (27-29). However, colony stimulating factor-1 has no effect
(30), whereas interleukin-10 down-regulates expression (31).
Interferon- decreases levels of p47phox mRNA and protein
in mature phagocytes (32), but enhances expression of p47phox
induced by tumor necrosis factor, retinoic acid, and
1,25(OH)2-vitamin D3 in cultured myeloid cell
lines (27, 28).
To understand better these complex events, we have initiated studies of
transcriptional regulation of the p47phox gene by
cloning, sequencing, and functionally characterizing its promoter. Here
we report that the region of the first 86 base pairs of the
p47phox gene 5 -flanking sequence possess
tissue-specific promoter activity in myeloid cells. The myeloid
transcription factor PU.1 is absolutely required for this function.
EXPERIMENTAL PROCEDURES
Materials
RPMI 1640 was obtained from Life Technologies,
Inc. and Serum PlusTM medium supplement from JRH Biosciences (Lenexa,
KS). Restriction enzymes, T4 polynucleotide kinase, RNasin, avian
myeloblastosis virus reverse transcriptase, and pGL3-Basic luciferase
vector and the luciferase assay kit were from Promega (Madison, WI). [ -32P]ATP, 6000 Ci/mmol, was obtained from NEN Life
Science Products. The TA Cloning Kit (containing the pCRII vector) for
cloning products of the polymerase chain reaction
(PCR)1 was obtained from Invitrogen (San
Diego, CA). Oligonucleotides were synthesized by the Advanced DNA
Technology Unit, University of Texas Health Science Center. The
Sequenase DNA sequencing kit was obtained from U. S. Biochemical Corp.
PU.1 and PEA3 antibodies were purchased from Santa Cruz Biotechnology
(Santa Cruz, CA).
Primer Extension Analysis
Poly(A)+ RNA was
isolated from HL-60 cells using oligo(dT)-cellulose (FastTrack Kit,
Invitrogen). A reverse oligonucleotide primer corresponding to nt
43-19 of the cDNA sequence (33) was labeled with
[ -32P]ATP and T4 polynucleotide kinase and 5 × 105 counts co-precipitated with 2.5 µg of HL-60
poly(A)+ RNA and 15 µg of the total RNA. Primer-RNA
hybridization was carried out overnight at 42 °C in 40 mM PIPES, pH 6.4, 1 mM EDTA, 400 mM
NaCl, and 80% deionized formamide. Following precipitation and washing
in ethanol, the primer-RNA complex was dissolved in H2O and
reverse transcribed by incubating with 40 units of avian myeloblastosis
virus reverse transcriptase at 42 °C for 90 min in a 25-µl
reaction mixture containing 50 mM Tris-HCl, pH 8.3, 50 mM KCl, 10 mM MgCl2, 0.5 mM spermidine, 10 mM dithiothreitol, 0.6 mM each of dATP, dTTP, dGTP, and dCTP, and 40 units of
RNasin. The product was then digested with 40 ng of RNase A at 37 °C
for 30 min, phenol/chloroform-extracted, precipitated in ethanol, and
separated on a sequencing gel. On the same gel a standard dideoxy
sequencing reaction using the same oligonucleotide primer and the
plasmid containing ~1.2 kb of p47phox genomic
sequence as template was also separated for identification of the bases
corresponding to the transcription start site (TSS). Autoradiography
using Kodak X-Omat film was carried out at 70 °C.
Human p47phox Genomic Cloning and Sequencing
The
p47phox 5 -flanking region was cloned by using the
PromoterFinder Kit (CLONTECH, Palo Alto, CA)
according to the manufacturer's protocol. PCR was performed using the
human genomic libraries provided as templates to amplify the desired
sequences. The forward primer was complementary to the adaptor ligated
to the genomic DNA fragments in each library. The reverse primer
(5 -CTGGGTACGAAGCGCTTCTCAAAGC-3 , see Fig. 1) corresponded to bp 75-50
of the p47phox cDNA. The amplified products were
analyzed on a 1.2% agarose gel and then subjected to the second PCR
with nested primers. The reverse primer
(5 -GGGCGATGTGACGGATGAAGGTGTC-3 ) used corresponded to bp 43-19 of the
cDNA. The final PCR products were cloned directly into the pCRII
vector and their identities confirmed by sequencing. Nucleotide
sequencing was carried out in both directions using the dideoxy
termination procedure and sequence-specific oligonucleotide primers.
Fig. 1.
Sequence analysis of the
p47phox promoter. The translation
initiation codon is doubly underlined. The transcriptional start site is overlined by a forward arrow and
designated as bp +1. Consensus sequences are underlined and
labeled for eight Ets binding sites (a PU.1 site, an Ets-1 site, and
six PEA3 sites), seven GATA sites, 12 Sp1 binding sites, a c-Myb
binding site, and a PEBP2/CBF binding site. Binding sites for other
known transcription factors, although present, are omitted for clarity.
The reverse primers used for cloning are underscored with
dotted lines.
[View Larger Version of this Image (65K GIF file)]
Luciferase Vector Construction
Reporter vectors were
constructed in the pGL3-Basic luciferase vector. The promoter regions
excised by digestion with XhoI and HindIII from
the pCRII-p47phox clones were subcloned into
promoterless luciferase reporter plasmid pGL3-Basic at the same
restriction sites. The constructs generated, the inserts of which all
go downstream to +52 relative to the TSS of the
p47phox gene, use the p47phox
translation initiation codon ligated in-frame to the luciferase open
reading frame.
For deletion construction PCR was done using the plasmid construct
pGL3-p47phox-1217 (i.e. from 1217
relative to the TSS, downstream to +52 followed by the luciferase open
reading frame) as template, a luciferase antisense oligonucleotide
(pGLprimer2, CTTTATGTTTTTGGCGTCTTCC) as the reverse primer and
oligonucleotides synthesized with an XhoI restriction site
linked to the desired 5 terminus of the p47phox
promoter as the forward primers. The PCR-amplified products were digested with XhoI and HindIII and ligated to
XhoI/HindIII-digested pGL3-Basic.
For PU.1 binding site mutation, we used a site-directed mutagenesis kit
(QuikChange, Stratagene, La Jolla, CA). The mutagenic primer (with
altered nucleotides underlined) was
5 -CAAAAGCGACTTGGTGTTTCCAGTGC-3 . The
constructs were confirmed by restriction mapping and sequencing.
Cell Culture
The human promyelocytic cell line HL-60 was
grown in RPMI 1640 medium supplemented with 10% Serum Plus and 10 mM HEPES. For 1 day prior to transfection and after
transfection, the cells were maintained in RPMI 1640 supplemented with
10% fetal bovine serum. The human monocyte cell line THP-1, the
promonocyte cell line U937, and the myeloid leukemia cell line PLB-985
were maintained in RPMI 1640 supplemented with 10% fetal bovine serum.
Two non-myeloid cell lines, the human cervical carcinoma epithelial
cell line HeLa and the transformed human embryonic kidney cell HEK293,
were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum. All media contained penicillin and
streptomycin.
Transient Transfections
The cells were maintained at a
density of about 5 × 105 cells/ml. Transfection was
carried out by electroporation. Briefly, cells were resuspended in
medium containing 20 µg of the luciferase reporter constructs and 4 µg of a cytomegalovirus- -galactosidase vector (pCMV- -gal) as a
transfection efficiency control. Electroporation was accomplished at
960 microfarads and 250 V. At 48 h the cells were washed three
times in phosphate-buffered saline, pH 7.4, lysed in 100 µl of 1 × reporter lysis buffer (Promega), and centrifuged at 12,000 rpm at
ambient temperature, and 20-µl aliquots of the supernatants were
tested in the luciferase assay system (Promega) using a Turner TD-20e
luminometer. -Galactosidase was assayed using a microassay procedure
(34) and standardized with purified -galactosidase (Sigma).
In Vitro Translations
The mouse PU.1 cDNA (a gift of
Dr. M. Klemsz, Indiana University, Indianapolis, IN) was excised by
digestion with EcoRI and then inserted into pBluescript SK.
A clone with the desired orientation was transcribed and translated
in vitro using T3 RNA polymerase and the TnT-coupled
reticulocyte lysate system (Promega). The synthesized
[35S]methionine-PU.1 was analyzed by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis and autoradiography. A
predominant band of approximately 38 kDa was observed, consistent with
the molecular mass previously reported (35). The control un-programmed
sample (i.e. no cDNA) gave no corresponding band.
Nuclear Extracts
HL-60 cells were disrupted by cavitation
using a technique described previously for polymorphonuclear
neutrophils (36). The cells were washed twice in phosphate-buffered
saline, pH 7.4, resuspended in 10 ml of cold relaxation buffer (100 mM KCl, 3 mM NaCl, 3.5 mM
MgCl2, 10 mM PIPES, pH 7.3), and 3.5 µl of
diisopropyl fluorophosphate (Sigma) were added. The cells were kept on
ice for 10 min, then centrifuged at 400 × g for 5 min.
The cell pellet was resuspended in 10 ml of relaxation buffer and
pressurized in N2 at 350 p.s.i. for 20 min in a
nitrogen bomb (Parr Instrument Co., Moline, IL) and released into 750 µl of a solution containing 20 mM EGTA, 100 mM MgCl2, 20 mM DTT, 4 mM phenylmethylsulfonyl fluoride, and 2 mM
sodium orthovanadate. The cavitated cells were centrifuged at 400 × g for 10 min at 4 °C, the nucleus-enriched pellet
resuspended and further purified on a discontinuous gradient of sucrose
(0.3 M/0.88 M). The nuclear fraction was
extracted in ~100 µl of urea extraction buffer (1.1 mM
urea, 1% Nonidet P-40, 5% glycerol, 0.5 mM
MgCl2, 5 mM KCl, 0.05 mM EDTA, 5 mM HEPES, pH 7.9) and microcentrifuged. The supernatant was
collected and stored in aliquots at 70 °C. The protein
concentration was determined using the Bradford reagent (Bio-Rad).
DNase I Protection Assay
Plasmid constructs were linearized
with MluI and end-labeled with [ -32P]CTP
and Klenow DNA polymerase. The insert was then excised by digestion
with HindIII and gel-purified. The nuclear extract was preincubated for 30 min on ice in 50 µl of buffer containing 50 mM NaCl, 0.1 mM EDTA, 0.5 mM DTT,
10% glycerol, 20 mM HEPES/KOH, pH 7.5, 2 µg poly-d(I-C).
The labeled DNA (~100,000 cpm) was then added, and the incubation was
continued at 25 °C. After 15 min, 5 µl each of 50 mM
MgCl2, 10 mM CaCI2, and diluted
DNase I were added. The incubation was continued for 1 min prior to the
addition of 100 µl of stop solution (0.375% SDS, 15 mM
EDTA, 100 mM NaCl, 100 mM Tris-HCl, pH 7.6).
Calf thymus DNA (10 µg) and proteinase K (20 µg) were added and the
mixture incubated at 37 °C for 15 min, then 95 °C for 5 min, and
phenol/chloroform-extracted and ethanol-precipitated. Finally, the DNA
was separated on 6% denaturing polyacrylamide gels, using
Maxam-Gilbert G+A sequencing reactions of the labeled fragments as the
markers.
Electrophoretic Mobility Shift Assay (EMSA)
Complementary
DNA oligonucleotides were annealed by heating in 1 × NET at
95 °C for 5 min and cooling at ambient temperature. Probes were then
labeled with [ -32P]ATP and T4 polynucleotide kinase.
For gel shift assays nuclear extract (6 µg) was incubated for 20 min
at ambient temperature with 5 × 104 cpm of the
labeled DNA probe in 20 µl of binding buffer containing 10 mM Tris-HCl, pH 7.6, 50 mM NaCl, 1 mM EDTA, 1 mM dithiothreitol, 5% glycerol, 1 µg/µl bovine serum albumin, 2 µg of poly-d(I-C). For supershift
assays, 2 µg of specific antibody was added and the reaction
continued for 15 min. Samples were loaded on 6% nondenaturing polyacrylamide gels, and electrophoresis was carried out at 200 V in 25 mM Tris, pH 8.5, with 190 mM glycerol and 1 mM EDTA. Competition assays were carried out in the same
manner, except that the above reaction mixture was preincubated with
competitor DNA for 10 min at 4 °C before addition of the labeled
probe.
RESULTS
Cloning of the p47phox 5 -Promoter Region
The
p47phox promoter region was cloned using the
PromoterFinder kit (CLONTECH). The nested reverse
primers for the first and second round PCR (see Fig. 1)
were derived from the p47phox cDNA to obtain the
specific products. The PCR products amplified from 4 of 5 human
sub-genomic libraries appeared as single bands, each of a different
size (3.0, 2.2, 1.4, and 1.2 kb), on agarose gels. These products were
cloned into the pCRII vector and their identification verified by
direct sequence continuity of the 3 ends with the 5 portion of
p47phox cDNA. Fig. 1 shows the complete sequence
of the longest clone. This 5 -flanking region, like the promoters of
other myeloid-specific genes such as CD11b and
CD18 (37, 38), lacks a proximal authentic CAAT or TATA box,
but the sequence TTTAA at 28 relative to the TSS (see below), flanked
on both sides by G+C-rich sequences, has some similarity to the most
common consensus sequence TATAAAA. Moreover, the initiator sequence,
which appears to direct the site of initiation and basal level of
transcription in many TATA-less promoters (39), was not present.
However, sequence motifs were found in the p47phox
promoter that correspond to binding sites of a number of known transcription factors. These include several purine-rich elements of
the type that bind to the ets family of transcription factors. One of
them, located at bp 45, is identical to the binding site for PU.1, a
factor required for terminal myeloid gene expression and
differentiation (40). Multiple binding sites are noted for GATA-1, a
critical transcription factor in the development of hematopoietic cells
(41), and for Sp1, which is essential for myeloid-specific
CD11b promoter activity (42). At bp 2194 is a c-Myb
binding site, which is present and functional in the neutrophil elastase gene. c-Myb also cooperates with avian C/EBP to activate the mim-1 and lysozyme genes in myeloid cells (43, 44).
PEBP2/CBF binds to and regulates the murine myeloperoxidase gene
proximal enhancer (45) and activates an early myeloid gene, the
macrophage colony-stimulating factor receptor (M-CSFR) (44). A similar binding site is found at bp 63 of the p47phox
promoter.
Identification of the p47phox Transcriptional Start
Site
To prove that we had, indeed, isolated the
p47phox 5 -promoter region, we next determined the
start site of transcription by primer extension. Poly(A)+
RNA was extracted from Me2SO-treated HL-60 cells, which
express increased levels of p47phox. The RNA was annealed to a
32P-labeled oligonucleotide complementary to nt 43-19 of
the published cDNA sequence (33) and then reverse-transcribed. The
extension products are displayed alongside p47phox
antisense sequence generated with the same oligonucleotide primer (Fig.
2). We identified a single predominant TSS,
corresponding to an adenine residue (thymidine on the antisense strand)
located 21 nt 5 of the translation initiation site (and 52 nt 5 of
the primer). This result was confirmed by ribonuclease protection analysis (data not shown). This location maps to within one nucleotide of a previously reported p47phox TSS (13, 46). We
designated this nucleotide as +1 for our remaining experiments
involving the p47phox gene.
Fig. 2.
Mapping of the p47phox
gene transcriptional start site by primer extension. An
antisense oligonucleotide complementary to bp 43-19 of the cDNA
was end-labeled and hybridized to RNA of Me2SO-treated
HL-60 cells. The primer was extended by reverse transcription, and the
product was analyzed by gel electrophoresis alongside a set of Sanger
sequencing reactions (lanes G, A, T, and C as marked) primed with the identical oligonucleotide.
An arrow indicates the extended product, which corresponds
to 21 nt upstream from the translation initiation codon. Negative
control reactions (HL-60 RNA replaced by yeast tRNA) produced no bands (data not shown).
[View Larger Version of this Image (24K GIF file)]
Localization of p47phox Promoter Activity
To identify
cis-elements and trans-acting factors important in
p47phox promoter activity, we linked 8 cloned
fragments of the p47phox genomic DNA ranging in size
from 3050 to 36 bp to the luciferase reporter gene. These constructs
and the promoterless vector pGL3-Basic were co-transfected into HL-60
cells with pCMV- -gal (to correct for differences in transfection
efficiency). Fig. 3 shows the normalized data. An
increase of ~30-fold in luciferase activity was observed in lysates
prepared from cells transfected with pGL3-p47-224 and pGL3-p47-86
constructs (the first 224 or 86 nucleotides upstream from the TSS,
respectively) compared with pGL3-Basic vector. The shorter construct
pGL3-p47-46 was less than 30% as active, while the shortest one
pGL3-p47-36 was completely inactive, indicating that sequences
critical for p47phox promoter activity are located
between bp 86 and 36. Constructs extending further 5 gave
gradually less luciferase activity, suggesting the presence of negative
regulatory elements upstream from bp 224 of the
p47phox promoter.
Fig. 3.
Characterization of the functional promoter
of the p47phox gene. Log phase HL-60 cell
cultures were transfected with the indicated constructs. All
p47phox constructs extended from the indicated
residue of the promoter (i.e. 3050, 2151, 1392,
1217, 224, 86, 46, or 36) downstream to residue +52.
Luciferase activity was determined 48 h post-transfection and
reported relative to the base-line activity of the promoterless construct (pGL3-Basic). Values were corrected for transcription efficiency by co-transfection of a -galactosidase expression plasmid. Data (mean ± S.E.) shown are from at least five
independent experiments.
[View Larger Version of this Image (34K GIF file)]
A Protected Region in the Proximal Promoter Is a PU.1 Consensus
Site
To test for protein-binding sites in the proximal
5 -flanking region required for myeloid promoter activity of the
p47phox gene, we used DNase I footprinting. The
p47phox genomic DNA fragment extending from bp 86
to +52 was analyzed using a nuclear extract from HL-60 cells. As
illustrated in Fig. 4, increasing amounts of HL-60
nuclear extract showed graded protection from DNase I digestion of a
16-nt region between nt 37 and 52 (5 -AAAGAGGAAGTCGCTT-3 ; lower
strand), compared with the probe in the absence of nuclear extract. The
protected sequence corresponds exactly to the PU.1 consensus motif
GAGGAA (47).
Fig. 4.
DNase-I footprint analysis of the
p47phox proximal promoter. The labeling of
the p47phox genomic DNA fragment extending from 86
to +52 was carried out by Mlu I digestion of pGL3-p47-86 and followed
by filling the recessed 3 termini with [ -32P]CTP and
DNA polymerase I Klenow fragment. After excision by HindIII
digestion and gel purification the end-labeled probe was subjected to
Maxam-Gilbert sequencing reaction (indicated by G+A) or DNase I
digestion in the presence of 0, 5, 10, 20, or 40 µg of HL-60 nuclear
extract. The sequence (lower strand) of the protected region is shown
on the right with the PU.1 consensus motif in boldface
type.
[View Larger Version of this Image (50K GIF file)]
The Potential PU.1 Binding Site Is Bound Specifically by PU.1 from
Myeloid Cells and in Vitro Synthesized PU.1
To provide specific
evidence that the p47phox promoter-binding activity
was PU.1, we performed the EMSA (Fig. 5A).
Double-stranded oligonucleotide encompassing the protected region of
the p47phox promoter was bound by in
vitro-translated PU.1 (lanes 4 and 8), but
not by unprogrammed reticulocyte lysate (lane 3). Mutation of the PU.1 site on the lower strand from GAGGAA to CACCAA (48) eliminated this binding (lane 7). Nuclear extract from HL-60
cells bound to the 32P-labeled wild type oligonucleotide
probe (Fig. 5, panel A, lane 9; panel
B, lane 2) and gave a major shifted band that had an identical electrophoretic mobility to that observed with in
vitro translated PU.1 protein. In the nuclear extracts, several
complexes migrating faster and slower than in vitro
translated PU.1 protein are also observed, both of which have been
reported previously (48-50). The faster represent DNA-binding
complexes formed by proteolytic products of PU.1, whose PEST domain
renders it susceptible to protease cleavage. The slower ones may be due
to the association with other transcription factors. Abrogation of all
of these species by 250- or 50-fold molar excess of the unlabeled wild
type probe (Fig. 5B, lane 4 or 5,
respectively), but not by the probe with the mutated PU.1 binding site
(Fig. 5B, lane 6), demonstrates binding
specificity.
Fig. 5.
Electrophoretic mobility shift analysis of
the p47phox gene fragment extending from bp
55 to 30. Panel A, in vitro synthesized PU.1
protein binds to the p47phox promoter PU.1 site.
In vitro translated 35S-labeled PU.1 served as a
probe (lanes 2, 4, 5, 7,
and 8) and the unprogrammed reticulocyte lysate
(i.e. no cDNA) as its control (lanes 1,
3, and 6). Samples were incubated with no
oligonucleotide (lanes 1 and 2), the wild type
(Wt) oligonucleotide (CAAAAGCGACTTCCTCTTTCCAGTGC, lanes 3-5 and 8), or the mutant (Mt)
oligonucleotide (CAAAAGCGACTTGGTGTTTCCAGTGC (mutated residues underlined), lanes 6 and 7).
Where indicated (lane 5), 2 µg of antibody to PU.1 was
then added to the reaction. In addition, 32P-labeled
wild type oligonucleotide was incubated with (lane 9) or
without (lane 10) HL-60 nuclear extract. DNA-protein
complexes were separated on a 6% polyacrylamide gel. PU.1>
indicates the specific complex, whereas SS> indicates the
supershifted complex. Panel B, PU.1 in HL-60 nuclear extract
binds specifically to the p47phox promoter.
32P-Labeled wild type oligonucleotide was incubated without
(lane 1) or with (lanes 2-6) HL-60 nuclear
extract in the absence (lanes 1-3) or presence of excess
wild type (Wt, lanes 4 and 5) or
mutant (Mt, lane 6) oligonucleotide. Where
indicated (lane 3) 2 µg of antibody to PU.1 was then
added.
[View Larger Version of this Image (70K GIF file)]
We next confirmed that the HL-60 cell-derived binding species that
comigrated with in vitro translated PU.1 indeed represented PU.1. Incubation of the in vitro translated PU.1 with
PU.1-specific antibody (against the epitope corresponding to amino
acids 251-271 mapping to its carboxyl terminus) inhibited this binding
species and resulted in supershifted complexes (Fig. 5A,
lane 5). Addition of the PU.1 antibody to the reaction of
the oligonucleotide probe and HL-60 nuclear extract also inhibited
binding and generated similar supershifted complexes (Fig.
5B, lane 3), whereas addition of antibody to PEA3
(another member of the Ets family) had no effect (not shown).
PU.1 Site Mutations Abolish p47phox Promoter
Activity
To verify the importance of the PU.1 binding site for
myeloid-specific p47phox expression, we mutated this
site (48) and tested for effects on p47phox promoter
function. As shown in Fig. 5, an oligonucleotide with a mutated PU.1
site did not compete with PU.1 binding to the wild type region and did
not bind to in vitro translated PU.1 or PU.1 from HL-60
nuclear extracts. This same mutation was then introduced by PCR into
three of the p47phox promoter-luciferase constructs
to form pGL-p47-2151Mt, pGL3-p47-224Mt, and pGL3-p47-86Mt. Transient
transfection experiments comparing the wild type plasmid constructs and
their mutated counterparts demonstrated that mutation of the PU.1
binding site reduced promoter activity to the control promoterless
level (Fig. 6), implying that PU.1 binding is essential
for p47phox promoter activity in HL-60 cells.
Fig. 6.
Mutation of the PU.1 binding site eliminates
p47phox promoter activity. Transfection of
HL-60 cells, determination of luciferase activity, and expression of
results were performed as in Fig. 3. The p47phox
constructs as indicated were either the same as in Fig. 3
(Wt) or contained the mutated PU.1 binding site
(Mt). Data (mean ± S.E.) shown are from at least four
independent experiments.
[View Larger Version of this Image (43K GIF file)]
The p47phox Promoter Is Myeloid Tissue-specific
The
documentation in the literature that expression of both PU.1 and
p47phox is selective for myeloid cells and B lymphocytes
in vivo is consistent with our observation that PU.1 is
essential for p47phox promoter activity. To verify
this in our experimental system, we transfected the pGL3-p47-86
construct into myeloid (HL-60, THP-1, PLB-985, and U937) and
non-myeloid (HeLa, HEK293) cell lines. As shown in Fig.
7A, the pGL3-p47-86 construct is active in
all the myeloid cell lines tested, exhibiting a 15- to 36-fold increase
in reporter activity, while the activity in non-myeloid cells is
negligible, indicating that tissue specificity of the p47phox promoter is retained, even in the first 86 bp of the 5 -flanking region.
Fig. 7.
Tissue specificity of the
p47phox promoter. Panel A, the
p47phox promoter directs expression of the
luciferase reporter gene in various myeloid cell lines, but not in
non-myeloid cell lines. Transfection of cells, determination of
luciferase activity, and expression of results were performed as in
Fig. 3, except that the indicated myeloid (HL-60, THP-1, PLB-985, and
U937) and non-myeloid (HEK293 and HeLa) cell lines were used. Data
(mean ± S.E.) shown are from at least three independent
experiments. Panel B, the p47phox
promoter PU.1 site binds specifically to nuclear extract of HL-60 or
THP-1 cells, but not to that of HeLa cells. Procedures were similar to
those in Fig. 5B. 32P-Labeled
oligonucleotide representing bp 55 to 30 of the
p47phox promoter was incubated alone (lane
1) or with HL-60 (lanes 2-5), THP-1 (lanes
6 and 7), or HeLa (lanes 8 and 9)
nuclear extracts in the absence (lanes 2, 5,
6, and 8) or presence of a 200-fold excess of
either wild type (Wt, lanes 3, 7, and
9) or mutant (Mt, lane 4) competing
oligonucleotide. Where indicated (lane 5), 2 µg of
antibody to PU.1 was added to the reaction. PU.1> indicates the specific complex, whereas SS> indicates the
supershifted complex.
[View Larger Version of this Image (49K GIF file)]
We reasoned that if the myeloid tissue specificity of
p47phox gene expression is due to PU.1 binding
specifically to the promoter, PU.1 binding activity should be detected
in these cells by EMSA. As shown in Fig. 7B, strong PU.1
binding activity was observed in the nuclear extracts of myeloid cell
lines HL-60 and THP-1, but was undetectable in the non-myeloid HeLa
cell extract.
PU.1 Trans-activates the p47phox Promoter
To
demonstrate that PU.1 is critical for p47phox
promoter activity, co-trans-activation experiments were performed with
the non-myeloid HeLa cell line, which lacks endogenous PU.1. The
promoterless luciferase expression vector pGL3-Basic or the
p47phox luciferase construct pGL3-p47-46 or
pGL3-p47-86 was transfected into HeLa cells with and without
co-transfection of the PU.1 expression plasmid PJ6-mPU.1 (Fig.
8). Co-transfection of PU.1 increased the activity of
the p47phox promoters about 3-fold. That the
trans-activation depended on binding of PU.1 to the putative site in
the proximal portion of the p47phox promoter was
confirmed by transfecting the PU.1 binding site-mutated p47phox luciferase construct PGL3-p47-86Mt together
with the PU.1 expression vector. No increase in reporter gene
expression was observed with the mutated construct.
Fig. 8.
PU.1 trans-activates the
p47phox promoter in HeLa cells. A PU.1
expression vector (3 µg) designated PJ6-mPU.1 was co-transfected into
HeLa cells along with 20 µg of the indicated wild type (pGL3-p47-86
or pGL3-p47-46) or PU.1 binding site-mutated (pGL3-p47-86Mt) reporter
construct. Luciferase activity was determined as in Fig. 3 and reported
relative to the base-line luciferase activity of the promoterless
construct pGL3-Basic. Data (mean ± S.E.) shown are from at least
three independent experiments.
[View Larger Version of this Image (45K GIF file)]
DISCUSSION
Our results demonstrate that PU.1 plays an essential role in basal
transcription of the p47phox gene. In transient
transfection studies, the pGL3-p47-86 and pGL3-p47-46 constructs,
both containing the PU.1 binding site, showed promoter activity in
myeloid cells at full or reduced levels, respectively, whereas the PU.1
site-deleted construct pGL3-p47-36 lost promoter activity completely.
Co-transfection of a PU.1 expression vector resulted in
trans-activation of the p47-luciferase reporter constructs. Footprint
analysis revealed a DNase I-protected site from 37 to 52. The
protected region containing a consensus PU.1 site bound specifically
both to PU.1 extracted from myeloid cells and to that synthesized
in vitro. Importantly, mutation of the PU.1 site in
constructs pGL3-p47-86Mt, pGL3-p47-224Mt, and pGL3-p47-2151Mt abolished promoter activity completely, highlighting the essential role
of the PU.1 element in p47phox promoter function.
This feature contrasts with many other myeloid-specific genes that
exhibit only partial dependence on PU.1 binding activity (51, 52). In
the case of CD11b gene expression Sp1 binding is essential,
although PU.1 also plays an important role (42). The mechanism by which
PU.1 operates to contribute to p47phox gene
transcription is unclear, although it is attractive to hypothesize that
during assembly of the transcription initiation complex, PU.1 promotes
the interaction between Sp1 and the TFIID complex by recruiting
TATA-binding protein (TBP) (53, 54). However, using TBP-specific
antibody we did not detect TBP association with the PU.1-DNA complex by
EMSA (data not shown).
The PU.1 proto-oncogene was first identified 10 kb downstream of the
site of Friend erythroleukemia virus integration in virally induced
tumors. Viral integration results in overexpression of PU.1 mRNA in
erythroid cells, an event linked to tumorigenesis (55). PU.1 is
expressed exclusively in the hematopoietic system at high levels in B
lymphocytic, granulocytic, and monocytic cells and at lower levels in
immature erythroid cells (40). Since p47phox is expressed
selectively in myeloid cells and B lymphocytes (12, 13), it shares with
PU.1 similar tissue specificity. PU.1 gene knockout mice show a
multilineage defect in development of B and T lymphocytes, monocytes,
and granulocytes (56). An in vitro system based on
differentiation of embryonic stem cells into hematopoietic cells
revealed that early myelopoiesis is relatively unaffected by a mutation
in the PU.1 gene, but later developmental events are blocked and
differentiation markers, CD-11b, M-CSFR, and CD-64, are absent
(57).
The PU.1 consensus binding sequence GAGGAA is present in several
myeloid-specific promoters and has been shown to be critical for the
expression of CD11b and CD18 (49, 58). The PU.1
binding site in the p47phox promoter matches at 12 of 14 nt with the SV40 PU.1 binding site (59), the first defined and
best known example. Compared with previously reported PU.1 binding
sites, the p47phox site is one of the best matches
to the SV40 site. However, the critical nucleotides reside at the
central consensus sequence since mutations of this sequence eliminate
p47phox promoter activity and the binding to PU.1
protein. Of note, in the CD11b promoter PU.1 binds to a site
that does not conform to the consensus sequence, yet an upstream
GAGGAA sequence is not bound by PU.1 (58). Furthermore, the PU.1
requirement for DNA binding is confined to a short core sequence that
has a high statistical representation in eukaryotic genomes. Thus, the
GAGGAA sequence is not guaranteed to be a PU.1 binding site and
the actual role of potential PU.1 sites in other myeloid-specific genes
must be individually defined.
When HL-60 cells were transfected with a series of
p47phox-luciferase constructs, pGL3-p47-86 and
pGL3-p47-224 displayed the strongest promoter activity (~30-fold
induction), whereas pGL3-p47-46 gave much less promoter activity
(~5-fold induction), indicating contributions of DNA sequence between
86 and 46 to p47phox promoter activity in
myeloid cells. This region immediately 5 to the PU.1 site may enhance
binding of PU.1 to the p47phox promoter or, since it
contains several putative promoter motifs, could bind other
transcription factors. Although we have detected specific interactions
between the DNA probe representing this region and nuclear extracts
from HL-60 cells (data not shown), it is not yet clear which
cis-elements and which transcription factors are responsible
for the observed promoter activity. First, the sequences CCCTCC and
CCTGCC which overlap at bp 78 are functional in the promoter of human
myeloperoxidase, a myeloid-specific gene (60, 61). Second, at bp 63
the sequence GACCGC is a putative site for binding of PEBP/CBF, which
is involved in the transcriptional regulation of the myeloid-specific
genes encoding for myeloperoxidase, elastase, and M-CSFR (44, 45).
Third, Sp1 sites are present between bp 79 and 71 (GGGGCAGGG, lower
strand) (62). However, our preliminary EMSA experiments militate
against a functional role for Sp1, since antibody to this protein
neither diminished the specific band nor gave a supershift. Finally,
the CTC box (CCCTCCC) located at bp 83 is present in a number of
genes, such as that for lysyl oxidase (63). Interestingly, this motif
is a target for binding of Sp1 in the genes for human medium chain acyl-CoA dehydrogenase (64) and murine 1,4-galactosyltransferase (65),
but not human phenylalanine hydroxylase (66). Moreover, the CTC box
appears to be unique to the promoters of extracellular matrix proteins,
binding a novel protein or protein complex in these genes (67). Whether
this promoter region of p47phox binds to
myeloid-specific or more broadly acting transcriptional factors remains
to be elucidated.
Recently, Gorlach et al. (68) reported a
p47phox pseudogene that is highly homologous to the
gene itself, with the notable exception of a GT deletion at the
beginning of exon 2 leading to a frameshift and premature stop codon.
These authors suggested that recombination between the wild type
p47phox gene and its pseudogene is the main cause of
the autosomal recessive form of chronic granulomatous disease
associated with absence of p47phox protein. The intron-exon
structures of the wild type and pseudogene are identical, they are
similarly transcribed and there are no major differences in their
proximal promoter regions (68). Our new data are compatible with this
observation. We found only minor sequence differences in the promoter
regions among the four original constructs pGL3-p47-3050,
pGL3-p47-2151, pGL3-p47-1392, and pGL3-p47-1217, generated from each
of four sub-genomic libraries. There are minor variations between our
clones and the sequence in the GenBankTM data base (accession number
U33006) submitted by Thrasher. Nevertheless, all of these clones
contain the PU.1 binding site at 45, and the sequences from bp 86
to-46 are identical among the clones, indicating the validity of the
conclusion of this study that PU.1 is essential for
p47phox promoter activity in myeloid cells.
The HL-60 cell line was derived from a patient with promyelocytic
leukemia (69). Me2SO treatment induces its differentiation along the neutrophilic lineage, and p47phox
expression increases dramatically due to the induction of transcription of this gene (12, 13). We predicted that the
p47phox-luciferase reporter constructs used in the
current work would express greater promoter activity in
Me2SO-differentiated HL-60 cells than in undifferentiated
HL-60 cells. In preliminary experiments this does not appear to be the
case (data not shown). Two potential explanations come to mind. First,
the Me2SO response elements of the
p47phox gene may reside outside of our
p47phox-luciferase constructs, including the longest
one pGL3-p47-3050, either further upstream or downstream in an intron.
Second, in addition to the control of initiation of gene
transcription, elongation blockade, usually soon after
initiation, is emerging as an important mechanism in regulation of gene
expression (70). The increase in p47phox mRNA
during Me2SO-induced differentiation could be due to a
release of elongation blockade imposed after transcription initiation in undifferentiated HL-60 cells. We are currently testing these interesting possibilities.
FOOTNOTES
*
This work was supported by Grants AI20866 and HL52665 from
the National Institutes of Health.The costs of publication of this article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF003533.
To whom correspondence should be addressed: Dept. of Medicine,
University of Texas Health Science Center, 7703 Floyd Curl Dr., San
Antonio, TX 78284-7870. Tel.: 210-567-4810; Fax: 210-567-4654; E-mail:
clarkra{at}uthscsa.edu.
1
The abbreviations used are: PCR, polymerase
chain reaction; bp, base pair(s); EMSA, electrophoretic mobility shift
assay; kb, kilobase pair(s); M-CSFR, macrophage colony-stimulating
factor receptor; nt, nucleotide(s); TBP, TATA-binding protein; TSS,
transcriptional start site; DTT, dithiothreitol; PIPES,
piperazine-N,N -bis(2-ethanesulfonic acid).
ACKNOWLEDGEMENTS
We thank Dr. M. Klemsz for a generous gift of
the murine PU.1 cDNA and Dr. S. K. Ahuja for many helpful
suggestions during the course of this work.
REFERENCES
-
Clark, R. A.
(1990)
J. Infect. Dis.
161,
1140-1147
[Medline]
[Order article via Infotrieve]
-
Dinauer, M. C.
(1993)
Crit. Rev. Clin. Lab. Sci.
30,
329-369
[Medline]
[Order article via Infotrieve]
-
Chanock, S. J., El Benna, J., Smith, R. M., and Babior, B. M.
(1994)
J. Biol. Chem.
269,
24519-24522
[Free Full Text]
-
Curnutte, J. T.
(1993)
Clin. Immunol. Immunopathol.
67,
S2-S15
[CrossRef][Medline]
[Order article via Infotrieve]
-
Thrasher, A. J., Keep, N. H., Wientjes, F., and Segal, A. W.
(1994)
Biochim. Biophys. Acta
1227,
1-24
[Medline]
[Order article via Infotrieve]
-
Roos, D., De Boer, M., Kuribayashi, F., Meischl, C., Weening, R. S., Segal, A. W., Åhlin, A., Nemet, K., Hossle, J. P., Bernatowska-Matuszkiewicz, E., and Middleton-Price, H.
(1996)
Blood
87,
1663-1681
[Free Full Text]
-
Segal, A. W.
(1996)
Mol. Med. Today
2,
129-135
[CrossRef][Medline]
[Order article via Infotrieve]
-
Klebanoff, S. J.
(1980)
Ann. Intern. Med.
93,
480-489
-
Clark, R. A.
(1983)
in
Advances in Inflammation Research (Weissmann, G., ed), pp. 107-146, Raven Press, New York
-
Weiss, S. J.
(1989)
N. Engl. J. Med.
320,
365-376
[Medline]
[Order article via Infotrieve]
-
Parkos, C. A., Dinauer, M. C., Walker, L. E., Allen, R. A., Jesaitis, A. J., and Orkin, S. H.
(1988)
Proc. Natl. Acad. Sci. U. S. A.
85,
3319-3323
[Abstract/Free Full Text]
-
Volpp, B. D., Nauseef, W. M., and Clark, R. A.
(1988)
Science
242,
1295-1297
[Abstract/Free Full Text]
-
Rodaway, A. R. F., Teahan, C. G., Casimir, C. M., Segal, A. W., and Bentley, D. L.
(1990)
Mol. Cell. Biol.
10,
5388-5396
[Abstract/Free Full Text]
-
Wientjes, F. B., Hsuan, J. J., Totty, N. F., and Segal, A. W.
(1993)
Biochem. J.
296,
557-561
-
Didsbury, J., Weber, R. F., Bokoch, G. M., Evans, T., and Snyderman, R.
(1989)
J. Biol. Chem.
264,
16378-16382
[Abstract/Free Full Text]
-
Meier, B., Cross, A. R., Hancock, J. T., Kaup, F. J., and Jones, O. T. G.
(1991)
Biochem. J.
275,
241-245
-
Meier, B., Jesaitis, A. J., Emmendörffer, A., Roesler, J., and Quinn, M. T.
(1993)
Biochem. J.
289,
481-486
-
Jones, S. A., Wood, J. D., Coffey, M. J., and Jones, O. T. G.
(1994)
FEBS Lett.
355,
178-182
[CrossRef][Medline]
[Order article via Infotrieve]
-
Radeke, H. H., Cross, A. R., Hancock, J. T., Jones, O. T. G., Nakamura, M., Kaever, V., and Resch, K.
(1991)
J. Biol. Chem.
266,
21025-21029
[Abstract/Free Full Text]
-
Jones, S. A., Hancock, J. T., Jones, O. T. G., Neubauer, A., and Topley, N.
(1995)
J. Am. Soc. Nephrol.
5,
1483-1491
[Abstract]
-
Neale, T. J., Ullrich, R., Ojha, P., Poczewski, H., Verhoeven, A. J., and Kerjaschki, D.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
3645-3649
[Abstract/Free Full Text]
-
Steinbeck, M. J., Appel, W. H., Jr., Verhoeven, A. J., and Karnovsky, M. J.
(1994)
J. Cell Biol.
126,
765-772
[Abstract/Free Full Text]
-
Zulueta, J. J., Yu, F. S., Hertig, I. A., Thannickal, V. J., and Hassoun, P. M.
(1995)
Am. J. Respir. Cell Mol. Biol.
12,
41-49
[Abstract]
-
Jones, S. A., O'Donnell, V. B., Wood, J. D., Broughton, J. P., Hughes, E. J., and Jones, O. T. G.
(1996)
Am. J. Physiol.
271,
H1626-H1634
[Abstract/Free Full Text]
-
Skalnik, D. G., Strauss, E. C., and Orkin, S. H.
(1991)
J. Biol. Chem.
266,
16736-16744
[Abstract/Free Full Text]
-
Lievens, P. M. J., Donady, J. J., Tufarelli, C., and Neufeld, E. J.
(1995)
J. Biol. Chem.
270,
12745-12750
[Abstract/Free Full Text]
-
Gupta, J. W., Kubin, M., Hartman, L., Cassatella, M., and Trinchieri, G.
(1992)
Cancer Res.
52,
2530-2537
[Abstract/Free Full Text]
-
Obermeier, H., Sellmayer, A., Danesch, U., and Aepfelbacher, M.
(1995)
Biochim. Biophys. Acta
1269,
25-31
[Medline]
[Order article via Infotrieve]
-
Levy, R., and Malech, H. L.
(1991)
J. Immunol.
147,
3066-3071
[Abstract]
-
Green, S. P., Hamilton, J. A., Uhlinger, D. J., and Phillips, W. A.
(1994)
J. Leukocyte Biol.
55,
530-535
[Abstract]
-
Kuga, S., Otsuka, T., Niiro, H., Nunoi, H., Nemoto, Y., Nakano, T., Ogo, T., Umei, T., and Niho, Y.
(1996)
Exp. Hematol.
24,
151-157
[Medline]
[Order article via Infotrieve]
-
Cassatella, M. A., Bazzoni, F., Flynn, R. M., Dusi, S., Trinchieri, G., and Rossi, F.
(1990)
J. Biol. Chem.
265,
20241-20246
[Abstract/Free Full Text]
-
Volpp, B. D., Nauseef, W. M., Donelson, J. E., Moser, D. R., and Clark, R. A.
(1989)
Proc. Natl. Acad. Sci. U. S. A.
86,
7195-7199
[Abstract/Free Full Text]
-
Rouet, P., Raguenez, G., and Salier, J. P.
(1992)
Biotechniques
13,
700-701
[Medline]
[Order article via Infotrieve]
-
Himmelmann, A., Thevenin, C., Harrison, K., and Kehrl, J. H.
(1996)
Blood
87,
1036-1044
[Abstract/Free Full Text]
-
Borregaard, N., Heiple, J. M., Simons, E. R., and Clark, R. A.
(1983)
J. Cell Biol.
97,
52-61
[Abstract/Free Full Text]
-
Pahl, H. L., Rosmarin, A. G., and Tenen, D. G.
(1992)
Blood
79,
865-870
[Abstract/Free Full Text]
-
Rosmarin, A. G., Levy, R., and Tenen, D. G.
(1992)
Blood
79,
2598-2604
[Abstract/Free Full Text]
-
Weis, L., and Reinberg, D.
(1992)
FASEB J.
6,
3300-3309
[Abstract]
-
Simon, M. C., Olson, M., Scott, E., Hack, A., Su, G., and Singh, H.
(1996)
Curr. Top. Microbiol. Immunol.
211,
113-119
[Medline]
[Order article via Infotrieve]
-
Orkin, S. H.
(1992)
Blood
80,
575-581
[Free Full Text]
-
Chen, H.-M., Pahl, H. L., Scheibe, R. J., Zhang, D.-E., and Tenen, D. G.
(1993)
J. Biol. Chem.
268,
8230-8239
[Abstract/Free Full Text]
-
Mink, S., Kerber, U., and Klempnauer, K.-H.
(1996)
Mol. Cell. Biol.
16,
1316-1325
[Abstract]
-
Friedman, A. D.
(1996)
Curr. Top. Microbiol. Immunol.
211,
149-157
[Medline]
[Order article via Infotrieve]
-
Zhang, D.-E., Fujioka, K., Hetherington, C. J., Shapiro, L. H., Chen, H.-M., Look, A. T., and Tenen, D. G.
(1994)
Mol. Cell. Biol.
14,
8085-8095
[Abstract/Free Full Text]
-
Casimir, C. M., Bu-Ghanim, H. N., Rodaway, A. R. F., Bentley, D. L., Rowe, P., and Segal, A. W.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
2753-2757
[Abstract/Free Full Text]
-
Klemsz, M. J., McKercher, S. R., Celada, A., Van Beveren, C., and Maki, R. A.
(1990)
Cell
61,
113-124
[CrossRef][Medline]
[Order article via Infotrieve]
-
Hohaus, S., Petrovick, M. S., Voso, M. T., Sun, Z., Zhang, D.-E., and Tenen, D. G.
(1995)
Mol. Cell. Biol.
15,
5830-5845
[Abstract]
-
Rosmarin, A. G., Caprio, D., Levy, R., and Simkevich, C.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
801-805
[Abstract/Free Full Text]
-
Pongubala, J. M. R., Nagulapalli, S., Klemsz, M. J., McKercher, S. R., Maki, R. A., and Atchison, M. L.
(1992)
Mol. Cell. Biol.
12,
368-378
[Abstract/Free Full Text]
-
Moulton, K. S., Semple, K., Wu, H., and Glass, C. K.
(1994)
Mol. Cell. Biol.
14,
4408-4418
[Abstract/Free Full Text]
-
Ahne, B., and Stratling, W. H.
(1994)
J. Biol. Chem.
269,
17794-17801
[Abstract/Free Full Text]
-
Hagemeier, C., Bannister, A. J., Cook, A., and Kouzarides, T.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
1580-1584
[Abstract/Free Full Text]
-
Moreau-Gachelin, F.
(1994)
Biochim. Biophys. Acta
1198,
149-163
[Medline]
[Order article via Infotrieve]
-
Moreau-Gachelin, F., Tavitian, A., and Tambourin, P.
(1988)
Nature
331,
277-280
[CrossRef][Medline]
[Order article via Infotrieve]
-
Scott, E. W., Simon, M. C., Anastasi, J., and Singh, H.
(1994)
Science
265,
1573-1577
[Abstract/Free Full Text]
-
Olson, M. C., Scott, E. W., Hack, A. A., Su, G. H., Tenen, D. G., Singh, H., and Simon, M. C.
(1995)
Immunity
3,
703-714
[CrossRef][Medline]
[Order article via Infotrieve]
-
Pahl, H. L., Scheibe, R. J., Zhang, D.-E., Chen, H.-M., Galson, D. L., Maki, R. A., and Tenen, D. G.
(1993)
J. Biol. Chem.
268,
5014-5020
[Abstract/Free Full Text]
-
Petterson, M., and Schaffner, W.
(1987)
Genes Dev.
1,
962-972
[Abstract/Free Full Text]
-
Zhao, W. G., Regmi, A., Austin, E. D., Braun, J. E., Racine, M., and Austin, G. E.
(1996)
Leukemia
10,
1089-1103
[Medline]
[Order article via Infotrieve]
-
Austin, G. E., Zhao, W.-G., Zhang, W., Austin, E. D., Findley, H. W., and Murtagh, J. J., Jr.
(1995)
Leukemia
9,
848-857
[Medline]
[Order article via Infotrieve]
-
Thiesen, H. J., and Bach, C.
(1990)
Nucleic Acids Res.
18,
3203-3209
[Abstract/Free Full Text]
-
Hamalainen, E. R., Kemppainen, R., Pihlajaniemi, T., and Kivirikko, K.
(1993)
Genomics
17,
544-548
[CrossRef][Medline]
[Order article via Infotrieve]
-
Leone, T. C., Cresci, S., Carter, M. E., Zhang, Z., Lala, D. S., Strauss, A. W., and Kelly, D. P.
(1995)
J. Biol. Chem.
270,
16308-16314
[Abstract/Free Full Text]
-
Rajput, B., Shaper, N. L., and Shaper, J. H.
(1996)
J. Biol. Chem.
271,
5131-5142
[Abstract/Free Full Text]
-
Wang, Y., Hahn, T. M., Tsai, S. Y., and Woo, S. L. C.
(1994)
J. Biol. Chem.
269,
9137-9146
[Abstract/Free Full Text]
-
Bruggeman, L. A., Burbelo, P. D., Yamada, Y., and Klotman, P. E.
(1992)
Oncogene
7,
1497-1502
[Medline]
[Order article via Infotrieve]
-
Gorlach, A., Roesler, J., Hopkins, P. J., Christensen, B. L., Lee, P., Green, E. D., Chanock, S. J., and Curnutte, J. T.
(1995)
Blood
86,
260a
-
Collins, S. J., Gallo, R. C., and Gallagher, R. E.
(1977)
Nature
270,
347-349
[CrossRef][Medline]
[Order article via Infotrieve]
-
Aso, T., Conaway, J. W., and Conaway, R. C.
(1995)
FASEB J.
9,
1419-1428
[Abstract]
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.
|