Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yu, B.
Right arrow Articles by Simon, M. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yu, B.
Right arrow Articles by Simon, M. I.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 29, Issue of July 18, 1997 pp. 18015-18019
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Characterization of a Goalpha Mutant That Binds Xanthine Nucleotides*

(Received for publication, March 25, 1997, and in revised form, May 5, 1997)

Bo Yu , Vladlen Z. Slepak Dagger and Melvin I. Simon §

From the Division of Biology, California Institute of Technology, Pasadena, California 91125

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES


ABSTRACT

Several GTP binding proteins, including EF-Tu, Ypt1, rab-5, and FtsY, and adenylosuccinate synthetase have been reported to bind xanthine nucleotides when the conserved aspartate residue in the NKXD motif was changed to asparagine. However, the corresponding single Goalpha mutant protein (D273N) did not bind either xanthine nucleotides or guanine nucleotides. Interestingly, the introduction of a second mutation to generate the Goalpha subunit D273N/Q205L switched nucleotide binding specificity to xanthine nucleotide. The double mutant protein Goalpha D273N/Q205L (Goalpha X) bound xanthine triphosphate, but not guanine triphosphate. Recombinant Goalpha X (Goalpha D273N/Q205L) formed heterotrimers with beta gamma complexes only in the presence of xanthine diphosphate (XDP), and the binding to beta gamma was inhibited by xanthine triphosphate (XTP). Furthermore, as a result of binding to XTP, the Goalpha X protein underwent a conformational change similar to that of the activated wild-type Goalpha . In transfected COS-7 cells, we demonstrate that the interaction between Goalpha X and beta gamma occurred only when cell membranes were permeabilized to allow the uptake of xanthine diphosphate. This is the first example of a switch in nucleotide binding specificity from guanine to xanthine nucleotides in a heterotrimeric G protein alpha  subunit.


INTRODUCTION

G proteins transduce receptor-generated signals across the plasma membranes of eukaryotic cells. They are heterotrimeric complexes composed of alpha , beta , and gamma  subunits. Each of the subunits belongs to a multigene protein family, containing at least 18 distinct alpha , 5 beta , and 11 gamma  subunits. Hundreds of seven-transmembrane receptors activated by a great variety of hormones, neuromediators, and growth factors are coupled to G proteins. Receptor-induced activation of a G protein leads to exchange of GDP for GTP bound to the alpha subunit. The GTP-bound alpha  subunit is released from the alpha beta gamma trimeric complex, and both free alpha  and beta gamma dimers are capable of modulating activities of effector enzymes and ion channels (1-3). G protein-mediated signaling is complicated; a single receptor can activate more than one kind of heterotrimer, and both the activated alpha  and the beta gamma subunits can interact with multiple effectors. For example, the thrombin receptor is known to couple to G12, Gi, and Gq family members (4), and physiological responses may be the result of contributions by both alpha  and beta gamma subunits. Furthermore, cross-talk between these different G protein-regulated pathways makes the networks even more complex.

One way to analyze this complex network is to specifically activate a particular Galpha in vivo to discern its function without interference from other G proteins. As a first step toward this goal, we used site-specific mutagenesis to switch the nucleotide specificity of Galpha from guanine to xanthine nucleotides. In cells, xanothine monophosphate is an intermediate in the biosynthesis of GMP; however, the steady-state concentrations of XDP1 and XTP are relatively low (5). Thus, by subsequent introduction of XTP, we should be able to specifically activate the mutant protein. The alpha  subunits of heterotrimeric G proteins belong to the GTPase superfamily that also includes factors involved in ribosomal protein synthesis, such as EF-Tu, and a large number of Ras-like small guanine nucleotide binding proteins (6, 7). Crystal structures of the alpha  subunits of transducin and Gi have been recently solved (8-11). Both Galpha structures had nearly identical binding pockets for the guanine nucleotide, which was similar to the guanine nucleotide binding pocket revealed in the crystal structures of Ras (12) and EF-Tu (13, 14). One of the conserved features was the interaction between a specific Galpha amino acid residue and the guanine nucleotide ring, i.e. a hydrogen bond from the side chain of a conserved aspartic acid (Asp-268 in transducin) to the N-1 nitrogen and the N2 amine of the guanine ring (see Fig. 1a). Asp-268 of transducin belongs to a conserved motif (NKXD) found in the GTPase superfamily. It has been shown that the characteristic hydrogen bond formed with the aspartic acid residue determines the specificity of guanine nucleotide binding in other GTP-binding proteins, such as EF-Tu and Ras (15, 16). A mutation of aspartate to asparagine at this position in several GTP binding proteins, including EF-Tu (17, 18), Ypt1 (19), rab-5 (20, 21), and FtsY (22) and adenylosuccinate synthetase (23), leads to active proteins regulated by xanthine nucleotides instead of guanine nucleotides. In this report, we studied the effect of the similar D273N mutation on nucleotide binding specificity of Goalpha .


Fig. 1. a, interaction between the aspartic acid side chain at position 268 in the alpha  subunit of transducin with the guanine ring of GTPgamma S, revealed by the solved crystal structure. b, a proposed model for the interaction between the substituted asparagine residue at position 273 in Goalpha and the xanthine ring.
[View Larger Version of this Image (7K GIF file)]


MATERIALS AND METHODS

Mutagenesis and Expression of the Goalpha

Myristoylated recombinant mouse GoAalpha was expressed in Escherichia coli. Conditions for growth, induction, and lysis of the Goalpha -expressing cells were described previously (24). The D273N mutation was introduced in both wild-type Goalpha and the activated mutant Goalpha Q205L by oligonucleotide-directed mutagenesis. The oligonucleotide TTTCTAAACAAGAAAAATTTATTTGGCGAGAAGATTAAGAAGTC was annealed to uracil-containing single-stranded DNA from the plasmids pGoalpha and pGoalpha Q205L. The resulting vectors were designated as pGoalpha D273N and pGoalpha X.

Expression and Purification of His6-tagged Goalpha

We subcloned wild type and mutant Goalpha cDNAs into the E. coli expression vector pET-15b (Novagen), which added a peptide of 20 amino acids MGSS(H6)SSGLVPRGSH containing the His6 tag and a thrombin site upstream of the amino terminus of Goalpha . These clones were used to transform the E. coli strain BL21(DE3), and proteins were expressed. After harvesting the culture, cell extracts were resuspended in the binding buffer (5 mM imidazole, 0.5 M NaCl, 160 mM Tris-HCl, pH 7.9, 1 mM beta Me). Binding to the Ni2+-NTA resin was according to the protocol provided by Novagen. The His6-tagged protein was eluted with a gradient of imidazole concentration (5-500 mM). The Goalpha and various mutant proteins eluted at about 250 mM imidazole. Proteins were then transferred to TED buffer (20 mM Tris-HCl, pH 8.0, 1 mM EDTA, 1 mM DTT) with 0.1 mM MgCl2 and 0.1 mM nucleotide diphosphate (GDP or XDP as appropriate) by gel filtration. Purified proteins were stored in 50% glycerol at -70 °C.

Synthesis of XTPgamma S

XTPgamma S was synthesized from XDP and ATPgamma S with nucleotide diphosphate kinase (NDK) as described previously (25). To produce 35S-labeled XTPgamma S, the reaction contained 10 µM XDP, 1 µM [35S]ATPgamma S, and 10 units NDK (Sigma) in 100 µl of NDK buffer (1 mM MgCl2, 5 mM DTT, 20 mM Tris-HCl, pH 8.0). The mixture was incubated at room temperature for 2 h. The resulting concentration of [35S]XTPgamma S was about 1 µM (1 µCi/pmol). The radiochemical purity of XTPgamma S was monitored by thin layer chromatography on Avicel/DEAE plates (Analtech) in 0.07 N HCl.

Nucleotide Binding

Binding of [35S]GTPgamma S and [35S]XTPgamma S to the recombinant Goalpha and the mutant proteins was performed as described (24). The binding reaction contained 0.5 µg of purified protein or 200 µg of crude E. coli protein in TED buffer with 0.1 mM MgCl2, 1 µM ATP, and 0.1 µM GTPgamma S or XTPgamma S (20,000 cpm/pmol). For the time course experiments, 20-µl aliquots were withdrawn from a 200-µl reaction, diluted 10-fold with ice-cold TED buffer containing 0.1 mM MgCl2, filtered through a 0.45-µm nitrocellulose filter, washed, and dried. The amount of bound radioactivity was determined by scintillation counting.

Proteolysis with Trypsin

Approximately 0.1 µg of purified recombinant Goalpha was preincubated with nucleotide at room temperature for 30 min in the TED buffer. 10 ng of trypsin was then added to the mixture, and the reaction was terminated after 10 min by addition of an equal volume of 2 × SDS-PAGE sample buffer and heating for 3 min at 100 °C. The proteolytic pattern was subsequently analyzed by Western blot using antibodies against Goalpha .

ADP-ribosylation by Pertussis Toxin

Pertussis toxin-catalyzed ADP-ribosylation was performed as described (24). Briefly, 0.1 µg of recombinant Goalpha was mixed with 0.1 µg of purified retinal beta gamma subunit complex in the presence of the appropriate nucleotide and incubated for 10 min at room temperature before addition of the reaction mixture (final concentration of 20 mM Tris-HCl, pH 8.0, 1 mM EDTA, 2 mM MgCl2, 2 mM DTT, 0.5 µM [32P]NAD (20,000 cpm/pmol), and 10 µg/ml pertussis toxin (List Biologicals)). Reactions were incubated for 30 min at room temperature and terminated by the addition of 5 × SDS-PAGE sample buffer. Samples were resolved on SDS-PAGE. Gels were stained with Coomassie Blue, dried, and exposed to x-ray film.

Cell Culture and Transfection

COS-7 cells were cultured in Dulbecco's modified Eagle's medium containing 10% fetal calf serum. 1 × 105 cells/well were seeded in 12-well plates 1 day before transfection. All transfection assays contained a total amount of 1 µg of DNA; the plasmid pCIS encoding beta -galactosidase was used to maintain a constant amount of DNA. To each well, 1 µg of DNA was mixed with 5 µl of lipofectamine (Life Technologies, Inc.) in 0.5 ml of Opti-MEM (Life Technologies, Inc.), and five h later, 0.5 ml of 20% fetal calf serum in Dulbecco's modified Eagle's medium was added to the cells. After 48 h, cells were assayed for inositol phosphate levels as described previously (26, 27).

Permeabilization of COS-7 Cell Membranes

Transfected COS-7 cells were washed twice with phosphate-buffered saline and incubated in 200 µl of permeabilization solution consisting of 115 mM KCl, 15 mM NaCl, 0.5 mM MgCl2, 20 mM Hepes-NaOH, pH 7, 1 mM EGTA, 100 µM ATP, 0.37 mM CaCl2 (to give a free Ca2+ concentration of 100 nM), and 200 units/ml alpha -toxin with or without 0.1 mM XDP for 10 min at 37 °C. Then 2 µl of 1 M LiCl was added before the inositol phosphate assay.


RESULTS

To change the binding specificity of Goalpha from guanine nucleotides to xanthine nucleotides, we replaced Asp-273 by an asparagine residue, which was expected on the basis of structural analysis to coordinate with xanthine instead of guanine (Fig. 1b). This mutation was introduced into both the wild-type Goalpha subunit and the GTPase-deficient Goalpha mutant (Q205L). We chose Goalpha because myristoylated Goalpha can be expressed in E. coli, and it has been shown that many of the characteristics of the recombinant Goalpha protein are similar to those of the protein isolated from brain. To further characterize the function of XTP-bound Goalpha mutants, we purified these proteins in the form of non-myristoylated His6-tagged Goalpha by affinity chromatography on a Ni2+-NTA column. It has been shown that the non-myristoylated form of Goalpha has identical nucleotide binding properties compared with the myristoylated form, and it also forms trimeric complexes with beta gamma subunits although the affinity to beta gamma is much less than the myristoylated form (44).

Binding of GTPgamma S and XTPgamma S

The nucleotide binding of Goalpha , Goalpha D273N, and Goalpha X (Goalpha D273N/Q205L) was assayed with [35S]GTPgamma S and [35S]XTPgamma S. In E. coli crude extracts, Goalpha reached maximum binding of GTPgamma S in about 30 min (Fig. 2a). As expected, Goalpha showed no affinity for XTPgamma S. However, Goalpha X revealed a switch in nucleotide specificity. As shown in Fig. 2b, Goalpha X had high affinity for XTPgamma S but not for GTPgamma S. Interestingly, only the double mutant was active while Goalpha D273N did not bind either GTPgamma S or XTPgamma S (data not shown). Goalpha binds GTPgamma S very tightly in the presence of 1 µM Mg2+ (28, 29). Both Goalpha (Fig. 2c) and Goalpha X (Fig. 2d) did not exchange bound [35S]NTPgamma S when excess non-radioactive nucleotides were subsequently added.


Fig. 2. Goalpha X binds XTPgamma S but not GTPgamma S. 20 µl of the E. coli extract containing wild-type Goalpha (a) or Goalpha X (b) was diluted 10-fold with TEDM buffer (20 mM Tris-HCl, pH 8.0, 1 mM EDTA, 1 mM DTT, 1 mM MgCl2) containing either 0.1 µM [35S]GTPgamma S or [35S]XTPgamma S (20,000 cpm/pmol) and incubated at room temperature. At the indicated times, 20-µl aliquots were withdrawn and assayed for the bound nucleotides. GTPgamma S binding of the purified His6-tagged Goalpha (c) and XTPgamma S binding of the purified His6-tagged Goalpha X (d) were compared with those of untagged Goalpha and Goalpha X in the E. coli extract. After 40 min, 1 mM unlabeled GTPgamma S (c) or XTP (d) was introduced into the reaction.
[View Larger Version of this Image (30K GIF file)]

The purified His6-tagged proteins in general retained the properties of the untagged myristoylated alpha  subunits. However, we detected some differences in nucleotide binding. His6-tagged Goalpha or Goalpha X bound GTPgamma S or XTPgamma S, respectively, but the binding was less stable than with the untagged myristoylated protein. In the case of His6-tagged Goalpha , the bound GTPgamma S could be exchanged after excess non-radioactive GTPgamma S was added (Fig. 2c). Similar behavior was observed in the XTPgamma S binding of pure His6-tagged Goalpha X, which also showed distinct nucleotide exchange after non-radioactive XDP or XTP were added to the binding reaction (Fig. 2d). The decrease in nucleotide affinity was apparently the result of the presence of the His6-tag. Although the nucleotide binding of His6-tagged proteins was less stable, the specificity of binding was clearly maintained, and the mutant bound the xanthine nucleotides rather than the guanine nucleotides. As expected, the purified single mutant Goalpha D273N did not show any nucleotide binding activity (data not shown).

Activation Conformational Change as Assessed by Limited Proteolysis

Guanine nucleotides protect G protein alpha  subunits, including Goalpha , from complete proteolytic degradation (30-32). The pattern of fragments derived from partial tryptic digestion can be used as an indicator of the conformation of the protein. In the presence of GDP, Goalpha is hydrolyzed by trypsin resulting in two products, a stable 25-kDa and an unstable 17-kDa peptide. Binding of non-hydrolyzable analogs of GTP can induce an active conformation of the Goalpha subunit, which is resistant to proteolytic degradation, and protects a stable 37-kDa polypeptide from further degradation. In the case of the activated mutant Goalpha Q205L, GTP can also protect the remaining 37-kDa polypeptide from complete proteolytic digestion by trypsin because Goalpha Q205L lacks GTPase activity. Fig. 3a shows that XTP protects Goalpha X from proteolysis by trypsin (lanes 4 and 5), whereas in the control experiment, GTPgamma S protected wild-type Goalpha (lane 8). This experiment indicates that Goalpha X binds XTP without hydrolyzing it. After binding to XTP, Goalpha X must have assumed a conformation similar to that of GTPgamma S-bound wild-type Goalpha . In this experiment, wild-type Goalpha needed only 1 µM GTPgamma S to prevent complete proteolysis. Similarly, Goalpha X was sufficiently protected in the presence of 1 µM XTP. It is noteworthy that GTPgamma S, but not GTP, was also able to protect Goalpha X from complete tryptic digestion although this protection required GTPgamma S concentrations above 100 µM (lanes 1, 2, and 3). Thus, Goalpha X has a much lower affinity for GTPgamma S than for XTP. We did not detect any of GTPgamma S binding activity of Goalpha X in our nucleotide binding assay because the highest concentrations of [35S]GTPgamma S used in the reaction were micromolar. Consistent with the results of the nucleotide binding experiments, the single mutant Goalpha D273N was not protected by any nucleotides including GTP, GTPgamma S, and XTP up to millimolar concentrations (data not shown).


Fig. 3. Functional Regulation of Goalpha by Xanthine Nucleotides. a, XTP protects the proteolysis of Goalpha X with trypsin. 0.1 µg of purified recombinant Goalpha or Goalpha X was incubated with indicated nucleotides at room temperature for 30 min. 10 ng of trypsin was then added to the mixture, and the reaction was terminated by addition of an equal volume of 2 × SDS-PAGE sample buffer. The proteolytic pattern was visualized by Western blot using an antibody against a C-terminal peptide of Goalpha . b, PTX-induced ADP-ribosylation of Goalpha X requires XDP and is inhibited by XTP. 0.1 µg of purified recombinant Goalpha or Goalpha X was mixed with 0.1 µg of purified bovine retinal beta gamma complex in the presence of indicated nucleotides (100 µM each, including the carry-over GDP or XDP from the protein storage buffer) and incubated for 10 min at room temperature. Then the reaction mixture containing 10 µg/ml pertussis toxin, 0.5 µM [32P]NAD (20,000 cpm/pmol), and other necessary components were added. Reactions were incubated for 30 min at room temperature and terminated by the addition of 10 µl of 5 × SDS-PAGE sample buffer. The samples were then resolved on a 10% SDS-polyacrylamide gel and visualized by autoradiography. The arrows indicate the positions of molecular mass markers.
[View Larger Version of this Image (23K GIF file)]

Pertussis Toxin-induced ADP-ribosylation

The interaction of Goalpha with the beta gamma complex can be assayed by ADP-ribosylation of the alpha  subunit induced by pertussis toxin (PTX) because ADP-ribosylation requires the formation of the heterotrimeric complex (33, 34). Modification (by ADP-ribosylation) of recombinant Goalpha catalyzed by PTX is the same in the presence of GTP or GDP because of the GTPase activity of Goalpha . However, GTPgamma S strongly inhibits the modification since Goalpha cannot hydrolyze GTPgamma S. GTPgamma S binding thus promotes the dissociation of the trimeric alpha beta gamma complex and prevents the ADP-ribosylation of the Goalpha subunit. The activated Goalpha Q205L mutant lacks GTPase activity, and the effect of GTP on ADP-ribosylation is similar to that of GTPgamma S on the wild-type Goalpha . Therefore, PTX labeling can be used not only to examine beta gamma binding but also GTPase activity. Fig. 3b shows that purified Goalpha was ADP-ribosylated by pertussis toxin (lane 7), and the labeling was strongly inhibited by GTPgamma S (lane 6). In contrast, Goalpha X was modified by pertussis toxin only in the presence of XDP (lane 4) but not with GDP (lane 5), and as expected, the reaction was strongly inhibited by XTP (lane 2), whereas GTP had no effect (lane 3). Therefore, only XDP-bound Goalpha X can form trimeric complexes with beta gamma , and binding of XTP induces dissociation of the trimeric complex. As a control, we did not detect any ADP-ribosylation of Goalpha X when GTPgamma S, GTP, or XTP alone was present (data not shown). Consistent with the results of trypsin digestion, this experiment indicated that XTP was not hydrolyzed by Goalpha X. The quantitation of [32P]ADP-ribose incorporation revealed that the labeling of Goalpha X was proportional to the amount of beta gamma used and reached a maximum at a Goalpha X:beta gamma ratio of 1:1, similar to wild-type Goalpha (data not shown). Interestingly, high concentrations (over 100 µM) of GTPgamma S also inhibited the ADP-ribosylation of Goalpha X (Fig. 3b, lane 1), offering further evidence that Goalpha X was able to bind GTPgamma S with low affinity. As expected, Goalpha D273N did not interact with beta gamma and was not modified by pertussis toxin in the presence of either GDP or XDP (data not shown).

XDP-dependent beta gamma Interaction in Transfected COS-7 Cells

In transfected COS-7 cells, beta 1gamma 2 is able to activate PLCbeta 2, and the activation of PLCbeta 2 can be inhibited by cotransfection with Goalpha because of competition for beta gamma (35). We cotransfected COS-7 cells with PLCbeta 2, beta 1, gamma 2, and Goalpha D273N or Goalpha X and found that both Goalpha mutants did not inhibit PLCbeta 2 activity, whereas wild-type Goalpha did. This experiment indicates that both mutants do not bind beta gamma in COS-7 cells and is consistent with the in vitro experiments on PTX-induced ADP-ribosylation. Goalpha X bound beta gamma only in the presence of XDP, and because XDP concentration is negligible inside the cell, the interaction did not occur. To deliver XDP into cells, we tried to permeabilize COS-7 cells by several methods including digitonin treatment, electroporation, and alpha -toxin (36). We found that only alpha -toxin gave us consistent results and had no effect on the PLCbeta 2 activities stimulated by beta gamma . After incubating cells with alpha -toxin in the presence of XDP, we found that Goalpha X inhibited PLCbeta 2 activity, whereas Goalpha D273N was not affected by XDP (Fig. 4). In the control experiments, we found that adding GDP or GTP to the permeabilization buffer had no effect on the PLCbeta 2 activity of cells transfected with the Goalpha mutants (data not shown). This experiment shows that the Goalpha mutants behave similarly in vitro and in cultured cells; Goalpha X binds beta gamma only when exogenous XDP is available.


Fig. 4. The interaction of Goalpha X with beta gamma in transfected COS-7 cells is XDP-dependent. 1 × 105 cells/well were seeded in a 12-well plate and then were transfected with cDNAs encoding the indicated proteins the next day. The total amount of cDNA for each well was adjusted to 1.0 µg by addition of CMV-LacZ cDNA. Cells were labeled with [3H]inositol, and the levels of inositol phosphates were determined after incubating cells with 200 units/ml alpha -toxin with or without 10-4 M XDP.
[View Larger Version of this Image (63K GIF file)]


DISCUSSION

We engineered a mutant of Goalpha that switched nucleotide binding activity from guanine nucleotides to xanthine nucleotides. The mutation (D273N) was at a conserved residue of the NKXD motif that appears in all GTPase superfamily proteins. Crystal structures of transducin and Gi showed that this aspartic acid residue participated in hydrogen bonding to the guanine ring (Fig. 1a). The proposed interaction between the mutagenized Asn and the xanthine ring is shown in Fig. 1b in which the hydrogen bond is "flipped" when compared with wild-type Galpha . Similar single Aspright-arrowAsn mutations have been made in other GTP binding proteins, including EF-Tu (17, 18), Ypt1 (19), rab-5 (20, 21), and FtsY (22), and E. coli adenylosuccinate synthetase (23), resulting in active proteins regulated by xanthine nucleotides instead of guanine nucleotides. However, the similar D119N mutant of H-Ras induced transformation of NIH-3T3 cells with efficiency indistinguishable from wild-type H-Ras (16, 37). Although the mutant D119N Ras exhibited decreased affinity for GTP and increased affinity for XTP (by 2 to 3 orders of magnitude), the high intracellular concentration of GTP (millimolar) probably ensures that the protein is still bound to the guanine nucleotides in the cell. Interestingly, we found the corresponding D273N mutation in Goalpha did not result in binding of either GTPgamma S or XTPgamma S, whereas the D273N/Q205L double mutant, Goalpha X, switched nucleotide binding ability. When examining the crystal structure of transducin, it is not clear why the Glnright-arrowLeu mutation (position 200 in transducin alpha ), which is at the opposite side of the nucleotide binding pocket from the Aspright-arrowAsn mutation (position 268 in transducin alpha ), rescued the xanthine nucleotide binding of Goalpha D273N. It is interesting to note that Goalpha X binds GTPgamma S at concentrations higher than 100 µM. In our nucleotide binding experiments, we could not observe this binding because the affinity was weak, requiring concentrations higher than 1 µM [35S]GTPgamma S, which was the highest concentration that we could use. The P-S bond of the gamma  phosphate in GTPgamma S is longer than the P-O bond in GTP, which not only prevents nucleotide hydrolysis when binding to G protein alpha  subunits, it also results in qualitatively different interactions and different affinities.

In vitro experiments using limited trypsin digestion and PTX-induced ADP-ribosylation showed that Goalpha X retained the characteristic properties of wild-type Goalpha in the presence of XDP or XTP. In addition, our data confirm the assumption that diphosphate nucleotides are required for the interaction of G protein alpha  subunits with beta gamma subunits. XTP-bound Goalpha X assumed a trypsin-resistant conformation similar to that of the activated wild-type Goalpha and stimulated beta gamma dissociation from the trimeric complex, suggesting that Goalpha X can be activated by XTP. In transfected COS-7 cells, PLCbeta 2 is activated by G protein beta gamma subunits, and the activity is inhibited when cotransfecting with Goalpha because of the competition for beta gamma . To study beta gamma binding of the mutant Goalpha X in vivo, we looked for inhibition of PLCbeta 2 activity as an indication of beta gamma binding. We found that Goalpha X did not affect beta gamma -stimulated PLCbeta 2 activity because of the absence of XDP. To turn on beta gamma binding, we used alpha -toxin to make cell membranes permeable to XDP, and indeed under these conditions, Goalpha X attenuated PLCbeta 2 activity. G protein-derived beta gamma subunits are shown to be able to bind many proteins other than Galpha , and may be involved in many signal transduction pathways. We demonstrated that XDP can be delivered into cells and Goalpha X may be used as a beta gamma quencher that can make the cellular beta gamma pool unavailable to other beta gamma effectors. The ability to turn on and off beta gamma in vivo could be useful to better understand the physiological function of beta gamma .

Goalpha is one of the G protein alpha  subunits whose functions are not well understood although there is some evidence supporting a role in the regulation of calcium channels (38-42). Since beta gamma subunits are also proposed as regulators of calcium channels (43), it is difficult to differentiate the activities of Goalpha and beta gamma in some situations when activated receptors release both Goalpha and beta gamma subunits. This is one of the problems that the Goalpha X mutant might be used to address. The channel may be activated directly by adding XTP without releasing free beta gamma in cells that have been transfected with cDNA expressing the mutant protein. Cross-talk between the different G protein-mediated signaling pathways has been well demonstrated. Activating Goalpha X directly and instantly by XTP would avoid the interference of other pathways and help us to differentiate individual pathways. Introducing this mutation into other G protein alpha  subunits may be used to study their functions as well.


FOOTNOTES

*   The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Dagger    Present address: Dept. of Molecular & Cellular Pharmacology, University of Miami School of Medicine, Miami, FL 33136.
§   To whom correspondence should be addressed: Division of Biology, California Institute of Technology, Pasadena, CA 91125. Tel.: 818-395-3944; Fax: 818-796-7066.
1   The abbreviations used are: XDP, xanthine diphosphate; XTP, xanthine triphosphate; DTT, dithiothreitol; NDK, nucleotide diphosphate kinase; PAGE, polyacrylamide gel electrophoresis; PTX, pertussis toxin; PLCbeta 2, phospholipase C beta 2.

ACKNOWLEDGEMENTS

We thank members of the Simon laboratory for helpful discussions and Drs. Lorna Brundage and Tau-Mu Yi for comments on the manuscript.


REFERENCES

  1. Neer, E. J. (1995) Cell 80, 249-257 [CrossRef][Medline] [Order article via Infotrieve]
  2. Simon, M. I., Strathman, M. P., and Gautam, N. (1991) Science 252, 802-808 [Abstract/Free Full Text]
  3. Gilman, A. G. (1987) Annu Rev. Biochem. 56, 615-649 [CrossRef][Medline] [Order article via Infotrieve]
  4. Grand, R. J. A., Turnell, A. S., and Grabham, P. W. (1996) Biochem. J. 313, 353-368
  5. Henderson, J. F., and Paterson, A. R. P. (1973) Nucleotide Metabolism, pp. 97-169, Academic Press, New York
  6. Bourne, H. R., Sanders, D. A., and McCormick, F. (1990) Nature 348, 125-132 [CrossRef][Medline] [Order article via Infotrieve]
  7. Bourne, H. R., Sanders, D. A., and McCormick, F. (1991) Nature 366, 654-663
  8. Noel, J., Hamm, H. E., and Sigler, P. B. (1993) Nature 366, 654-663 [CrossRef][Medline] [Order article via Infotrieve]
  9. Lambright, D. G., Noel, J. P., Hamm, H. E., and Sigler, P. B. (1994) Nature 369, 621-628 [CrossRef][Medline] [Order article via Infotrieve]
  10. Sondek, J., Lambright, D. G., Noel, J. P., Hamm, H. E., and Sigler, P. B. (1994) Nature 372, 276-279 [CrossRef][Medline] [Order article via Infotrieve]
  11. Coleman, D. E., Berghuis, A. M., Lee, E., Linder, M. E., Gilman, A. G., and Sprang, S. R. (1994) Science 265, 1405-1412 [Abstract/Free Full Text]
  12. De Vos, A. M., Tong, L., Milburn, M. V., Maniatis, P. M., Jancarik, J., Noguchi, S., Nishimura, S., Muira, K., Ohtsuka, E., and Kim, S.-H. (1988) Science 239, 888-893 [Abstract/Free Full Text]
  13. Jurnak, F. (1988) Science 230, 32-36
  14. La Cour, T. F. M., Nyborg, J., Thirup, S., and Clark, B. F. C. (1985) EMBO J. 4, 2385-2388 [Medline] [Order article via Infotrieve]
  15. Der, C. J., Pan, B.-T., and Cooper, G. M. (1986) Mol. Cell. Biol. 6, 3291-3294 [Abstract/Free Full Text]
  16. Feig, A. L., Pan, B.-T., Roberts, T. M., and Cooper, G. M. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 4607-4611 [Abstract/Free Full Text]
  17. Hwang, Y. W., and Miller, D. L. (1987) J. Biol. Chem. 262, 13081-13085 [Abstract/Free Full Text]
  18. Weijland, A., and Parmeggiani, A. (1993) Science 259, 1311-1314 [Abstract/Free Full Text]
  19. Jones, S., Litt, R. J., Richardson, C. J., and Seger, N. (1995) J. Cell Biol. 130, 1051-1061 [Abstract/Free Full Text]
  20. Rybin, V., Ullrich, O., Rubino, M., Alexandrov, K., Simon, I., Seabra, M., Goody, R., and Zerial, M. (1996) Nature 383, 266-269 [CrossRef][Medline] [Order article via Infotrieve]
  21. Hoffenberg, S., Nikolova, L., Pan, J. Y., Daniel, D. S., Wessling-Resnick, M., Knoll, B. J., and Dickey, B. F. (1995) Biochem. Biophys. Res. Commun. 215, 241-249 [CrossRef][Medline] [Order article via Infotrieve]
  22. Powers, T., and Wolter, P. (1995) Science 269, 1422-1424 [Abstract/Free Full Text]
  23. Kang, C., Sun, N., Honzatko, R. B., and Fromm, H. J. (1994) J. Biol. Chem. 269, 24046-24049 [Abstract/Free Full Text]
  24. Slepak, V. Z., Wilkie, T. M., and Simon, M. I. (1993) J. Biol. Chem. 268, 1414-1423 [Abstract/Free Full Text]
  25. Goody, R. S., Eckstein, F., and Schrimer, H. (1972) Biochim. Biophys. Acta 276, 155-161 [Medline] [Order article via Infotrieve]
  26. Wu, D., Lee, C. H., Rhee, S. G., and Simon, M. I. (1992) J. Biol. Chem. 267, 1811-1817 [Abstract/Free Full Text]
  27. Wu, D., Katz, A., Lee, C. H., and Simon, M. I. (1992) J. Biol. Chem. 267, 25798-25802 [Abstract/Free Full Text]
  28. Higashijima, T., Ferguson, K. M., Sternweis, P. C., Smigel, M. D., and Gilman, A. G. (1987) J. Biol. Chem. 262, 762-766 [Abstract/Free Full Text]
  29. Higashijima, T., Ferguson, K. M., Sternweis, P. C., Ross, E. M., Smigel, M. D., and Gilman, A. G. (1987) J. Biol. Chem. 262, 752-756 [Abstract/Free Full Text]
  30. Hurley, J. B., Simon, M. I., Teplow, D. B., Robishaw, J. D., and Gilman, A. G. (1984) Science 226, 860-862 [Abstract/Free Full Text]
  31. Graziano, M. P., and Gilman, A. G. (1989) J. Biol. Chem. 264, 15475-15482 [Abstract/Free Full Text]
  32. Denker, B. M., Neer, E. J., and Schmidt, C. J. (1992) J. Biol. Chem. 267, 6272-6277 [Abstract/Free Full Text]
  33. Bokoch, G. M., Katada, T., Northup, J. K., Hewlett, E. L., and Gilman, A. G. (1983) J. Biol. Chem. 258, 2072-2075 [Abstract/Free Full Text]
  34. Casey, P. J., Graziano, M. P., and Gilman, A. G. (1989) Biochemistry 28, 611-616 [CrossRef][Medline] [Order article via Infotrieve]
  35. Slepak, V. Z., Katz, A., and Simon, M. I. (1994) J. Biol. Chem. 270, 4037-4041 [Abstract/Free Full Text]
  36. Ahnert-Hilger, G., Mach, W., Fohr, K. J., and Gratzl, M. (1989) Methods Cell Biol. 31, 63-90 [Medline] [Order article via Infotrieve]
  37. Zhong, J.-M., Chen-Hwang, M.-C., and Hwang, Y.-W. (1995) J. Biol. Chem. 270, 10002-10007 [Abstract/Free Full Text]
  38. Kleuss, C., Hescheler, J., Ewel, C., Rosenthal, W., Schultz, G., and Wittig, B. (1991) Nature 353, 43-48 [CrossRef][Medline] [Order article via Infotrieve]
  39. Taussig, R., Sanchez, S., Rifo, M., Gilman, A. G., and Belardetti, F. (1992) Neuron 8, 799-809 [CrossRef][Medline] [Order article via Infotrieve]
  40. Lledo, P. M., Homburger, V., Bockaert, J., and Vincent, J.-D. (1992) Neuron 8, 455-463 [CrossRef][Medline] [Order article via Infotrieve]
  41. Kalkbrenner, F., Degtiar, V. E., Schenker, M., Brendel, S., Zobel, A., Heschler, J., Wittig, B., and Schultz, G. (1995) EMBO J. 14, 4728-4737 [Medline] [Order article via Infotrieve]
  42. Charpentier, N., Prezeau, L., Carrette, J., Bertorelli, R., Le Cam, G., Manzoni, O., Bockaert, J., and Homburger, V. (1993) J. Biol. Chem. 268, 8980-8989 [Abstract/Free Full Text]
  43. Ikeda, S. R. (1996) Nature 380, 255-258 [CrossRef][Medline] [Order article via Infotrieve]
  44. Denker, B. M., Neer, E. J., and Schmidt, C. J. (1992) J. Biol. Chem. 267, 6272-6277

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
P. J. Kammermeier and P. F. Worley
Homer 1a uncouples metabotropic glutamate receptor 5 from postsynaptic effectors
PNAS, April 3, 2007; 104(14): 6055 - 6060.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y.-L. Wu, S. B. Hooks, T. K. Harden, and H. G. Dohlman
Dominant-negative Inhibition of Pheromone Receptor Signaling by a Single Point Mutation in the G Protein {alpha} Subunit
J. Biol. Chem., August 20, 2004; 279(34): 35287 - 35297.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Molinari, C. Ambrosio, D. Riitano, M. Sbraccia, M. C. Gro, and T. Costa
Promiscuous Coupling at Receptor-Galpha Fusion Proteins. THE RECEPTOR OF ONE COVALENT COMPLEX INTERACTS WITH THE alpha -SUBUNIT OF ANOTHER
J. Biol. Chem., April 25, 2003; 278(18): 15778 - 15788.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Gille, K. Wenzel-Seifert, M. B. Doughty, and R. Seifert
GDP Affinity and Order State of the Catalytic Site Are Critical for Function of Xanthine Nucleotide-selective Galpha s Proteins
J. Biol. Chem., February 28, 2003; 278(10): 7822 - 7828.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. S. Feldman, A. M. Zamah, K. L. Pierce, W. E. Miller, F. Kelly, A. Rapacciuolo, H. A. Rockman, W. J. Koch, and L. M. Luttrell
Selective Inhibition of Heterotrimeric Gs Signaling. TARGETING THE RECEPTOR-G PROTEIN INTERFACE USING A PEPTIDE MINIGENE ENCODING THE Galpha s CARBOXYL TERMINUS
J. Biol. Chem., August 2, 2002; 277(32): 28631 - 28640.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. H. Ghahremani, C. Forget, and P. R. Albert
Distinct Roles for Galpha i2 and Gbeta gamma in Signaling to DNA Synthesis and Galpha i3 in Cellular Transformation by Dopamine D2S Receptor Activation in BALB/c 3T3 Cells
Mol. Cell. Biol., March 1, 2000; 20(5): 1497 - 1506.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
B. Yu, L. Gu, and M. I. Simon
Inhibition of Subsets of G Protein-coupled Receptors by Empty Mutants of G Protein alpha Subunits in Go, G11, and G16
J. Biol. Chem., January 7, 2000; 275(1): 71 - 76.
[Abstract] [Full Text] [PDF]