![]()
|
|
||||||||
(Received for publication, April 23, 1996, and in revised form, October 17, 1996)
From the APOBEC-1 is a catalytic subunit of an
apolipoprotein B (apoB) mRNA editing enzyme complex. In humans it
is expressed only in the intestine, whereas in mice it is expressed in
both the liver and intestine. APOBEC-1 exists as a spontaneous
homodimer (Lau, P. P., Zhu, H.-J., Baldini, A., Charnsangavej, C., and
Chan, L. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 8522-8526). We tested the editing activity and dimerization potential
of three different mouse APOBEC-1 mutants using in vitro
editing activity assay and immunoprecipitation in the presence of
epitope-tagged APOBEC-1. One catalytically inactive mutant, mu1
(H61K/C93S/C96S), that retains its capacity to dimerize with wild-type
APOBEC-1 was found to inhibit the editing activity of the latter and
was thus a dominant negative mutant. Two other inactive mutants that
dimerized poorly with APOBEC-1 failed to inhibit its activity.
Intravenous injection of a mu1 adenovirus, Admu1, in C57BL/6J mice
in vivo resulted in liver-specific expression of mu1
mRNA. On days 4 and 9 after virus injection, endogenous hepatic
apoB mRNA editing was 23.3 ± 5.0 and 36.8 ± 5.7%,
respectively, compared with 65.3 ± 11 and 71.3 ± 5.2%,
respectively, for luciferase adenovirus-treated animals. Plasma
apoB-100 accounted for 95 and 93% of total plasma apoB in Admu1
animals on days 4 and 9, respectively, compared with 78 and 72% in
luciferase adenovirus animals. Plasma cholesterol on day 9 was 98 ± 17 mg/dl in the mu1-treated animals, substantially higher than
phosphate-buffered saline-treated (57 ± 9 mg/dl) or luciferase-treated (71 ± 12 mg/dl) controls. Fast protein liquid chromatography analysis of mouse plasma showed that the intermediate density/low density lipoprotein fractions in the animals treated with
the dominant negative mutant adenovirus were much higher than those in
controls. We conclude that active APOBEC-1 functions as a dimer and its
activity is inhibited by a dominant negative mutant. Furthermore, apoB
mRNA editing determines the availability of apoB-100, which in turn
limits the amount of intermediate density/low density lipoprotein that
can be formed in mice. Liver-specific inhibition of apoB mRNA
editing is an important component of any strategy to enhance the value
of mice as a model for human lipoprotein metabolism.
The mouse is a useful animal model for lipoprotein metabolism and
atherosclerosis (1, 2). Its value as a model for human disease,
however, is limited by the fact that there is a substantial difference
in lipoprotein metabolism between the two species. One major difference
is the presence of high levels of apolipoprotein B
(apoB)1 mRNA editing in the liver in
mice but not in humans.
ApoB mRNA editing is a process by which apoB-100 mRNA is
converted to apoB-48 mRNA (3, 4) (reviewed in Ref. 5). It involves
the conversion of the first base of the codon CAA, encoding glutamine
2153 in apoB-100, to UAA, a stop codon, in apoB-48 mRNA. In humans,
editing occurs exclusively in the small intestine but not in the liver.
Therefore, the human liver produces apoB-100 and the small intestine
produces apoB-48. In mice, apoB mRNA editing occurs in both the
small intestine and the liver. Therefore, the amount of apoB-100
produced by the liver is very small, and mice have very low levels of
circulating apoB-100; consequently, they have low levels of
intermediate density lipoprotein (IDL) and low density lipoprotein
(LDL), atherogenic lipoproteins that require apoB-100 as an essential
component.
ApoB mRNA editing is mediated by a multiprotein enzyme complex.
APOBEC-1 is a cytidine deaminase-like protein that has been identified
as a catalytic component of the complex (6-10) that efficiently edits
synthetic apoB mRNA in vitro in the presence of
complementation factors. Lau et al. (10) showed that
APOBEC-1 exists as a spontaneous homodimer. It shows sequence
similarity to Escherichia coli cytidine deaminase, which
also exists as a homodimer (11). In the case of APOBEC-1, Lau et
al. (10) postulated that dimerization may be mediated by
hydrophobic interactions in a leucine-rich domain in the C-terminal
third of the molecule. It is not known, however, if the
active form of APOBEC-1 is in the form of a homodimer.
The crystallographic structure of E. coli cytidine deaminase
suggests that the active enzyme functions as a dimer (11). We reasoned
that active APOBEC-1 might also function as a dimer and enzymatically
inactive APOBEC-1 mutants (e.g. those that have substitutions in the zinc-coordinating residue in the active site (11))
might under appropriate conditions inactivate the wild-type enzyme by
forming an inactive heterodimer with the latter. In contrast, mutants
involving the leucine-rich domain have a high likelihood of having
impaired dimerization potential (6, 10). In this communication, we have
examined the capacity of APOBEC-1 mutants to dimerize with wild-type
APOBEC-1 and correlated this property with their ability to inhibit the
editing activity of the latter. We then made use of the technique of
adenovirus-mediated gene transfer to deliver a dominant negative mutant
APOBEC-1 to the mouse liver in vivo. We found that mice
treated with the dominant negative mutant APOBEC-1 developed
significant hypercholesterolemia because of a marked increase in
IDL/LDL cholesterol. Our observation is consistent with hepatic apoB
mRNA editing being a limiting factor in the production of IDL/LDL
in mice.
Mouse APOBEC-1 mutants (mu1, H61K/C93S/C96S; mu2,
APOBEC-1 1-172 that misses the C-terminal 57 residues containing the
leucine-rich domain; mu3, L182R/L187R) were produced by the polymerase
chain reaction (PCR). In brief, pBluescript II KS (Stratagene)
containing the wild-type mouse APOBEC-1 cDNA (7) was amplified
using the reverse primer (5 RNAs were transcribed from cDNAs
subcloned into pBKCMV and capped with T3 RNA polymerase using the
mMESSAGE mMACHINE kit (Ambion). They were translated in
nuclease-treated rabbit reticulocyte lysate (Promega) in the presence
of [3H]leucine (Amersham Corp.) for 2 h at 30 °C.
Immunoprecipitation was performed as described (10). The
immunoprecipitated products were separated on an SDS-12%
polyacrylamide gel. Gels were fixed, soaked in Amplify (Amersham
Corp.), and dried before they were exposed to x-ray film at The in
vitro editing assay was carried out as described previously (12)
using 8 fmol of synthetic substrate in the presence of chicken
enterocyte S-100 extracts. Primer extension products were fractionated
on a 6% polyacrylamide, 8 M urea gel and quantified by
exposure to a phosphor screen (Molecular Dynamics).
The cDNA for mu1 was
excised from the KS vector by BamHI/ClaI
digestion and subcloned into the BglII/ClaI sites
of pAvCvSv shuttle vector (13). The recombinant adenovirus was prepared by cotransfection of pAvCvSv containing mu1 cDNA and pJM17 (14) into 293 cells (15). Infection, propagation, screening, and large scale
production of high titer recombinant adenovirus were carried out as
described (13, 16). AdLuc (17) contained luciferase cDNA instead of
mu1 cDNA. Recombinant adenovirus stock was diluted with
phosphate-buffered saline (PBS) to the appropriate concentrations, and
0.2 ml of diluted recombinant adenovirus (2 × 109
plaque-forming units; particle/plaque-forming unit ratio ~30) was
injected into the external jugular vein of 3-month-old (~30 g)
C57BL/6J mice that were maintained on laboratory chow (Teklad 4%
mouse/rat diet 7001).
Total
cellular RNA was prepared by using the Ultraspec RNA Isolation System
(Biotecx Laboratory). 20 µg of RNA was electrophoresed on a 1.0%
agarose, 6% formaldehyde gel, transferred to a Hybond-N+ membrane
(Amersham Corp.), and hybridized to a 32P-labeled
0.7-kilobase pair mu1 cDNA probe. The same membrane was then
hybridized to a mouse glyceraldehyde-3-phosphate dehydrogenase cDNA
probe (Ambion). Direct primer extension was carried out as described
(16). A 32P-end-labeled mouse antisense apoB DNA was
annealed overnight at 45 °C with 20 µg of total RNA. The annealed
products were precipitated with ethanol and reconstituted in 10 µl of
first strand synthesis buffer (Life Technologies, Inc.) containing 0.5 mM each dATP, dCTP, dTTP, 0.5 mM ddGTP, 10 mM dithiothreitol, and 20 units of Superscript II reverse
transcriptase (Life Technologies, Inc.). The extension was carried out
for 1 h at 45 °C. The extension products were resolved by 6%
polyacrylamide, 8 M urea gel electrophoresis, and the
radiolabeled products were quantitated by PhosphorImager (Molecular
Dynamics).
Animals were fasted
for 6 h and blood was collected into tubes containing EDTA. Plasma
(0.2 ml) collected from individual mice was fractionated by fast
protein liquid chromatography (FPLC) using two Superose 6 columns
(Pharmacia Biotech, Inc.) connected in series (17). Fifty 0.5-ml
fractions were collected using the eluent 1 mM EDTA, 154 mM NaCl, and 0.02% NaN3 (pH 8.2) (18). Cholesterol and triglyceride contents of each FPLC fraction and of
plasma were determined enzymatically (Sigma kits
352-50 and 336-10). For analysis of plasma apoBs, lipoproteins of
d < 1.21 prepared by ultracentrifugation from plasma
pooled from four individual animals were fractionated on 4-15% SDS
gel and stained by Coomassie Blue. The apoB-100 and apoB-48 bands were
quantified by densitometer measurements (13).
We examined the capacity of various APOBEC-1 mutants to
dimerize with epitope-tagged wild-type APOBEC-1 (10). mu1
(H61K/C93S/C96S) efficiently formed a heterodimer with epitope-tagged
wild-type APOBEC-1 (Fig. 1, lane 4). However,
a mutant that lacks the leucine-rich region (mu2) or one with mutations
in this region (mu3) showed a markedly decreased ability to dimerize
with epitope-tagged wild-type APOBEC-1 (Fig. 1, lanes 6 and
8). These results indicate that the leucine-rich region is
important for dimer formation.
In order to study the effect of heterodimer
formation on apoB mRNA editing activity, individual mutant and
wild-type APOBEC-1s were cotranslated in vitro and the
editing activity of the translation products was determined. By itself,
mu1, in which the 3 zinc-coordinating residues were mutated, displayed
no detectable editing activity in vitro. Increasing the
ratio of mu1 mRNA in the presence of a constant amount of wild-type
APOBEC-1 mRNA produced an APOBEC-1 product that had lost >95% of
its activity in the in vitro editing assay (Fig.
2). Both mu2 and mu3 also had essentially no editing activity by themselves (<5% editing activity compared to that of wild
type). The presence of increasing amounts of mu2 or mu3 translation
products did not affect the editing activity of wild-type APOBEC-1
(Fig. 2). These results suggest that only a mutant that can efficiently
dimerize with the wild-type APOBEC-1 is able to inhibit the editing
activity of the latter. This supports the hypothesis that active
APOBEC-1 functions as a dimer.
Normal C57BL/6J mice were treated
with an intravenous injection of Admu1, an adenoviral vector containing
mu1, or AdLuc, an adenovirus containing luciferase cDNA. Liver and
blood samples were obtained at days 4 and 9 after treatment. The
highest level of mu1 mRNA was detected in the liver on day 4. It
decreased substantially but was still readily detectable on day 9 (Fig.
3A). In contrast, mu1 mRNA was not
detectable in the small intestine either on day 4 or day 9. This agrees
with our previous experience (13, 16) and that of others (reviewed in
Ref. 19) that intravenous administration of adenoviral vectors in mice
in vivo targets the transgene to the liver almost
exclusively. To determine whether the Admu1 effectively inhibited
endogenous apoB mRNA editing, we measured the relative amounts of
apoB-100 and apoB-48 mRNAs by primer extension (Fig. 3B). On day 4 following adenovirus administration, the
hepatic apoB mRNA from Admu1 animals contained 23.3 ± 5.0%
(n = 4) and that from AdLuc animals contained 65.3 ± 11% (n = 4) edited mRNA. On day 9, the
proportions of edited mRNA were 36.8 ± 5.7% for Admu1
animals (n = 3) and 71.3 ± 5.2% for AdLuc
animals (n = 4). The ratio for PBS-treated animals was
69.3 ± 4.3% (n = 4). Therefore, Admu1 but not
AdLuc administration markedly reduced the amount of edited apoB
mRNA in the liver. The amount of edited apoB mRNA in the small
intestine in Admu1-treated animals was 89.5 ± 3.5% (n = 4) and 88.4 ± 2.2% (n = 4)
for days 4 and 9, respectively, compared with AdLuc values of 92.7 ± 2.2% (n = 4) and 94.7 ± 0.48% (n = 4) for these two days; it was 93.8 ± 0.7%
(n = 4) for PBS-injected controls. Thus,
adenovirus-mediated transfer of a dominant negative mutant APOBEC-1
in vivo selectively inhibited apoB mRNA editing in the
liver. Furthermore, this maneuver resulted in a significant increase in
apoB-100 level (15.2 ± 4.0 mg/dl in Admu1, 2.84 ± 0.5 mg/dl
in Adluc, and 3.63 ± 2.1 mg/dl in PBS animals, p < 0.0005, on day 9) in Admu1-treated animals.
The ratio of apoB-100 and
apoB-48 protein was examined in mouse plasma by SDS gel analysis (Fig.
3C). Pooled plasma from four AdLuc-treated mice on days 4 and 9 contained 78 and 72%, respectively, of the total apoB as
apoB-100. The proportion of apoB-100 increased to 95% at day 4 and
remained at 93% at day 9 in Admu1-treated animals.
There were significant differences in plasma lipids among the three
groups following adenovirus treatment. In Admu1 animals, plasma
cholesterol (day 9) and triglyceride (both day 4 and day 9) were almost
double the values in the other two groups (Table I).
Plasma lipids (mean ± S.D.) in adenovirus-treated and
PBS-injected (control) mice
Volume 272, Number 3,
Issue of January 17, 1997
pp. 1456-1460
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.
,
,
,
,
,
Departments of Cell Biology,
Medicine, and § Pediatrics, Baylor College of
Medicine, Houston, Texas 77030-3498 and the § United States
Department of Agriculture/Agricultural Research Service Children's
Nutrition Research Center, Houston, Texas 77030
Site-directed Mutagenesis by Polymerase Chain
Reaction
-GGAAACAGCTATGACCATG-3
), forward primer
(5
-GTAAAACGACGGCCAGT-3
), and specific mutagenesis primers. The
specific mutagenesis oligonucleotides used for PCR are listed below.
The underlined nucleotides represent restriction sites for cloning
purposes. The mutations are in boldface. H61K
(5
-GAAGTTGACTTCAACTTTGTTGCTGGTGTTTTG-3
); C93S/C96S
(5
-GCCCTGGAGCTCTCCCCGCTGGGACTCCAG-3
); L182R/L187R
(5
-CTGTATGTACTGGAGCGCTACTGCATCATTAGAGGACTTCCACCCTGT-3
); mu2 was generated by PCR using forward primer and 3
downstream primer
(5
-CGCGG
TCAATGGGGGTACCTTGGCCAAT-3
);
wild-type APOBEC-1 tagged with a 9-amino acid Haemophilus
influenzae hemagglutinin epitope (HA-1) preceded by a 3-alanine
residue spacer (10) was generated by PCR using forward primer
and 3
downstream primer (5
-CGCGG
TCAAGCGTAATCTGGAACATCGTATGGGTAGGCTGCGGCTTTCAACCCTGTAGCCCAAAGG-3
). After PCR, the products were purified by electrophoresis on 1.5% agarose gels followed by extraction using a QIAquick gel extraction kit
(Qiagen). The purified products were digested with BamHI and EcoRI and subcloned into the
BamHI/EcoRI sites of pBKCMV (Stratagene) or
pBluescript KS. DNA sequences were verified by double-stranded DNA
sequencing.
80 °C.
The relative intensities of the fluorographic images were determined
with a photometric image scanner (BioImage).
Heterodimer Formation between Mutant and Wild-type
APOBEC-1
Fig. 1.
Immunoprecipitation of APOBEC-1 and mutants
cotranslated in vitro. Translation products before and
after immunoprecipitation with anti-HA-1 antibody were analyzed as
described under "Materials and Methods." wt, wild-type
APOBEC-1; wt*, HA-1 epitope-tagged wild-type APOBEC-1;
mu1, (H61K/C93S/C96S) mutant; mu2, APOBEC-1 1-172; mu3, (L182R/L187R) APOBEC-1. In each
lane, the upper band represents the
epitope-tagged APOBEC-1 and the lower band represents the
untagged wild-type or mutant APOBEC-1. Since the antibody is only
against the HA-1 epitope, the coprecipitation of the untagged smaller
APOBEC-1 band indicates that the tagged and untagged proteins existed
as heterodimers (10).
[View Larger Version of this Image (67K GIF file)]
Fig. 2.
Effect of the presence of excess mutant
APOBEC-1s on editing activity of wild-type APOBEC-1. Capped
wild-type APOBEC-1 cRNA and mutant cRNAs were cotranslated in
vitro using a rabbit reticulocyte lysate. Translation products
were analyzed for apoB mRNA editing activity in vitro.
ApoB RNA editing activity of wild-type APOBEC-1 in the absence of
mutant APOBEC-1 was 74 ± 4% (mean ± S.D.,
n = 4) of input RNA in this assay and this activity is
set to 100%. All assays were done at a constant amount of wild-type APOBEC-1 in the presence of increasing amounts of mutant
APOBEC-1s.
[View Larger Version of this Image (17K GIF file)]
Fig. 3.
Admu1 gene transfer. A, northern
blot analysis of liver and intestinal RNA using 32P-labeled
APOBEC-1 cDNA probe on days 4 and 9 of treatment; the asterisk indicates mu1 mRNA. B, primer
extension assay of liver and intestine RNA. The edited (UAA)
and unedited (CAA) products are as marked. C,
pooled day-9 plasma apoBs from PBS-, AdLuc-, or Admu1-treated mice
fractionated on 4-15% SDS gels.
[View Larger Version of this Image (35K GIF file)]
Day 4
Day 9
Control (8)a
Admu1 (15)
AdLuc (14)
Control
(8)
Admu1 (13)
AdLuc (11)
mg/dl
mg/dl
Cholesterol
61 ± 6
80
± 17b,c
59 ± 6
57 ± 9
98
± 17c,d
71 ± 12
Triglyceride
63
± 20
143 ± 30c,d
93 ± 31
60 ± 8
131
± 28d,e
104 ± 25f
a
The number in parentheses indicates the number of
animals.
b
p < 0.005 versus control.
c
p < 0.0005 versus AdLuc.
d
p < 0.0001 versus control.
e
p < 0.05 versus AdLuc.
f
p < 0.005 versus control.
In order to determine which lipoprotein fractions were affected by
Admu1 injection, plasma lipoproteins from day 9 samples were
fractionated by FPLC and their cholesterol content determined (Fig.
4). It is evident that there is no significant
difference in the very low density or high density lipoprotein
fractions between Admu1-treated and the AdLuc- or PBS-treated control
samples. However, compared with controls the IDL/LDL fractions were
markedly elevated in the animals treated with the dominant negative
mutant APOBEC-1 vector. SDS-polyacrylamide gel analysis indicates that the apoB-100 band was substantially higher in the Admu1 compared with
the AdLuc1 samples (data not shown).
The experiments above lead us to the following conclusions. (i) Active APOBEC-1 works as a dimer and can be inhibited by a dominant negative mutant. Here we show that a mutant APOBEC-1 (H61C/C93S/C96S) with its zinc-coordinating residues mutated is totally inactive. This is consistent with previous observations (8, 20, 21) and with the catalytic role of the homologous residues in E. coli cytidine deaminase (11). The other two mutants, mu2 and mu3, which had mutations in the leucine-rich region, were also enzymatically inactive. The loss of catalytic activity in these mutants is probably related to their inability to efficiently form dimers, the active form of the enzyme. The fact that the mutations in these dimerization-incompetent APOBEC-1s involve residues in the leucine-rich domain indicates that this region is important for dimer formation. In any case, only mu1, which is competent in dimerization, acts as a dominant negative mutant when coexpressed with wild-type APOBEC-1 (Fig. 2). Therefore, these experiments support the contention that the active form of APOBEC-1 is a homodimer (10).
(ii) Liver-specific inhibition of APOBEC-1 action leads to elevated IDL/LDL cholesterol. We hypothesized that the low IDL/LDL cholesterol observed in mice compared to humans is partly the result of the diversion of apoB mRNA to the production of predominantly apoB-48, severely limiting the amount of apoB-100, which is essential for the formation of IDL/LDL. Here we showed that hepatic APOBEC-1 action in mice was inhibited by adenovirus-mediated transfer of a dominant negative mutant. As a result of the decrease in apoB mRNA editing, the plasma apoB-100/apoB-48 ratio was greatly increased and the plasma IDL/LDL cholesterol was much higher in these animals than in the luciferase- or PBS-treated controls. We have repeated the adenovirus experiments and consistently observed the IDL/LDL elevation (data not shown). We conclude that the availability of apoB-100 (indirectly determined by apoB mRNA editing efficiency in the liver) limits the amount of IDL/LDL that can be formed in mice. It is interesting that in APOBEC-1 knockout mice that do not edit apoB mRNA either in the liver or small intestine there is little (22) or no change (23, 24) in plasma IDL/LDL. The difference in phenotype between the animals reported in this study and the complete knockout mice may be related to the fact that 1) the liver-specific nature of APOBEC-1 inactivation and the normal editing in the small intestine may in some way contribute to enhanced very low density lipoprotein and subsequently IDL/LDL production, and/or more likely 2) the acute inhibition of APOBEC-1 action by adenovirus-mediated gene transfer does not allow sufficient time for the animals to marshal a compensatory response that may play a role in minimizing the lipoprotein changes in the APOBEC-1 gene knockout animals. In any case, future experiments aimed at "humanizing" the mouse should include the permanent liver-specific inactivation of apoB mRNA editing, which would greatly enhance the value of this animal as a model for human lipoprotein metabolism and atherosclerosis.
This article has been cited by other articles:
![]() |
D. M. Lehmann, C. A. Galloway, M. P. Sowden, and H. C. Smith Metabolic regulation of ApoB mRNA editing is associated with phosphorylation of APOBEC-1 complementation factor Nucleic Acids Res., July 4, 2006; 34(11): 3299 - 3308. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Opi, H. Takeuchi, S. Kao, M. A. Khan, E. Miyagi, R. Goila-Gaur, Y. Iwatani, J. G. Levin, and K. Strebel Monomeric APOBEC3G Is Catalytically Active and Has Antiviral Activity. J. Virol., May 1, 2006; 80(10): 4673 - 4682. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Xie, M. P. Sowden, G. S. C. Dance, A. T. Torelli, H. C. Smith, and J. E. Wedekind The structure of a yeast RNA-editing deaminase provides insight into the fold and function of activation-induced deaminase and APOBEC-1 PNAS, May 25, 2004; 101(21): 8114 - 8119. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Sowden, D. M. Lehmann, X. Lin, C. O. Smith, and H. C. Smith Identification of Novel Alternative Splice Variants of APOBEC-1 Complementation Factor with Different Capacities to Support Apolipoprotein B mRNA Editing J. Biol. Chem., January 2, 2004; 279(1): 197 - 206. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. T. Grey, C. Longo, T. Shukri, V. I. Patel, E. Csizmadia, S. Daniel, M. B. Arvelo, V. Tchipashvili, and C. Ferran Genetic Engineering of a Suboptimal Islet Graft with A20 Preserves {beta} Cell Mass and Function J. Immunol., June 15, 2003; 170(12): 6250 - 6256. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Dickerson, E. Market, E. Besmer, and F. N. Papavasiliou AID Mediates Hypermutation by Deaminating Single Stranded DNA J. Exp. Med., May 19, 2003; 197(10): 1291 - 1296. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Lyons, H. Wittenburg, R. Li, K. A. Walsh, G. A. Churchill, M. C. Carey, and B. Paigen Quantitative trait loci that determine lipoprotein cholesterol levels in DBA/2J and CAST/Ei inbred mice, J. Lipid Res., May 1, 2003; 44(5): 953 - 967. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Hinsdale, P. M. Sullivan, H. Mezdour, and N. Maeda ApoB-48 and apoB-100 differentially influence the expression of type-III hyperlipoproteinemia in APOE*2 mice J. Lipid Res., September 1, 2002; 43(9): 1520 - 1528. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Sowden, N. Ballatori, K. L. d. M. Jensen, L. H. Reed, and H. C. Smith The editosome for cytidine to uridine mRNA editing has a native complexity of 27S: identification of intracellular domains containing active and inactive editing factors J. Cell Sci., January 3, 2002; 115(5): 1027 - 1039. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. S. C. Dance, P. Beemiller, Y. Yang, D. V. Mater, I. S. Mian, and H. C. Smith Identification of the yeast cytidine deaminase CDD1 as an orphan C{->}U RNA editase Nucleic Acids Res., April 15, 2001; 29(8): 1772 - 1780. [Abstract] [Full Text] [PDF] |
||||
![]() |
B.-B. Teng, S. Ochsner, Q. Zhang, K. V. Soman, P. P. Lau, and L. Chan Mutational analysis of apolipoprotein B mRNA editing enzyme (APOBEC1): structure–function relationships of RNA editing and dimerization J. Lipid Res., April 1, 1999; 40(4): 623 - 635. [Abstract] [Full Text] |
||||
![]() |
N. Richardson, N. Navaratnam, and J. Scott Secondary Structure for the Apolipoprotein B mRNA Editing Site. AU-BINDING PROTEINS INTERACT WITH A STEM LOOP J. Biol. Chem., November 27, 1998; 273(48): 31707 - 31717. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yang, Y. Yang, and H. C. Smith Multiple protein domains determine the cell type-specific nuclear distribution of the catalytic subunit required for apolipoprotein B mRNA editing PNAS, November 25, 1997; 94(24): 13075 - 13080. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yang, Y. Yang, K. Kovalski, and H. C. Smith Partial Characterization of the Auxiliary Factors Involved in Apolipoprotein B mRNA Editing through APOBEC-1 Affinity Chromatography J. Biol. Chem., October 31, 1997; 272(44): 27700 - 27706. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yang, M. P. Sowden, and H. C. Smith Induction of Cytidine to Uridine Editing on Cytoplasmic Apolipoprotein B mRNA by Overexpressing APOBEC-1 J. Biol. Chem., July 21, 2000; 275(30): 22663 - 22669. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. N. Papavasiliou and D. G. Schatz The Activation-induced Deaminase Functions in a Postcleavage Step of the Somatic Hypermutation Process J. Exp. Med., May 6, 2002; 195(9): 1193 - 1198. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |