![]()
|
|
||||||||
(Received for publication, September 20, 1996, and in revised form, October 23, 1996)
§,
,
and
From the
Departments of Anatomy and Psychiatry,
Langley Porter Psychiatric Institute, Center for Neurobiology and
Psychiatry, University of California,
San Francisco, California 94143-0984 and the ¶ Department of
Molecular Biology and Genetics, University of Guelph,
Ontario, N1G 2W1 Canada
Galectins are members of a genetically related
family of
-galactoside-binding lectins. At least eight distinct
mammalian galectins have been identified. More distantly related, but
still conserving amino acid residues critical for carbohydrate-binding, are galectins in chicken, eel, frog, nematode, and sponge. Here we
report that galectins are also expressed in a species of fungus, the
inky cap mushroom, Coprinus cinereus. Two dimeric galectins are expressed during fruiting body formation which are 83% identical to each other in amino acid sequence and conserve all key residues shared by members of the galectin family. Unlike most galectins, these
have no N-terminal post-translational modification and no cysteine
residues. We expressed one of these as a recombinant protein and
studied its carbohydrate-binding specificity using a novel
nonradioactive assay. Binding specificity has been well studied for a
number of other galectins, and like many of these, the recombinant
C. cinereus galectin shows particular affinity for blood
group A structures. These results demonstrate not only that the
galectin gene family is evolutionarily much older than previously
realized but also that fine specificity for complex saccharide
structures has been conserved. Such conservation implies that galectins
evolved to perform very basic cellular functions, presumably by
interaction with glycoconjugates bearing complex lactoside
carbohydrates resembling blood group A.
Galectins are animal lectins that are related in amino acid
sequence and specifically bind to
-galactoside carbohydrates such as
lactose (1). Members of this gene family all include a conserved
carbohydrate-binding domain but vary in inclusion of other domains and
in tissue expression patterns. More distantly related, but conserving
critical amino acid residues involved in carbohydrate-binding, are
galectins in chicken, eel, frog, nematode, and sponge (2).
Although galectins have been studied for 20 years now, physiological functions for these proteins have not yet been clearly established. Their affinity for oligosaccharides found on glycoconjugates on cell surfaces or in extracellular matrix has suggested that galectins function extracellularly by binding to such ligands. Indeed, certain galectins have particular affinity for specific glycoprotein ligands, such as polylactosamine chains on laminin (1, 3). When added to cells or overexpressed after transfection, galectins can have major effects on cell adhesion, proliferation, apoptosis, metastasis, and immune function (1-6). However, evidence has also been presented for intracellular functions of galectins, for instance in message splicing (7) or as nuclear proteins (8). Therefore, efforts are being directed at exploring the evolutionary origin of galectins in the hope that their functions will be easier to define in simple model organisms.
Here we report that a species of fungus, the inky cap mushroom, Coprinus cinereus, expresses two lectins related in sequence and carbohydrate-binding specificity to other galectins. This discovery means that the galectin gene family is even older than previously realized and must have evolved at least a billion years ago. Like many other galectins, recombinant C. cinereus galectin shows particular affinity for blood group A structures, suggesting that fine specificity for complex saccharide structures has also been conserved. Such conservation implies that galectins evolved to perform very basic cellular functions, presumably by interaction with glycoconjugates bearing complex lactoside carbohydrates resembling blood group A.
Fruiting stage C. cinereus proteins were first extracted and partially purified
using ammonium sulfate precipitation and ion exchange chromatography,
as described previously (9). Lactose-binding proteins were then
isolated by affinity chromatography from approximately 0.5 mg of
protein in 1 ml of 50 mM Tris-HCl (pH 7.2), 150 mM NaCl (TBS) plus 10 mM mercaptoethanol. This
partially purified fruiting body extract was passed through a 1-ml (bed
volume) column of lactosyl-Sepharose, prepared as described previously
(10). The column was washed with 10 ml of TBS, 10 mM
mercaptoethanol, and eluted with another 5 ml by inclusion of 0.1 M lactose, while collecting 1-ml fractions. Protein
concentrations were determined using a bicinchoninic acid protein assay
(BCA Protein Assay, Pierce). Fractions were then analyzed by
SDS-PAGE1 (17% gel) and silver staining.
Protein molecular weights were estimated by comparison with protein
standards (SDS-PAGE Molecular Weight Standards
Low Range,
Bio-Rad). It was subsequently found that the reducing agent,
mercaptoethanol, was not required for purification of the
lactosebinding proteins.
Endonuclease activity was measured basically as described previously (9) by incubating 23 µl of serially diluted (in 100 mM Tris-Cl (pH 7.4), 10 mM MgCl2) test fractions with 2 µl (0.5 µg) of supercoiled plasmid DNA for 30 min at 37 °C and then monitoring any DNA nicking by migration in a 1% agarose gel, stained with ethidium bromide.
cDNA SequencingDNA was purified from overnight
cultures of additional phage clones isolated during the original
antibody screen of a C. cinereus
gt11 cDNA library
(11), and the insert cDNA was removed by restriction digestion and
subcloned into pGEM4Z plasmids (Promega Corp., Madison, WI). Both
strands of the cDNA were then fully sequenced by standard
techniques using Sequenase (U.S. Biochemical Corp.), T7 and T3
oligonucleotide primers flanking the cloning site, some
sequence-determined internal primers, and incorporation of
-35S-dCTP and dideoxynucleotides for chain termination
according to protocols suggested by the enzyme manufacturer.
Restriction digests, electrophoresis, ligation, bacterial
transformation, and other basic molecular genetic manipulations all
followed standard methods.
Partial amino acid sequences were determined by established protocols (12) from the N terminus of proteins separated by SDS-PAGE and electroblotted onto a polyvinylidene difluoride membrane. The membrane with the blotted proteins was stained with Coomassie Blue R-250, and individual bands were excised and analyzed by Edman degradation at the Core Facility for Protein/DNA Chemistry at Queen's University, Kingston, Ontario, Canada.
Production and Purification of Recombinant GalectinTo
produce recombinant lectin in Escherichia coli, an
NdeI site was engineered at the translation start site in
the C. cinereus galectin-II clone in pGEM4Z by PCR between a
mutagenic primer (5
CCAGTCTAACATATGCTCTACCACC 3
) and a primer for the
T7 promoter in pGEM4Z. The PCR product was ligated into the
HphI site of pCR1000 (Stratagene, La Jolla, CA) and
transformed into E. coli INV
F (Stratagene). This plasmid
was then purified, digested with NdeI and BamHI,
and ligated into NdeI and BamHI digested pET-11
(Novagen Inc., Madison, WI). Cultures of E. coli strain
BL21(DE3) transformed with this plasmid were induced with 0.1 M isopropyl-
-thiodigalactoside and lysed by sonication,
and the recombinant lectin was purified by affinity chromatography on
lactosyl-Sepharose, all as described previously (13).
To estimate approximate native molecular masses, proteins were analyzed by gel filtration chromatography using a Superdex 75 HR 10/30 molecular sieve column (bed volume approximately 24 ml) (Pharmacia Biotech Inc.) and a Perkin-Elmer Series 4 HPLC system with detection at 214 nm. Approximately 10 µg of purified recombinant protein or 0.5 mg of the partially purified fruiting body extract at 100 µg/ml in TBS, 4 mM mercaptoethanol, 0.1 M lactose was injected into the HPLC, equilibrated in the same buffer, and chromatographed at a flow rate of 0.5 ml/min. In some cases, the eluent was collected in 0.33-ml fractions for SDS-PAGE analysis. Approximate molecular masses of the test proteins were calculated by comparison with molecular weight standards (Sigma) and recombinant rat galectin-1 and human galectin-3 (13).
Electrospray Ionization Mass Spectrometry (ESI-MS)Mass spectrometry was used to determine precise subunit molecular masses for the native galectins purified by lactose-affinity chromatography from fruiting body extracts. ESI-MS analysis was performed by the Biological Mass Spectrometry Laboratory, Department of Chemistry, University of Waterloo, Ontario. Prior to analysis the purified lectins were extensively dialyzed against 2 mM ammonium acetate (pH 7.0). 400 pmol of the protein was introduced into the ion source at a cone voltage of 22 V. The molecular mass spectrum was reconstructed from multiply charged ions in the m/z (mass to charge ratio) spectrum.
Novel Carbohydrate-binding AssayCarbohydrate-binding specificity of recombinant lectin was determined using a novel assay and a panel of standard oligosaccharides (as numbered in Table I, numbers 3 and 18 kindly donated by Hakon Leffler, UCSF, numbers 8, 10, 11, and 20 from Oxford GlycoSystems, numbers 9 and 19 from Accurate Chemical and Scientific Corp., and the rest from Sigma). In brief, each saccharide was tested for inhibition of the binding of biotin-labeled asialofetuin (biotin-ASF) to lectin-Sepharose beads, detected by subsequent binding of streptavidin-peroxidase, and colorimetric quantification of bound peroxidase activity using soluble tetramethylbenzidine substrate.
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Purified recombinant C. cinereus galectin-II or rat galectin-1 were first conjugated to Sepharose by standard techniques (14). In brief, each protein was dialyzed into 75 mM NaCl, 75 mM Na2HPO4/KH2PO4 (pH 7.2) (PBS). The pH was raised by addition of (null)/1;5 volume of 0.5 M NaHCO3 (pH 8.3), 1 M NaCl, 5 mM EDTA, and lactose was added to 0.1 M. Then 15 ml of this solution at approximately 1 mg/ml galectin was added to 15 ml (packed volume) of cyanogen bromide-activated Sepharose 4B beads (Pharmacia Biotech Inc.), which had been hydrated and washed with dilute HCl according to the manufacturer's instructions. Coupling was allowed to proceed overnight at 4 °C with gentle rocking to keep the beads suspended. The beads were then pelleted by centrifugation; the supernatant was aspirated to waste, and unreacted sites were blocked by resuspension and incubation for 2 h at 4 °C in 20 ml of 0.2 M ethanolamine in the above coupling buffer. The beads were then washed three times with 20 ml of TBS and stored at 4 °C.
Fetuin (Sigma) was desialylated by mild acid hydrolysis (15), dialyzed against PBS, and biotinylated by addition of 0.5 ml at 20 mg/ml to an equal volume of 0.2 M NaCO3 (pH 8.8), and addition of 300 µl of 12 mg/ml N-hydroxysuccinimide-biotin (Calbiochem) in dimethylformamide. After reaction in the dark for 1 h at room temperature, the reaction was quenched by addition of 100 µl of 1 M NH4Cl. The solution was then dialyzed twice against 1 liter of TBS and stored in frozen aliquots.
A competitive binding assay was developed in which 5 µl of 50 µg/ml biotin-ASF was added to 35 µl of 1:7 suspension of lectin-Sepharose beads in TBS, 1% bovine serum albumin (Sigma, RIA grade), 0.2% Triton X-100, and 10 µl of a given test saccharide. After incubating overnight at 4 °C with gentle rocking to maintain suspension, the beads with any bound biotin-ASF were pelleted by microcentrifuge, washed three times with 0.5 ml of the above buffer, and then incubated rocking for 1 h at 4 °C in 0.5 ml of a 1:500 dilution of streptavidin biotinylated horseradish peroxidase complex (RPN 1051, Amersham Life Sciences Inc.) in the same buffer. Again, the beads carrying any streptavidin-peroxidase bound to biotin-ASF were pelleted and washed three times. The beads were then resuspended by vortexing in 100 µl of H2O, and 25 µl of suspension was placed in a microtiter plate well. 100 µl of tetramethylbenzidine reagent (TMB-Soluble, Intergen) was then added to each well, and the absorption at 620 nm of each well was recorded every minute for 30 min with mechanical agitation before each reading. From these readings the reaction velocity while in the linear range, reflecting the amount of bound peroxidase, was determined using Kineticalc software (Bio-Tek Instruments, Inc., Winooski, VT). Values obtained in the presence of saccharide (averaged for triplicate experiments) were then calculated as a fraction (F) of that obtained in the absence of any inhibitor and plotted against the saccharide concentration (C) using Sigmaplot software (Jandel Scientific Software, San Rafael, CA). The approximate Ki for each saccharide, which should be approximately the concentration giving 50% inhibition of biotin-ASF binding to the lectin beads, was calculated by fitting the data to a simple competitive binding function for a trace ligand (F = 1/(1 + C/Ki)).
A
candidate galectin in C. cinereus was initially identified
by using the "Findpatterns" program (GCG Sequence Analysis Software Package, version 8, Genetics Computer Group, Inc., Madison, WI) to
screen GenBank (National Center for Biotechnology Information, National
Library of Medicine) for sequences which include a motif chosen as
conserved in the carbohydrate-binding site of all known galectins (L,
I, V, F)(L, I, V, F)XN(S, T)(5X-7X)(W,
Y)XXEX(R, K, H). A partial cDNA encoding such
a motif (GenBank Accession No. L03301[GenBank]) had been cloned from a
basidiomycete fungus, C. cinereus, by screening an
gt11
library with an antibody raised to a partially purified endonuclease
(11). Although the cDNA was presumed to encode an endonuclease,
this had not been directly demonstrated.
Lactose affinity chromatography
was used to test for the presence of galectins in a partially purified
endonuclease preparation. Fruiting body extract was first treated by
ammonium sulfate precipitation and ion exchange chromatography, as
described previously (9). Analysis by SDS-PAGE and silver staining of
this preparation revealed three bands, one with an apparent molecular
mass of 17 kDa and a barely resolved doublet at approximately 15.5 kDa
(Fig. 1, lane 2). When passed over a
lactosyl-Sepharose affinity matrix, all endonuclease activity flowed
through the column, as did the lower band in the 15.5-kDa doublet (Fig.
1, lane 3), whereas the upper band of the doublet and the
band at 17 kDa were almost completely retained and specifically eluted
with lactose (Fig. 1, lanes 4-8). This indicates that the
retained proteins possess lactose-binding activity. The endonuclease
activity might be due to the lower band of the 15.5-kDa doublet or to
some other minor component of the preparation. Regardless, all
endonuclease activity is clearly separable from lactose-binding
activity. Therefore, given its sequence similarity to galectins, the
above cDNA sequence seemed quite likely to encode at least one of
the lactose-binding proteins at 15.5 and 17 kDa and not an
endonuclease.
Isolation of cDNAs for Two Closely Related C. cinereus Galectins
To confirm that the above C. cinereus
cDNA encodes at least one of the lactose-binding bands identified
here, we searched for a corresponding full coding length cDNA in
order to produce and test the recombinant protein for lectin activity.
Sequencing of additional clones isolated during the original antibody
screen of a C. cinereus
gt11 library (11) yielded an
apparently full coding length cDNA (Coprinus
galectin-II, GenBank Accession No. U64676[GenBank]) 635 base pairs in length
with a sequence closely related to the original cDNA. We also
discovered that a portion of the original cDNA (Coprinus
galectin-I) had been overlooked due to an internal EcoRI
restriction site. The full 509-base pair length of this cDNA
(corrected GenBank Accession No. L03301[GenBank]) was subcloned by PCR
amplification from the phage vector using primers flanking the
gt11
EcoRI sites.
These two cDNAs are very closely related, sharing 84% identity in
nucleic acid sequence and 83% identity in deduced amino acid sequence
(Fig. 2), and both cDNAs share extensive amino acid sequence similarity with other members of the galectin family (Fig.
3) (16-37), including all critical amino acid residues
found by crystallography to be directly involved in carbohydrate
binding (marked with an asterisk in Fig. 3) (38-40). Of the
26-amino acid residue differences between the two Coprinus
lectins (nonidentical amino acid residues are marked at bottom of Fig.
3), 8 are clearly conservative substitutions, and only 3 nonconservative substitutions occur at positions generally conserved in
other galectins. While certain galectins, such as mammalian galectin-1
(41, 42), include cysteine residues that must remain reduced for the
protein to retain carbohydrate-binding activity, neither of the deduced Coprinus galectin sequences includes any cysteine residues,
and we found that these lectins remain active in the absence of
reducing agents. Molecular masses calculated from the deduced amino
acid sequences of the cDNAs are 16,408 and 16,671 for
Coprinus galectin-I (Cgl-I) and galectin-II (Cgl-II),
respectively.
Based on N-terminal peptide sequence obtained from the SDS-PAGE bands described above, the two cDNAs correspond to the two lactose-binding proteins at 15.5 and 17 kDa. The peptide sequence MLYHLFVNNQVKLQNDFKPE from the band migrating at approximately 17 kDa exactly matches the predicted N-terminal sequence of the Cgl-II cDNA. The peptide sequence MLYRLFVNNQIK?QDDFKAE from the band migrating at approximately 15.5-kDa protein matches the predicted N-terminal sequence of the Cgl-I cDNA with the exception of histidine encoded by the cDNA as the fourth residue, instead of the arginine indicated by amino acid sequencing.
Biochemical Characterization of Recombinant Coprinus Galectin-IIBecause N-terminal sequence matching the cDNA was
obtained for both proteins by Edman degradation, it appeared that
neither protein has a modified N terminus, retaining their initial
methionines. This was confirmed by mass spectrometry of the
Coprinus lectins purified by lactose-affinity chromatography
from fruiting body extracts. ESI-MS revealed two major peaks with
apparent masses of 16,408 (±1.2 Da) and 16,672 (±1.2 Da) (Fig.
4), corresponding exactly to the masses predicted from
the cDNA sequences for Cgl-I and Cgl-II, respectively. Also
apparent are minor peaks 96 Da larger than each of the major peaks and
even smaller peaks 96 Da larger than those, but these appear to be
ionization artifacts, because their presence and size varied depending
on buffer conditions. These results confirm the deduced protein
sequences and demonstrate that neither protein is post-translationally
modified in any way.
To confirm the lectin activity indicated by similarity to galectins,
the coding sequence for Cgl-II was subcloned into a prokaryotic expression vector and recombinant protein was produced in E. coli. This protein was purified from the lysed bacteria by
affinity chromatography using a lactosyl-Sepharose column and elution
with lactose, confirming its lectin activity. SDS-PAGE revealed a
single band in the purified recombinant protein matching in size the 17-kDa band in the partially purified extract (Fig. 1, lane
1). The purified recombinant lectin had no detectable endonuclease activity even at 2.0 mg/ml (Fig. 5, lane 6),
whereas plasmid degrading activity was easily detectable in the
partially purified fruiting body extract at 25 µg/ml (Fig. 5,
lane 3).
Recombinant Cgl-II elutes as two distinct peaks on HPLC gel filtration
chromatography under nondenaturing conditions (Fig. 6A, profile A), and based on
comparison to molecular mass standards these peaks appear to represent
a dimer (about (null)/2;3 of the total) with an approximate size of
41.5 kDa and a monomer (about (null)/1;3 of the total) with an
approximate size of 18.5 kDa (Fig. 6B). To ask whether Cgl-I
also dimerizes, fungal proteins in the partially purified fruiting body
extract were analyzed. These proteins elute with a more complex profile
(Fig. 6A, profile B), but major peaks appear at
the same positions as for recombinant Cgl-II. SDS-PAGE of fractions
from the apparent dimer peak of the partially purified extract (Fig.
6C, lane 4) revealed bands matching in size both Cgl-I (the
upper band of the 15.5-kDa doublet bands) and Cgl-II (the 17-kDa band).
These bands plus the lower band of the 15.5-kDa doublet appeared in the
apparent monomer fractions (Fig. 6C, lane 8-11).
Whether the lectins can also form heterodimers or only homodimers can
not be determined from these data.
Characterization of Coprinus Galectin-II Carbohydrate-binding Specificity Using a Novel Assay
To compare the
carbohydrate-binding specificity of Coprinus galectin with
other galectins, a novel assay was designed based on saccharide
inhibition of biotinylated asialofetuin binding to galectin protein
immobilized on Sepharose beads. The advantage of this assay is that it
is nonradioactive, whereas characterization of specificity for most
other galectins has been based on saccharide inhibition of the binding
of radioiodinated lectin to immobilized saccharide, such as
lactosyl-Sepharose. To be sure that results from this assay are
comparable with results reported for other assays, well characterized
rat galectin-1 was tested simultaneously. For each saccharide tested,
inhibition curves were plotted using a log scale for the saccharide
concentration (as shown for lactose in Fig. 7). All
curves for Cgl-II and rat galectin-1 were parallel, apparently
reflecting simple noncooperative binding in each case. Based on these
curves, the approximate Ki or the concentration giving 50% inhibition of biotin-ASF binding to the lectin beads was
calculated for each saccharide. Results are shown in Table I for recombinant Cgl-II and rat galectin-1 in
comparison with published results for inhibition of rat galectin-1 (43)
binding to lactosyl-Sepharose. Clearly, the novel assay developed here, in which soluble labeled ligand binds to immobilized lectin, yields values for rat galectin-1 specificity remarkably close to values obtained from an assay in which soluble labeled lectin binds to immobilized ligand. This novel nonradioactive assay should be more
practical, given the greater stability of its components.
The carbohydrate-binding specificity of recombinant Cgl-II is very
similar to the specificities reported for other galectins (1). As with
all other galectins, only galactoside, and especially lactoside, sugars
competed for the lectin binding site. Also as with all other galectins,
binding seems to require a free hydroxyl at the glucose 3 carbon of
lactose (Gal
1-4Glc), whereas binding seems only moderately affected
by substitution at the galactose 2
- or 3
-hydroxyl. Thus, substitution
of lactose with fucose at position 3 (Table I, number 20) greatly
reduces inhibitory potency, whereas substitution with fucose at
position 2
(Table I, number 8) somewhat increases inhibitory potency
compared with lactose (Table I, number 4). As for most galectins,
N-acetyllactosamine (Table I, number 5) is a significantly
more potent inhibitor than lactose. Like many other galectins, Cgl-II
shows particular affinity for lactose substituted with GalNAc at the 3
position on galactose (Table I, number 9). Blood group A
tetrasaccharide (GalNAc
1-3[Fuc
1-2]Gal
1-4Glc), which has
this structure, was the most potent competitive inhibitor tested
(apparent Ki = 0.09 mM).
Identification of galectin expression in a fungus, C. cinereus, extends the known antiquity of this gene family. The Coprinus isolectins are the first galectins identified outside the animal kingdom, which diverged from the fungi approximately 1 billion years ago (44, 45). Such evolutionary conservation implies that galectins evolved to perform very basic biological functions. Physiological processes are considerably more limited in mushrooms than in most other species in which galectins have been studied, restricting the possible functions played by galectins as they originally evolved. Furthermore, because fungi (and sponges) diverged from the main phylogenetic tree before insects and animals diverged, it seems likely that galectins are also expressed in Drosophila and that, if these could be identified, the experimental advantages of that organism could be brought to bear on the question of galectin function.
Carbohydrate-binding specificity was only studied for one of the two Coprinus galectins, Cgl-II. Because they are so similar in amino acid sequence (83% identity), it seems unlikely that there are major differences in binding specificity between Cgl-I and Cgl-II. However, it is clear that these are not just alleles of each other, because preliminary studies have revealed tandem arrangement of the two corresponding genes.2 One possibility is that gene duplication has served to facilitate high level expression.
Some aspects of Coprinus galectin binding specificity can be
interpreted from the crystal structures determined for mammalian galectin-1 (38, 39) and galectin-2 (40) complexed with saccharide. Those crystals reveal a carbohydrate-binding site composed of four
adjacent
strands (amino acids 31-83 of mammalian galectin-1), and
all of the galectins, including both Coprinus galectins,
conserve certain critical amino acid residues which directly interact
with lactose, His-44 (except in the 32-kDa nematode galectin), Arg-48, Val-59 (except in the 32-kDa nematode galectin C-terminal domain), Asn-61, Trp-68, and Glu-71 (amino acid residues numbered by position in
mammalian galectin-1 as shown in Fig. 3). In the crystallized galectins, Asn-46 also contributes to lactose binding through water-mediated interaction with the 3-OH of lactose. However, this
residue is not conserved in the Coprinus galectins, electric eel galectin (30), or in the N-terminal carbohydrate-binding domain of
the 32-kDa nematode galectins (36). Most galectins, including the
Coprinus galectins, also share amino acid residue Arg-73,
which interacts through a water molecule with the N-acetyl group of GlcNAc and is at least partially responsible for preferential binding to Gal
1-4GlcNAc. Arg-73 has also been suggested to restrict the equatorial 3-OH of GlcNAc and thereby block binding of
Gal
1-3GalNAc (46). Many galectins show enhanced binding to larger
oligosaccharides, but the amino acid residues responsible have not yet
been clearly established.
In general, the Ki values measured for Cgl-II are higher than those reported for other galectins. Ki is a measure of the competitive potency of a test saccharide for competitive inhibition of lectin binding to a standard ligand (asialofetuin in this case). However, these values are not necessarily directly comparable across studies, because they can be assay-dependent. Ki values depend partly on the lectin's affinity for the given standard ligand (unless the standard ligand concentration is much smaller than its dissociation constant), but values reported for various galectins have derived from assays using different standard ligands (in some cases with very different valencies). Even as measured here in the same assay, the fact that the Ki values for Cgl-II are higher than those for rat galectin-1 could mean that Cgl-II has a higher affinity than rat galectin-1 for asialofetuin or that Cgl-II has lower affinity than rat galectin-1 for the tested saccharides. What should be comparable across different assays (assuming similar interaction valency) is the relative potency of test saccharides compared with a standard, such as lactose. Analyzed in this way, the 30-fold lower Ki measured for blood group A tetrasaccharide compared with lactose for inhibition of Cgl-II is similar to the 25-fold difference found for rat galectin-3.
Preferential binding to blood group A structures has now been observed
for a number of galectins, including mammalian galectins
3 (43, 47),
4 (24), and
5 (43) and a sponge galectin (48). The observation that
blood group A tetrasaccharide is also the best of the tested
competitors for the Cgl-II binding site marks such fine specificity as
an evolutionarily old characteristic of galectins and suggests that it
might be functionally important. At least some fungi incorporate GalNAc
into glycoproteins and polysaccharides (49), but there has not yet been
enough structural characterization of fungal glycoconjugates to use
this information to identify any candidate ligands. It is also possible
that relevant ligands are not fungal, but perhaps animal, insect, or
nematode glycoconjugates mediating, for instance, spore adhesion to
those organisms (50).
While evidence has been presented for both intra- and extracytoplasmic functions of galectins, the complex carbohydrate structures preferred by galectins are extracytoplasmic, and in many cases galectins have been shown to be secreted and accumulated extracellularly (1, 2). However, none of the galectins yet described, including the Coprinus galectins, include a secretion signal sequence. Nevertheless, mammalian galectin-1 and galectin-3 have been shown to be exported from mammalian cells by nonclassical mechanisms (51-56), and galectin-1 can even be exported when expressed as a recombinant protein in Saccharomyces cerevesiae (57). Thus, it is likely that the Coprinus galectins, too, are secreted proteins.
The Coprinus galectins share a number of additional characteristics with other galectin family members. Like most other galectins, the Coprinus galectins form non-disulfide bonded dimers and are thus functionally divalent with the potential to cross-link glycoconjugates on cell surfaces or in extracellular matrix. Like many other galectins, the Coprinus galectins are expressed at very high levels (11), a characteristic of proteins with more structural roles, as opposed to catalytic or signaling roles. Also like many other galectins, the Coprinus galectins show marked developmental regulation, in this case during fruiting body formation (11). These characteristics reinforce previous suggestions that galectin functions may be particularly important in regulating developmental changes in cell-cell or cell-matrix interactions.
Unlike other galectins, the Coprinus galectins have unmodified N termini. It is not clear why the mobilities of Cgl-I and Cgl-II diverge on SDS-PAGE, because the molecular masses, as predicted from deduced sequence and confirmed by mass spectrometry, are very close, 16,408 and 16,671, respectively. Therefore, these proteins have no post-translational modifications. In contrast, all other galectins for which this has been studied have acetylated N termini (after cleavage of the initiator methionine in most cases) (2). Mammalian galectin-3 also undergoes regulated phosphorylation (58).
At one time galectins were referred to as S-type lectins (59), because they were thought to require reduced thiols to retain carbohydrate-binding activity. While this is true for some galectins, such as mammalian galectin-1 (41, 42), it is not true for many other galectins. The Coprinus galectins fall into the latter category, and like a galectin in nematodes (36) and one in electric eel (30), Cgl-I and Cgl-II have no cysteine residues and retain carbohydrate-binding activity in the absence of reducing conditions. If, as has been proposed (41), oxidative inactivation serves to limit the extracellular lifespan of some galectins, this is not the case for the Coprinus galectins.
Small, saline-soluble lectins have been found in many other fungus
species (50, 60), and almost all are developmentally regulated with
high expression in fruiting bodies and little or no expression in
vegetative mycelia. Most show binding specificity for GalNAc,
Gal
1-3GalNAc, or asialomucin. Some of these could be galectins,
such as the
-galactosyl-specific lectin isolated from fruiting
bodies of another basidiomycete mushroom, Ischnoderma resinosus (61). However, the few fungal lectins that have been sequenced are clearly not members of the galectin family. For instance,
the galactosamine-binding lectins from the nematode-trapping fungus
Arthrobotrys oligospora and the common edible mushroom Agaricus bisporus are related to each other in sequence and
form a novel lectin gene family (62, 63), whereas the fucose-binding lectin from the mushroom Aleuria aurantia has an unrelated
sequence (64).
It is notable that galactoside-binding lectins are also specifically expressed during fruiting body formation in other organisms, such as the cellular slime mold, Dictyostelium discoideum (65), and the bacterium, Myxococcus xanthus (66). These lectins are clearly unrelated in sequence to the galectins but like the galectins have been shown to accumulate extracellularly despite the lack of classical secretion signal sequences (67, 68). The fact that in each of these organisms small, soluble galactoside-binding lectins are synthesized at high levels at a time when the organisms are starving and that such lectins seem to have evolved independently several times might indicate that galactoside-binding lectins play some important role in fruiting. Indeed, suppression of lectin expression in D. discoideum (69) or in M. xanthus (70) resulted in impaired fruiting body formation, apparently due to a defect in the cells' ability to migrate into an aggregate, the initial step in fruiting body formation for these species. Fruiting in basidiomycetes, including C. cinereus, involves a similar aggregation of cells (from the vegetative mycelium) to form a more complex tissue, the mushroom. However, this is believed to involve only changes in cell adhesion and elongation, not cell migration (71). We hope to better define the function of the C. cinereus galectins by using homologous recombination to eliminate expression of both C. cinereus galectin genes.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) U64676[GenBank] and L03301[GenBank].
This article has been cited by other articles:
![]() |
S. Itonori, S. Yamawaki, K. Aoki, K. Yamamoto, N. Hada, T. Takeda, J. T. Dulaney, and M. Sugita Structural characterization of glycosylinositolphospholipids with a blood group type B sugar unit from the edible mushroom, Hypsizygus marmoreus Glycobiology, July 1, 2008; 18(7): 540 - 548. [Abstract] [Full Text] [PDF] |
||||