JBC Transcription and Nuclear Factor Monoclonals

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Huang, C.
Right arrow Articles by Zhan, X.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huang, C.
Right arrow Articles by Zhan, X.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 31, Issue of August 1, 1997 pp. 19248-19252
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Proteolysis of Platelet Cortactin by Calpain*

(Received for publication, March 4, 1997, and in revised form, May 5, 1997)

Cai Huang Dagger , Narendra N. Tandon §, Nicholas J. Greco §, Yansong Ni Dagger , Tony Wang and Xi Zhan Dagger **

From the Dagger  Department of Experimental Pathology and the § Department of Platelet Biology, The Holland Laboratory, American Red Cross, Rockville, MD 20855, the  Division of Biology, Glaxo and Wellcome Research Institute, Research Triangle Park, North Carolina 27709, and the  Department of Anatomy and Cell Biology, George Washington University, Washington, D. C. 20037

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES


ABSTRACT

Cortactin, a substrate of pp60c-src and a potent filamentous actin binding and cross-linking protein, is abundant in circulating platelets. After stimulation of platelet aggregation with collagen, cortactin undergoes a dramatic increase in tyrosine phosphorylation followed by a rapid degradation. The cleavage of platelet cortactin was detected in lysates prepared using either Triton-containing buffer or SDS-sample buffer. However, the degradation of cortactin was not observed in platelets derived from a Glanzmann's patient, who lacked functional integrin alpha IIbbeta 3 (GPIIb-IIIa). In addition, the proteolysis of cortactin was abolished by treating platelets before but not after collagen stimulation with EGTA or calpeptin. Furthermore, recombinant cortactin was digested by µ-calpain in vitro in a dose-dependent manner, indicating that cortactin is a substrate for calpain. We also observed that the calpain-mediated digestion in vitro is dependent on the presence of a sequence containing a proline-rich region and multiple tyrosine residues that are phosphorylated by pp60c-src. Tyrosine phosphorylation by pp60c-src up-regulates the activity of calpain toward cortactin. Our data suggest that the calpain-mediated proteolysis of tyrosine-phosphorylated cortactin may provide a mechanism to remodel irreversibly the cytoskeleton in response to platelet agonists.


INTRODUCTION

Cortactin, an F-actin1 binding and cross-linking protein (1, 12), is a major target for tyrosine phosphorylation in response to signaling mediated by fibroblast growth factor (2), epidermal growth factor (3), integrin activation (4), bacteria-mediated phagocytosis (5), and v-src oncogene (6). Overexpression or amplification of the human cortactin gene (also called EMS1) is often associated with human malignancies (7, 8). In v-Src-transformed cells, cortactin has been found to co-localize with Src oncoproteins within podosomes, membrane-substratum contact structures (6). Analysis of cortactin phosphorylation in cells lacking the c-src gene (9) or following overexpression of c-Csk (10), a negative regulator for pp60c-src, has provided further compelling evidence that cortactin is an intrinsic substrate for pp60c-src.

The protein sequence of cortactin is unique because it contains six and one-half 37-amino acid tandem repeats near the NH2 terminus, and a Src homology 3 (SH3) domain at the carboxyl-terminal end. Between the repeat and the SH3 domain is an alpha -helix, a proline-rich region, and multiple tyrosine residues. The amino acid sequence of human cortactin within the repeat domain shares nearly 100% identity with the chicken and murine homologues and 70% with HS1, a cortactin-related gene product (11), indicating that the repeat domain plays a fundamental role for cortactin (12). Indeed, the repeat domain has been demonstrated as the binding site for F-actin (12). In contrast, the sequence between the alpha -helix and the SH3 domain exhibits less than 33% identity to HS1, but the function of this region has not yet been identified.

We recently reported that there is abundant expression of cortactin in megakaryocytes and platelets (13). While tyrosine phosphorylation of cortactin has been described as a major phenomenon in thrombin-stimulated platelets (14, 15), the significance of the tyrosine phosphorylation is unknown. In the present study, we examined the fate of cortactin in platelets stimulated by collagen. We found that cortactin is degraded following tyrosine phosphorylation and that the protease responsible for the cortactin degradation is a calpain-related enzyme, which requires integrin alpha IIbbeta 3. Furthermore, we provide in vitro evidence that the sequence containing the proline-rich region and multiple tyrosine residues targeted by pp60c-src is required for the calpain-mediated cleavage. Finally, we demonstrated that tyrosine phosphorylation of cortactin by pp60c-src dramatically alters its susceptibility to calpain. These data suggest that tyrosine phosphorylation may play a role in the calpain-mediated proteolysis of cortactin.


EXPERIMENTAL PROCEDURES

Antibodies and Chemical Reagents

Monoclonal antibody (mAb) 4F11 was purchased from Upstate Biotechnology, Inc. (Lake Placid, NY). Monoclonal antibody against phosphotyrosine (RC20) was from Transduction Laboratories (Lexington, KY). The polyclonal antibody against the C-terminal part of murine cortactin was derived from mice immunized with a recombinant protein corresponding to amino acids 323-546. Prostaglandin E1, phenylmethylsulfonyl fluoride, Triton X-100, EGTA, benzamidine, leupeptin, and aprotinin were from Sigma. SDS-PAGE markers were from Bio-Rad. Protein A-Sepharose was from Pharmacia Biotech Inc. Purified µ-calpain derived from pig erythrocytes was obtained from ICN (Costa Mesa, CA). Calpeptin was from Biomol (Plymouth Meeting, PA). Sodium orthovanadate was from Fisher. Type I tendon collagen was from Chrono-Log Co. (Havertown, PA).

Isolation of Human Platelets

Human blood (500 ml) from healthy volunteers was collected into 70 ml of CPD solution, containing 1.84 mg of sodium citrate, 1.78 mg of dextrose, 209 mg of citric acid, and 155 mg of monobasic sodium phosphate. Platelet-rich plasma was obtained by centrifugation at 200 × g for 16 min at ambient temperature. Blood from a Glanzmann's patient (female) was kindly provided by Robert Abel (Christina Hospital, Wilmington, DE). Citric acid and prostaglandin E1 were added to platelet-rich plasma to final concentrations of 4 mM and 1 µg/ml, respectively. The platelet-rich plasma was then centrifuged at 700 × g for 10 min. The platelet pellet was resuspended in washing buffer (4.26 mM NaH2PO4, 7.46 mM Na2HPO4, pH 6.5, containing 5.5 mM dextrose, 128 mM NaCl, 4.77 mM sodium citrate, 2.35 mM citric acid, and 3.5 mg/ml of bovine serum albumin) and centrifuged at 700 × g for 10 min. The pellet was then resuspended in a modified Tyrode-Hepes buffer (10 mM Hepes, pH 7.35, containing 136.7 mM NaCl, 5 mM glucose, 2.6 mM KCl, 13.8 mM NaHCO3, 1.0 mM MgCl2, 0.36 mM NaH2PO4, and 3.5 mg/ml bovine serum albumin) at 1 × 109 platelets/ml.

Analysis of Cortactin in Triton-solubilized Platelets

Collagen at a final concentration of 2.5 µg/ml was added to the washed platelets (0.6 ml of 1 × 109 cells/ml) in the presence of 1 mM CaCl2 in an aggregometer cuvette at 37 °C for the times indicated. Activated platelets were immediately lysed by adding 200 µl of 4 × Triton lysis buffer (200 mM Tris-HCl, pH 7.2, containing 4% Triton X-100, 20 mM EGTA, 40 µg/ml leupeptin, 40 µg/ml aprotinin, 4 mM phenylmethylsulfonyl fluoride, 4 mM benzamidine, and 4 mM Na3VO4). The lysates were centrifuged at 15,000 × g for 10 min. The pellet (insoluble fraction) was solubilized by adding an equal volume of 2 × SDS sample buffer (16). The soluble fractions were subjected to immunoprecipitation by mAb 4F11 (2.5 µg/ml) as described previously (2). The immunoprecipitates were washed once with 1 × Triton-lysis buffer, resuspended in 2 × SDS sample buffer, and analyzed by immunoblotting analysis with either mAb 4F11 or RC20 as described previously (2).

Analysis of Cortactin in SDS-lysed Platelets

Stirred platelets (0.4 ml of 1 × 109 cells/ml) were stimulated with collagen at 37 °C and lysed by adding an equal volume of 2 × SDS sample buffer including 10 mM EGTA and 20 µM calpeptin. The platelet proteins were separated by SDS-PAGE, and cortactin was detected by immunoblot analysis.

Preparation of Recombinant Cortactin Proteins

To prepare GST-cortactin, a DNA fragment of 182 bp was generated by polymerase chain reaction. The oligonucleotide ACTCGTGGATCCTGGAAAGCCTCTGCA was used as the 5' primer and contained a BamHI site; the oligonucleotide CTTGAGCGTCTGGTGTT was used as the 3' primer and contained an Xmn1 site. The amplified fragment was ligated with a DNA fragment derived from the digestion of a cDNA clone encoding the murine cortactin (2) with Xmn1 and EcoRI, and the ligated product was then cloned into BamHI and EcoRI sites of PGEX-2T (Pharmacia). The cortactin variant CortDelta 496-546 was prepared as follows. A DNA fragment of 370 base pairs was prepared by polymerase chain reaction. The oligonucleotide CGAGAGAGCTCAGCGGATGGCC was used as the 5' primer and contained a SacI site; the oligonucleotide ACTGCAGAATTCTAGATGGCTGTGATGCC was used as the 3' primer and contained an EcoRI site and a stop codon. The amplified fragment was cloned into a DNA fragment derived from the digestion of GST-cortactin with SacI and EcoRI. CortDelta 375-546 was prepared in the same way as CortDelta 496-546 except that the oligonucleotide CGAGAGAGCTCAGTAACGGATCGCCAAAGAA was used as the 5' primer and contained a stop codon and a SacI site. All polymerase chain reaction-generated fragments were confirmed by DNA sequencing. Cortactin and its variants were expressed in Escherichia coli as glutathione S-transferase fusion proteins and purified by affinity chromatography using glutathione-Sepharose as described previously (17). The purified glutathione S-transferase fusion proteins were further digested with thrombin, and the glutathione S-transferase-free proteins were purified using glutathione-Sepharose and DEAE-Sepharose (1).

Digestion of Cortactin with µ-Calpain in Vitro

Purified recombinant cortactin (3.6 µg) was incubated with µ-calpain for 90 min at different concentrations in 40 µl of reaction buffer (50 mM Tris-HCl, pH 7.36, containing 134 mM KCl, 1 mM MgCl2, 75 µM EGTA, and 75 µM CaCl2). The reaction was terminated by adding an equal volume of 2 × SDS sample buffer, and the proteins were separated by a gradient SDS-PAGE gel (4-20%, w/v). The digested proteins were visualized by either Coomassie Blue staining or immunoblotting with mAb 4F11 or a polyclonal antibody directed against a peptide encoding the amino acid sequence from the alpha -helix to the SH3 domain.


RESULTS

Proteolysis of Cortactin in Collagen-stimulated Platelets

To evaluate the role of cortactin in platelet aggregation, we examined tyrosine phosphorylation of cortactin in collagen-stimulated platelets. Activated platelets were lysed using a Triton X-100-containing buffer. The soluble fractions were subjected to immunoprecipitation with 4F11, a mAb recognizing the repeat domain of cortactin (6). The pellets were solubilized in SDS sample buffer. Proteins in both fractions were immunoblotted using either a polyclonal antibody against cortactin or a mAb against phosphotyrosine. As shown in Fig. 1A, stimulation of stirred platelets with collagen caused a dramatic increase in the level of tyrosine phosphorylation of cortactin after 15 s and a maximum phosphorylation at 45 s, which was concomitant with platelet aggregation (data not shown). However, the level of phosphorylated cortactin declined slightly after 1 min of stimulation, and this coincided with a decrease in the level of cortactin in the soluble fraction (Fig. 1B).


Fig. 1. Degradation of cortactin in Triton X-100-lysed platelets. Human platelets were prepared and washed as described under "Experimental Procedures." Washed platelets under stirring were stimulated with collagen (2.5 µg/ml) for the times indicated and lysed with lysis buffer containing 1% Triton X-100. Cortactin in the soluble fractions (A and B) was immunoprecipitated with mAb 4F11, and the proteins in the insoluble fractions (C and D) were solubilized by adding an equal volume of 2 × SDS sample buffer. The proteins were separated by SDS-PAGE, transferred to nitrocellulose membranes, and immunoblotted with a mAb against phosphotyrosine (A and C). The same membranes were stripped and reblotted with a polyclonal cortactin antibody (B) or with both cortactin and Src antibodies (D). Positions corresponding to cortactin and pp60c-src are indicated (D).
[View Larger Version of this Image (34K GIF file)]

We examined the possibility that a reduced amount of cortactin in the soluble fraction in response to collagen could be a consequence of the cytoskeletal translocation that has been described previously in thrombin-stimulated platelets (15, 18). Immunoblot analysis of cortactin in the insoluble fraction demonstrated that the stimulation of platelets with collagen enhanced tyrosine phosphorylation of multiple proteins including those that migrated at the positions for cortactin (Fig. 1C). However, the amount of cortactin associated with the insoluble fraction was only transiently increased during the period from 30 to 45 s and diminished afterward (Fig. 1D), suggesting that platelet cortactin, in either the soluble or insoluble fractions, was degraded after collagen stimulation. The degradation of cortactin appears not caused by a nonspecific proteolysis because pp60c-src associated with the pellets was not degraded under the same conditions even after a prolonged stimulation (Fig. 1D).

To confirm that the apparent degradation of cortactin was not the result of a protease released during the Triton-mediated lysis, we analyzed cortactin in platelet lysates that were prepared by direct lysis in SDS-sample buffer. The results from these experiments were compared with the pattern of cortactin degradation prepared in Triton X-100 buffer. As shown in Fig. 2A, significant amount of degraded cortactin was detected in the SDS-lysed whole platelets after collagen stimulation, although the extent of the degradation, especially at early phases of stimulation (30 and 45 s), appeared to be less than that of Triton-lysed platelets. However, the degradation patterns in both lysates are similar (Fig. 2B).


Fig. 2. Degradation of cortactin in whole platelets. Washed platelets were stimulated with collagen for the indicated times and lysed by either adding an equal volume of 2 × SDS sample buffer or adding <FR><NU>1</NU><DE>3</DE></FR> volume of 4 × Triton lysis buffer and incubated on ice for 30 min. The Triton lysates were further mixed with an equal volume of 2 × SDS sample buffer. The proteins in both lysates were separated by SDS-PAGE (7%, w/v) and analyzed by immunoblotting with 4F11 as described under "Experimental Procedures." A, a short exposure; B, a longer exposure.
[View Larger Version of this Image (36K GIF file)]

Calpain-related Protein Is the Major Protease Responsible for the Proteolysis of Cortactin in Platelets

Calpain is a family of calcium-dependent cysteine proteases that are abundantly present in platelets and are activated during platelet aggregation (19, 20). As shown in Fig. 3A, EGTA treatment of platelets significantly inhibited the degradation of cortactin as compared with untreated platelets. Furthermore, treatment with calpeptin, a specific membrane-permeable peptide-derivative inhibitor for calpain (21), resulted in the same reduction of cortactin degradation (Fig. 3B, part a). However, when a lysis buffer containing either EGTA or calpeptin was used to lyse activated platelets, no significant inhibition of cortactin degradation was observed (Fig. 3B, parts b and c). This result further confirms that the degradation of cortactin primarily occurs prior to platelet lysis.


Fig. 3. Degradation of cortactin requires a calcium-dependent protease that can be inhibited by EGTA or calpeptin. A, washed platelets were stimulated with collagen either in the presence or absence of 2 mM EGTA for the indicated times and immediately lysed with Triton X-100-lysis buffer. The proteins in the insoluble fractions were solubilized with SDS sample buffer and immunoblotted with mAb 4F11. B, platelets were pretreated with (a) or without (b) 20 µM calpeptin for 30 s. The treated platelets were then stimulated with collagen and lysed in Triton X-100-lysis buffer in the presence of 10 mM EGTA (a and b) or 80 µM calpeptin (c). Cortactin in the insoluble fractions was identified by immunoblotting with mAb 4F11.
[View Larger Version of this Image (31K GIF file)]

Degradation of Cortactin in Platelets Is Dependent on alpha IIbbeta 3

In platelets, the influx of calcium can be regulated by the activation of alpha IIbbeta 3 (22, 23), a major integrin on the surface of platelets. To evaluate the role of alpha IIbbeta 3 in the proteolysis of cortactin, we examined tyrosine phosphorylation of cortactin in platelets from a Glanzmann's patient. As shown in Fig. 4, normal platelets exhibited a 60% reduction in the amount of intact cortactin after 3 min of collagen stimulation. In contrast, no significant reduction was found with the Glanzmann's platelets, suggesting that the degradation of cortactin requires alpha IIbbeta 3 under identical conditions. Interestingly, the induction of tyrosine phosphorylation of cortactin in response to collagen in the Glanzmann's platelets was not impaired (Fig. 4), implying that tyrosine phosphorylation of cortactin is a process independent of alpha IIbbeta 3.


Fig. 4. Proteolysis of platelet cortactin requires alpha IIbbeta 3. Normal platelets and platelets from a Glanzmann's patient were stimulated with collagen for the times indicated and lysed with an equal volume of 2 × SDS sample buffer. The platelet proteins were analyzed by immunoblotting with mAb 4F11 or mAb against phosphotyrosine.
[View Larger Version of this Image (45K GIF file)]

Cleavage of Cortactin by µ-Calpain in Vitro Is Dependent on the Presence of a Sequence Containing the Proline-rich Region and Multiple Tyrosine Residues

Purified µ-calpain (calpain-I) digests recombinant murine cortactin in vitro in a dose-dependent manner (Fig. 5A). At a concentration of 6.2 µg/ml of calpain, approximately 90% of the cortactin proteins were digested to multiple fragments. Interestingly, many of the digested fragments were reactive to mAb 4F11, which specifically recognizes the repeat domain of cortactin (12), but not to an antibody directed against the region between the repeat and the carboxyl terminus (Fig. 6A). This implies that the sequence in this region may be more susceptible to calpain. To verify this, we analyzed two cortactin variants, CortDelta 496-546, which lacks the SH3 domain, and CortDelta 375-546, which lacks the sequence from the proline-rich region to the carboxyl terminus (Fig. 6B, upper part). As with the wild-type cortactin, the mutant CortDelta 496-546 was efficiently digested by calpain (Fig. 6B, lower part). In contrast, little digestion of the mutant CortDelta 375-546 was detected under the same conditions, indicating that the sequence of amino acids 375-496, which contains the proline-rich region and multiple tyrosine residues, may be involved in the calpain-mediated proteolysis.


Fig. 5. In vitro digestion of cortactin by calpain. Recombinant cortactin (1 µM) was incubated with µ-calpain at different concentrations for 90 min and analyzed by SDS-PAGE. The proteins were visualized by Coomassie Blue staining. Lane 1, molecular weight markers; lane 2, without calpain; lane 3-7, with calpain at concentrations of 1.5, 3.1, 6.2, 12.5, and 25 µg/ml, respectively.
[View Larger Version of this Image (84K GIF file)]


Fig. 6. Calpain-mediated digestion requires the presence of a sequence containing the proline-rich region and multiple tyrosine residues. A, cortactin was incubated for 90 min in either the absence (lane 1) or presence (lane 2) of 1.5 µg/ml µ-calpain. The digested proteins were immunoblotted with mAb 4F11 (a) or a polyclonal antibody against amino acids 323-546 (b). B, upper part, schematic presentation of cortactin and cortactin mutants. The areas for the repeat (Repeat), the alpha -helix (Helix), the proline-rich region (P), and tyrosine residues targeted by pp60c-src (Y) are indicated; lower part, cortactin and its mutants were digested with µ-calpain, and the resultant fragments were analyzed by immunoblotting with mAb 4F11.
[View Larger Version of this Image (27K GIF file)]

Src-mediated Tyrosine Phosphorylation Increases the Susceptibility of Cortactin to Calpain

Amino acids 375-496 contain multiple tyrosine residues that can be targeted for phosphorylation by pp60c-src.2 Thus, we performed a calpain digestion of cortactin phosphorylated by pp60c-src. Fig. 7 shows that most phosphorylated cortactin proteins were digested nearly completely within 2 min. In contrast, significant amounts of nonphosphorylated cortactin remained even after 20 min of digestion under the same conditions. However, when partially digested phosphorylated cortactin was analyzed by SDS-PAGE and compared with nonphosphorylated cortactin, we did not observe any significant difference in the two patterns (Fig. 7). Therefore, it is likely that tyrosine phosphorylation enhances the efficiency of calpain-mediated digestion without altering its cleavage sites.


Fig. 7. Src-mediated tyrosine phosphorylation increases the susceptibility of cortactin to calpain. A, cortactin (1.3 µM) was phosphorylated by pp60c-src in tyrosine kinase buffer. Phosphorylated cortactin was then subsequently treated with µ-calpain (1 µg/ml) for the times indicated and further analyzed by immunoblot analysis with mAb 4F11. B, comparison of the digestion pattern of phosphorylated cortactin (+Src) with that of nonphosphorylated cortactin (-Src). Proteins were visualized by Coomassie Blue staining. The arrowhead indicates bovine serum albumin that is used as carrier in pp60c-src buffer.
[View Larger Version of this Image (30K GIF file)]


DISCUSSION

It is unclear whether platelet calpain-mediated proteolysis occurs during lysis of cells or within aggregated platelets (24, 25). Our data indicate that the proteolysis of cortactin occurs within activated platelets. We detected the degradation of cortactin in whole platelets prepared by direct lysis in a SDS-sample buffer (Figs. 2 and 4). In addition, the calpain inhibitors EGTA and calpeptin block the degradation when they are applied before but not after platelet activation. Finally, it appears that the calpain-mediated proteolysis of cortactin is not the result of a nonspecific proteolysis, because pp60c-src, another substrate for calpain (26), was not degraded under the same conditions that allow cortactin proteolysis (Fig. 1D). However, it should be pointed out that the degree of the proteolysis of cortactin in activated platelets appears to vary depending on the method of lysing platelets. There is more extensive degradation found in Triton-lysed platelets than in SDS sample buffer (Fig. 2). This may be due to the fact that the soluble cortactin becomes more vulnerable to calpain released after lysis.

In agreement with other reports (15, 18), we observed that cortactin undergoes a transient translocation into the Triton-insoluble fraction between 30 and 45 s after collagen stimulation (Fig. 1D); however, the role of the translocation in this proteolysis of cortactin is not clear. While cortactin is a potent F-actin binding and cross-linking protein, the presence of F-actin does not apparently change the efficiency of the proteolysis of cortactin in vitro (data not shown). Furthermore, a cortactin mutant able to bind to F-actin but lacking the sequence from the proline-rich region to the carboxyl terminus is not efficiently digested by calpain (Fig. 6B). Hence, it is unlikely that the F-actin binding is a rate-limiting step for the calpain digestion.

Many cytoskeleton-associated proteins have been reported to be substrates for calpain. These include actin-binding proteins (27), vitronectin (28), protein-phosphotyrosine phosphatase 1B (29), integrin beta 3 subunit (30), talin (27), spectrin (31), and protein kinase C (32). As with many of those substrates, proteolysis of cortactin appears to be dependent on alpha IIbbeta 3 because it does not occur in Glanzmann's platelets lacking functional alpha IIbbeta 3 (Fig. 4). We have found, however, that the absence of alpha IIbbeta 3 does not affect collagen-induced tyrosine phosphorylation of cortactin. Our finding is in agreement with a previous report, which also showed increased tyrosine phosphorylation in thrombin-treated platelets derived from Glanzmann's patients (15). Furthermore, tyrosine phosphorylation of cortactin can be detected after 15 s of stimulation (Fig. 1A). This is prior to platelet aggregation, which occurs 30-45 s after stimulation. Thus, tyrosine phosphorylation of cortactin is kinetically correlated with the activation of pp60c-src, which occurs in the early phase prior to the activation of alpha IIbbeta 3 during platelet stimulation (33). These data indicate that the Src-mediated tyrosine phosphorylation of cortactin could be involved in the calpain-mediated digestion. The importance of Src in the digestion of cortactin is further highlighted by our findings that the digestion of recombinant cortactin by µ-calpain is dependent on the presence of a sequence containing multiple tyrosine residues targeted by pp60c-src (Fig. 6), and the efficiency of the digestion of cortactin in vitro is dramatically increased by pp60c-src (Fig. 7).

Calpain-digested cortactin in vitro has significantly less F-actin cross-linking activity (data not shown). Interestingly, the F-actin cross-linking activity can be also down-regulated by tyrosine phosphorylation without degradation (1). These dual mechanisms regulating cortactin may be required to ensure the irreversible shape change associated with activated platelets. It is also noteworthy that both mechanisms involve the same structural region between the proline-rich motif and the SH3 domain. This may suggest the importance of this region in the regulation of cortactin function. Since calpain and cortactin are widely expressed in many mammalian cells, future studies using a structure-function approach should reveal the significance of calpain-mediated cleavage of cortactin in cellular cytoskeletal reorganization.


FOOTNOTES

*   This study was supported by National Institutes of Health Grant R29 HL52753 (to X. Z.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
**   To whom correspondence should be addressed: Dept. of Experimental Pathology, The Holland Laboratory, American Red Cross, 15601 Crabbs Branch Way, Rockville, MD 20855. Tel.: 301-738-0568; Fax: 301-738-0879; E-mail: zhanx{at}usa.redcross.org.
1   The abbreviations used are: F-actin, filamentous actin; mAb, monoclonal antibody; PAGE, polyacrylamide gel electrophoresis; SH3, Src homology 3.
2   J. Qiu and X. Zhan, manuscript in preparation.

ACKNOWLEDGEMENTS

We thank Graham Jamieson and Allan Mufson for critical reading of the manuscript and Diana Norman for expert secretarial support.


REFERENCES

  1. Huang, C., Ni, Y., Gao, Y., Wang, T., Haudenschild, C. C., and Zhan, X. (1997) J. Biol. Chem. 272, 13911-13915 [Abstract/Free Full Text]
  2. Zhan, X., Hu, X., Friesel, R., and Maciag, T. (1993) J. Biol. Chem. 268, 9611-9620 [Abstract/Free Full Text]
  3. Maa, M., Wilson, L. K., Moyers, J. S., Vines, R. R., Parsons, J. T., and Parsons, S. J. (1992) Oncogene 7, 2429-2438 [Medline] [Order article via Infotrieve]
  4. Vuori, K., and Ruoslahti, E. (1995) J. Biol. Chem. 270, 22259-22262 [Abstract/Free Full Text]
  5. Dehio, C., Prevost, M. C., and Sansonetti, P. J. (1995) EMBO J. 14, 2471-2482 [Medline] [Order article via Infotrieve]
  6. Wu, H., Reynolds, A. B., Kanner, S. B., Vines, R. R., and Parsons, J. T. (1991) Mol. Cell Biol. 11, 5113-5124 [Abstract/Free Full Text]
  7. Schuuring, E. D., Verhoeven, E., Litvinov, S., and Michalides, R. J. A. M. (1993) Mol. Cell Biol. 13, 2891-2898 [Abstract/Free Full Text]
  8. Bringuier, P. P., Tamimi, Y., Schuuring, E., and Schalken, J. (1996) Oncogene 12, 1747-1753 [Medline] [Order article via Infotrieve]
  9. Thomas, S. M., Soriano, P., and Imamoto, A. (1995) Nature 376, 267-271 [CrossRef][Medline] [Order article via Infotrieve]
  10. Nada, S., Okada, M., Aizawa, S., and Nakagawa, H. (1994) Oncogene 9, 3571-3578 [Medline] [Order article via Infotrieve]
  11. Kitamura, D., Kaneko, H., Miyagoe, Y., Ariyasu, T., and Watanabe, T. (1989) Nucleic Acids Res. 17, 9367-9379
  12. Wu, H., and Parsons, J. T. (1993) J. Cell Biol. 120, 1417-1426 [Abstract/Free Full Text]
  13. Zhan, X., Haudenschild, C. C., Ni, Y., Smith, E., and Huang, C. (1997) Blood 89, 457-464 [Abstract/Free Full Text]
  14. Wong, S., Reynolds, A. B., and Papkoff, J. (1992) Oncogene 7, 2407-2415 [Medline] [Order article via Infotrieve]
  15. Fox, J. E. B., Lipfert, L., Clark, E. A., Reynolds, C. C., Austin, C. D., and Brugge, J. S. (1993) J. Biol. Chem. 268, 25973-25984 [Abstract/Free Full Text]
  16. Laemmli, U. K. (1970) Nature 227, 680-685 [CrossRef][Medline] [Order article via Infotrieve]
  17. Zhan, X., Plourde, C., Hu, X., Friesel, R., and Maciag, T. (1994) J. Biol. Chem. 269, 20221-20224 [Abstract/Free Full Text]
  18. Ozawa, K., Kashiwada, K., Takahashi, M., and Sobue, K. (1995) Exp. Cell Res. 221, 197-204 [CrossRef][Medline] [Order article via Infotrieve]
  19. Croall, D. E., and DeMartino, G. N. (1991) Physiol. Rev. 71, 813-847 [Free Full Text]
  20. Fox, J. E., Taylor, R. G., Taffarel, M., Boyles, J. K., and Goll, D. E. (1993) J. Cell Biol. 120, 1501-1507 [Abstract/Free Full Text]
  21. Tsujinaka, T., Kajiwara, Y., Kambayashi, J., Sakon, M., Higuchi, N., Tanaka, T., and Mori, T. (1988) Biochem. Biophys. Res. Commun. 153, 1201-1208 [CrossRef][Medline] [Order article via Infotrieve]
  22. Fujimoto, T., Fujimura, K., and Kuramoto, A. (1991) J. Biol. Chem. 266, 16370-16375 [Abstract/Free Full Text]
  23. Rybak, M. E., Renzulli, L. A., Bruns, M. J., and Cahaly, D. P. (1988) Blood 72, 714-720 [Abstract/Free Full Text]
  24. Wencel-Drake, J. D., Okita, J. R., Annis, D. S., and Kunicki, T. J. (1991) Arterioscler. Thromb. 11, 882-891 [Abstract/Free Full Text]
  25. Elce, J. S., Sigmund, L., and Fox, M. J. (1989) Biochem. J. 261, 1039-1042 [Medline] [Order article via Infotrieve]
  26. Oda, A., Druker, B. J., Ariyoshi, H., Smith, M., and Salzman, E. W. (1993) J. Biol. Chem. 268, 12603-12608 [Abstract/Free Full Text]
  27. Fox, J. E. B., Goll, D. E., Reynolds, C. C., and Phillips, D. R. (1985) J. Biol. Chem. 260, 1060-1066 [Abstract/Free Full Text]
  28. Seiffert, D. (1996) J. Biol. Chem. 271, 11170-11176 [Abstract/Free Full Text]
  29. Frangioni, J. V., Oda, A., Smith, M., Salzman, E. W., and Neel, B. G. (1993) EMBO J. 12, 4843-4856 [Medline] [Order article via Infotrieve]
  30. Du, X., Saido, T. C., Tsubuki, S., Indig, F. E., Williams, M. J., and Ginsberg, M. H. (1995) J. Biol. Chem. 270, 26146-26151 [Abstract/Free Full Text]
  31. Fox, J. E. B., Reynolds, C. C., Morrow, J. S., and Phillips, D. R. (1987) Blood 69, 537-545 [Abstract/Free Full Text]
  32. Melloni, E., Pontremoli, S., Michetti, M., Sacco, O., Sparatore, B., and Horecker, B. L. (1986) J. Biol. Chem. 261, 4101-4105 [Abstract/Free Full Text]
  33. Clark, E. A., and Brugge, J. S. (1993) Mol. Cell Biol. 13, 1863-1871 [Abstract/Free Full Text]

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Mol. Biol. CellHome page
C. Badowski, G. Pawlak, A. Grichine, A. Chabadel, C. Oddou, P. Jurdic, M. Pfaff, C. Albiges-Rizo, and M. R. Block
Paxillin Phosphorylation Controls Invadopodia/Podosomes Spatiotemporal Organization
Mol. Biol. Cell, February 1, 2008; 19(2): 633 - 645.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
O. Destaing, A. Sanjay, C. Itzstein, W. C. Horne, D. Toomre, P. De Camilli, and R. Baron
The Tyrosine Kinase Activity of c-Src Regulates Actin Dynamics and Organization of Podosomes in Osteoclasts
Mol. Biol. Cell, January 1, 2008; 19(1): 394 - 404.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
C. Luxenburg, J. T. Parsons, L. Addadi, and B. Geiger
Involvement of the Src-cortactin pathway in podosome formation and turnover during polarization of cultured osteoclasts
J. Cell Sci., December 1, 2006; 119(23): 4878 - 4888.
[Abstract] [Full Text] [PDF]


Home page
PhysiologyHome page
L. I. Cosen-Binker and A. Kapus
Cortactin: The Gray Eminence of the Cytoskeleton.
Physiology, October 1, 2006; 21(5): 352 - 361.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
B. J. Perrin, K. J. Amann, and A. Huttenlocher
Proteolysis of Cortactin by Calpain Regulates Membrane Protrusion during Cell Migration
Mol. Biol. Cell, January 1, 2006; 17(1): 239 - 250.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
S. J. Franco and A. Huttenlocher
Regulating cell migration: calpains make the cut
J. Cell Sci., September 1, 2005; 118(17): 3829 - 3838.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Heiska and O. Carpen
Src Phosphorylates Ezrin at Tyrosine 477 and Induces a Phosphospecific Association between Ezrin and a Kelch-Repeat Protein Family Member
J. Biol. Chem., March 18, 2005; 280(11): 10244 - 10252.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Zamorano, M. D. Rivas, F. Setien, and M. Perez-G
Proteolytic Regulation of Activated STAT6 by Calpains
J. Immunol., March 1, 2005; 174(5): 2843 - 2848.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. A. Westhoff, B. Serrels, V. J. Fincham, M. C. Frame, and N. O. Carragher
Src-Mediated Phosphorylation of Focal Adhesion Kinase Couples Actin and Adhesion Dynamics to Survival Signaling
Mol. Cell. Biol., September 15, 2004; 24(18): 8113 - 8133.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Kulkarni and S. P. Jackson
Platelet Factor XIII and Calpain Negatively Regulate Integrin {alpha}IIb{beta}3 Adhesive Function and Thrombus Growth
J. Biol. Chem., July 16, 2004; 279(29): 30697 - 30706.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
B. Knoll and U. Drescher
Src Family Kinases Are Involved in EphA Receptor-Mediated Retinal Axon Guidance
J. Neurosci., July 14, 2004; 24(28): 6248 - 6257.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
N. Martinez-Quiles, H.-Y. H. Ho, M. W. Kirschner, N. Ramesh, and R. S. Geha
Erk/Src Phosphorylation of Cortactin Acts as a Switch On-Switch Off Mechanism That Controls Its Ability To Activate N-WASP
Mol. Cell. Biol., June 15, 2004; 24(12): 5269 - 5280.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. Forsythe and A. D. Befus
Inhibition of Calpain Is a Component of Nitric Oxide-Induced Down-Regulation of Human Mast Cell Adhesion
J. Immunol., January 1, 2003; 170(1): 287 - 293.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Hattan, E. Nesti, T. G. Cachero, and A. D. Morielli
Tyrosine Phosphorylation of Kv1.2 Modulates Its Interaction with the Actin-binding Protein Cortactin
J. Biol. Chem., October 4, 2002; 277(41): 38596 - 38606.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Biol.Home page
A. Robert, M.-J. Miron, C. Champagne, M.-C. Gingras, P. E. Branton, and J. N. Lavoie
Distinct cell death pathways triggered by the adenovirus early region 4 ORF 4 protein
J. Cell Biol., August 5, 2002; 158(3): 519 - 528.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
M. S. Lombardi, A. Kavelaars, P. Penela, E. J. Scholtens, M. Roccio, R. E. Schmidt, M. Schedlowski, F. Mayor Jr., and C. J. Heijnen
Oxidative Stress Decreases G Protein-Coupled Receptor Kinase 2 in Lymphocytes via a Calpain-Dependent Mechanism
Mol. Pharmacol., August 1, 2002; 62(2): 379 - 388.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
G. Nicolas, C. M. Fournier, C. Galand, L. Malbert-Colas, O. Bournier, Y. Kroviarski, M. Bourgeois, J. H. Camonis, D. Dhermy, B. Grandchamp, et al.
Tyrosine Phosphorylation Regulates Alpha II Spectrin Cleavage by Calpain
Mol. Cell. Biol., May 15, 2002; 22(10): 3527 - 3536.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. M. Gilligan, R. Sarid, and J. Weese
Adducin in platelets: activation-induced phosphorylation by PKC and proteolysis by calpain
Blood, April 1, 2002; 99(7): 2418 - 2426.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Biol.Home page
Bialkowska, Kulkarni, Du, D. Goll, T. Saido, and J. Fox
Evidence that {beta}3 Integrin-induced Rac Activation Involves the Calpain-dependent Formation of Integrin Clusters that Are Distinct from the Focal Complexes and Focal Adhesions that Form as Rac and RhoA become Active
J. Cell Biol., October 30, 2000; 151(3): 685 - 696.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Kulkarni, T. C. Saido, K. Suzuki, and J. E. B. Fox
Calpain Mediates Integrin-induced Signaling at a Point Upstream of Rho Family Members
J. Biol. Chem., July 23, 1999; 274(30): 21265 - 21275.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Wu, D. Dowbenko, and L. A. Lasky
PSTPIP 2, a Second Tyrosine Phosphorylated, Cytoskeletal-associated Protein That Binds a PEST-type Protein-tyrosine Phosphatase
J. Biol. Chem., November 13, 1998; 273(46): 30487 - 30496.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Huang, J. Liu, C. C. Haudenschild, and X. Zhan
The Role of Tyrosine Phosphorylation of Cortactin in the Locomotion of Endothelial Cells
J. Biol. Chem., October 2, 1998; 273(40): 25770 - 25776.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Kapus, C. Di Ciano, J. Sun, X. Zhan, L. Kim, T. W. Wong, and O. D. Rotstein
Cell Volume-dependent Phosphorylation of Proteins of the Cortical Cytoskeleton and Cell-Cell Contact Sites. THE ROLE OF Fyn AND FER KINASES
J. Biol. Chem., October 6, 2000; 275(41): 32289 - 32298.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. O. Carragher, V. J. Fincham, D. Riley, and M. C. Frame
Cleavage of Focal Adhesion Kinase by Different Proteases during Src-regulated Transformation and Apoptosis. DISTINCT ROLES FOR CALPAIN AND CASPASES
J. Biol. Chem., February 2, 2001; 276(6): 4270 - 4275.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Xu, R. Zhao, Y. Peng, A. Guerrah, and Z. J. Zhao
Association of Tyrosine Phosphatase SHP-2 with F-actin at Low Cell Densities
J. Biol. Chem., July 27, 2001; 276(31): 29479 - 29484.
[Abstract] [Full Text]</