|
Volume 272, Number 32,
Issue of August 8, 1997
pp. 20063-20069
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.
Adrenocorticotropin Induction of Stress-activated Protein
Kinase in the Adrenal Cortex in Vivo*
(Received for publication, September 12, 1996, and in revised form, May 5, 1997)
Genichi
Watanabe
§,
Pilar
Pena
¶,
Chris
Albanese
,
Lisa D.
Wilsbacher
,
James B.
Young
and
Richard G.
Pestell
**
From the Departments of Medicine and Developmental
and Molecular Biology, The Albert Einstein Cancer Center, Albert
Einstein College of Medicine, Bronx, New York 10461 and
Department of Medicine, Northwestern University Medical School,
Chicago, Illinois 60611
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
ABSTRACT
A broad array of stressors induce ACTH release
from the anterior pituitary, with consequent stimulation of the adrenal
cortex and release of glucocorticoids critical for survival of the
animal. ACTH stimulates adrenocortical gene expression in
vivo and inhibits adrenocortical cell proliferation. Binding of
ACTH to its G-protein-coupled receptor stimulates the production of
cAMP and activation of the protein kinase A pathway. The
stress-activated protein kinases (SAPKs) (or c-Jun N-terminal kinases)
and the extracellular signal-regulated kinases (ERKs) are members of
the mitogen-activated protein kinase family of serine/threonine
kinases, which have recently been implicated in G-protein-coupled
receptor intracellular signaling. The SAPKs are preferentially induced
by osmotic stress and UV light, whereas the ERKs are preferentially
induced by growth factors and proliferative signals in cultured cells.
In these studies, ACTH stimulated SAPK activity 3-4-fold both in the
adrenal cortex in vivo and in the Y1 adrenocortical cell
line. 12-O-Tetradecanoylphorbol-13-acetate but not cAMP
induced SAPK activity in Y1 cells. The isoquinolinesulfonamide inhibitors H-8 and H-89 blocked ACTH induction of SAPK activity at
protein kinase C inhibitory doses but not at protein kinase A
inhibitory doses. The calcium chelating agent EGTA inhibited ACTH-induced SAPK activity and the calcium ionophore A23187 induced SAPK activity 3-fold. In contrast with the induction of SAPK by ACTH,
ERK activity was inhibited in the adrenal cortex in vivo and in Y1 adrenal cells. Together these findings suggest that ACTH
induces SAPK activity through a PKC and
Ca+2-dependent pathway. The induction of SAPK
and inhibition of ERK by ACTH in vivo may preferentially
regulate target genes involved in the adrenocortical stress responses
in the whole animal.
INTRODUCTION
ACTH binds to specific G-protein (Gs)-coupled surface receptors in
the adrenal cortex to induce secretion of steroid hormones critical for
the normal stress response. The stimulatory guanine nucleotide-bound Gs
couples to adenylate cyclase, leading to a series of signaling
cascades. The acute ACTH response is associated with a rapid increase
in steroid secretion and is mediated by cAMP and
cAMP-dependent protein kinase A
(PKA)1 (1, 2). Although ACTH
stimulates an increase in cAMP formation (3-5), other secondary
messengers including protein kinase C (PKC) (6),
Ca+2-calmodulin-dependent protein kinase (7)
and the phosphoinositol pathway (8, 9) are also induced by ACTH. Early
and delayed gene expression is elicited by ACTH (5). The immediate
early genes junB, c-myc, and c-fos
were stimulated by ACTH in cultured adrenocortical cells (10), and
c-fos and c-jun mRNAs were induced by ACTH in
the Y1 adrenal cell line (11). The steroidogenic P-450 genes, including
P-450 side chain cleavage (CYP11A1), are induced in a more
delayed manner in both the adrenal cortex in vivo and in Y1
cells (5).
Several observations suggest that ACTH regulates PKA-independent
signaling. ACTH and cAMP induced immediate early gene expression with
quite different kinetics (11). The immediate early gene expression
profile induced by ACTH in Y1 cells resembled the expression profile
induced by stimulating the PKC pathway with phorbol esters (11). In
addition, c-myc mRNA levels were induced by the PKC activator 12-O-tetradecanoylphorbol-13-acetate (TPA), and
ACTH-induced c-myc expression was blocked by the PKC
inhibitor H-7 in rat primary adrenal cell cultures (10).
Stimuli that activate either the PKC, the
Ca+2-calmodulin-dependent protein kinase, or
the phosphoinositol pathway, also induce members of the
mitogen-activated protein kinase family of serine/threonine kinases
(12). Mitogen-activated protein kinases include the related but
distinct p54 stress-activated protein kinases (SAPKs) (or c-Jun
N-terminal kinases), the p42 and p44 extracellular
signal-regulated kinases (ERKs), and p38 kinases (13-17). These
serine/threonine kinases activate downstream transcription factors,
which in turn induce expression of target genes. A variety of
environmental stressors induce SAPK activity in cultured cells,
including heat shock and UV irradiation and calcium ionophores
(17-22). Angiotensin II, activating mutations of G-protein-coupled
receptors, and activators of the PKC pathway also induce SAPK activity
(13-17, 23, 24). Relatively little is known about the regulation of
the SAPK pathway in vivo. The effects of ACTH on SAPK
activity were previously unknown.
ERK activity is stimulated by proliferative stimuli including growth
factors and increases in intracellular Ca+2 in a cell
type-specific manner (25-27). ERK activity induced by either epidermal
growth factor or platelet-derived growth factor in fibroblast cell
lines was inhibited by cAMP (25, 28, 29). In contrast, cAMP induced ERK
activity in PC12 cells (30), rat ovarian granulosa cells (31), and
cardiac myocytes (32), indicating that the effect of cAMP on ERK
activity is cell type-specific.
In addition to adrenal cells, ACTH receptors are expressed on a number
of different cell types including lymphocytes (33), pancreatic islet
cells (34), and adipose tissue (35); thus, an understanding of
intracellular signaling by ACTH may have implications in a broad array
of different cell types. To understand more fully the intracellular
signaling pathways governing ACTH action, we examined the effect of
ACTH on the activity of the mitogen-activated protein kinases, SAPK,
and ERK kinases in vivo and in cultured adrenocortical
cells. Since previous studies suggested that the induction of several
immediate early genes by ACTH appeared to involve mechanisms separate
from the PKA pathway, we examined the regulation of immediate early
gene expression and promoter activity in response to ACTH.
MATERIALS AND METHODS
Animals and Reagents
Male CD rats (175-200 g; Charles
River Laboratories, Wilmington, MA) were used for the experiments. The
rats used in this study were maintained in accordance with the
guidelines of the animal care committee of Northwestern University.
Free-feeding rats were injected with ACTH (5 units/100 g weight;
Cortrosyn, Organon, Bedford, OH) by the tail vein and sacrificed by
decapitation after CO2 inhalation. Adrenals were taken at
the time point indicated in the text. The adrenal cortex was dissected
free from the medulla and lysed with radioimmune precipitation buffer
(100 mM Tris, pH 7.5, 150 mM NaCl, 0.1% SDS,
1% Nonidet P-40, 0.1 mM Na3VO4, 0.5% deoxycholate, 0.1 mM phenylmethylsulfonyl fluroide, 1 µg/ml leupeptin), and the extracts were used for immune complex
kinase assays and Western blotting. Porcine adrenocorticotropic hormone (ACTH(1-39)) (Sigma), 8-bromo-cAMP (Sigma),
N-(2-(methylamino)ethyl)-5-isoquinolinesulfonamide hydrochloride (H-8),
N-(2-(p-bromocinnamyl)amino)ethyl-5-isoquinolinesulfonamide hydrochloride (H-89), A23187 (Calbiochem-Novabiochem International), BAPTA (Molecular Probes, Inc. Eugene, OR), EGTA (Sigma), and TPA (Sigma) were reconstituted and stored as recommended by the
manufacturer. The SignaTECT cAMP-dependent protein kinase A
assay system (Promega, Madison, WI), which uses biotinylated
Leu-Arg-Arg-Ala-Ser-Leu-Gly (Kemptide) as substrate, and the SignaTECT
protein kinase C assay system (Promega), which uses biotinylated
Ala-Ala-Lys-Ile-Gln-Ala-Ser-Phe-Arg-Gly-His-Met-Ala-Arg-Lys-Lys (Neurogranin) peptide, were used as recommended by the
manufacturer.
SAPK, p42ERK, p44ERK Immune Complex
Assays
Assays were performed as recently described on extracts
derived from rats or cultured cells (24, 36). Staphylococcal protein A-agarose beads were incubated with anti-ERK antibody (C14, Santa Cruz
Biotechnology, Santa Cruz, CA) or anti-SAPK antibody (a gift from Dr.
J. Kyriakis) (17) for 1 h at 4 °C. The antibody-beads complexes
were washed once with radioimmune precipitation buffer and incubated
with 200 µg of extracts for a further 2 h at 4 °C. The
immunoprecipitates were washed with radioimmune precipitation buffer,
wash buffer (0.5 M LiCl, 0.1 M Tris-Cl, pH 8.0, 1 mM dithiothreitol, and kinase buffer (for SAPK: 20 mM MOPS, pH 7.2, 2 mM EGTA, 10 mM
MgCl2, 0.1% Triton X-100, 1 mM dithiothreitol;
for ERK: 25 mM HEPES, pH 7.2, 10 mM
MgCl2, 10 mM MnCl2, 1 mM dithiothreitol). The reactions were performed at
30 °C for 20 min in 40 µl of kinase buffer with 10 µCi of
[ -32P]ATP (6000 Ci/mmol, 1 Ci = 37 GBq) and 2 µg of glutathione S-transferase c-Jun (1-135) protein
fragment for SAPK activity or 2 µg of myelin basic protein for ERK
activity. The samples were analyzed by SDS-polyacrylamide gel
electrophoresis upon termination of the reaction with Laemmli buffer
and boiling. The phosphorylation of glutathione
S-transferase c-Jun or myelin basic protein was quantified
by densitometry using a Bio-Rad Molecular Analyst 1.1.1.
Western Blots
The cell extracts used for
immunoprecipitation kinase assays were also used to quantify protein
abundance of the immediate early gene and Cyp11A1 gene
products. Western blotting was performed as described previously using
antibodies to JunB (N-17), JunD (329), c-Fos (K-25), c-Myc (C-8, Santa
Cruz Biotechnology), -tubulin (5H1) (37), and the rat Cyp11A1 (38,
39). Reactive proteins were visualized by the enhanced
chemiluminescence system (Amersham Life Science, Inc.). The abundance
of immunoreactive protein was quantified by densitometry using a
Bio-Rad Molecular Analyst 1.1.1.
Reporter Genes, Expression Vectors, and
Oligodeoxyribonucleotides
The reporter c-fosLUC (24)
contains the human c-fos promoter from 361 to +157 in the
pA3LUC reporter (40). The junB promoter was
cloned by polymerase chain reaction using oligonucleotides to the
published sequences (5 GGTACCCGCGAGCCGCCTCCTCCC, 3
AAGCTTCCGGGCGGCCCAGGCGGT) and was subcloned into the reporter
pA3LUC to create the reporter junBLUC. The
c-myc P1/P2 promoters from 157 to +500 (41) were linked to
the pA3LUC reporter to form c-mycLUC. The
cAMP-responsive chorionic gonadotropin subunit promoter fragments
linked to the luciferase reporter gene 846 LUC referred to as
CRELUC and 172 LUC were previously described (42). The
reporter plasmid 172 m4 LUC reporter that contains a mutation
within the chorionic gonadotropin subunit cAMP response element
(CRE) which abolishes cAMP responsiveness and cAMP-responsive element
binding protein binding was described previously (42). The 2700-base
pair ovine CYP11A1 promoter fragment linked to the
luciferase reporter gene, 2700 CYPLUC, was described previously (43).
The integrity of all constructs was determined by restriction enzyme
analysis and dideoxy DNA sequencing (44) using an Applied Biosystems
Inc. automated sequencer. The construction of the plasmid encoding the
wild type and inactive mutant catalytic subunits of protein kinase A
were described previously (45).
Tissue Culture
Cell culture, DNA transfection, and
luciferase assays were performed as described previously (42, 46). The
Y1 cell line was a gift from Dr. B. Schimmer. Y1 cells were grown in
Ham's F-10 medium with 1% penicillin, streptomycin, 2.5% fetal
bovine serum, and 15% horse serum. 3 × 105 cells
were transfected by calcium phosphate precipitation, the medium was
changed after 6 h, and luciferase activity was determined after a
further 24 h (42, 46). Luciferase assays were performed using an
Autolumat LB 953 (EG & G Berthold). Luciferase content was measured by
calculating the light emitted during the initial 30 s of the
reaction, and the values are expressed in arbitrary light units (36,
42). The percent effect was determined by comparison with its untreated
activity. Statistical analyses were performed using the Mann Whitney
U test.
RESULTS
SAPK Activity Is Stimulated by ACTH in the Adrenal Cortex in
Vivo
To examine the effect of ACTH on adrenal cortical SAPK
activity in vivo, rats were treated with intravenous ACTH.
The adrenal cortex was dissected from the medulla, and immune complex
kinase assays were performed using a polyclonal SAPK antibody and the amino terminus of c-Jun (amino acids 1-135) as the substrate (17, 24,
43). Adrenal cortical SAPK activity was increased 2-fold at 15 min
(Fig. 1A) and 3-fold (3.1 ± 0.5, n = 5) at 30 min (Fig. 1, A and
B). SAPK activity remained elevated at 1 h (3.2-fold) and at 6 h (2-fold), indicating the response to ACTH was both rapid and sustained (Fig. 1, A and B). The
sustained induction of SAPK activity contrasts with the transient
induction of SAPK activity we previously observed in response to growth
factors (43). In control animals treated with intravenous saline, there was no increase in SAPK activity. In contrast with the induction of
SAPK activity, ERK activity was reduced 40% at 30 min in the same
ACTH-treated adrenal cortical extracts (data not shown).
Fig. 1.
The time course of SAPK induction by ACTH
in vivo. The adrenal cortical cells from ACTH-treated
animals were assayed at the time points indicated. The cell extracts
were immunoprecipitated using the polyclonal SAPK antibody (17), and
the kinase assays were performed with treated and untreated cell
extracts. Relative -fold induction was determined by comparison with
untreated cells using a densitometer. The mean data ± S.E. are
shown.
[View Larger Version of this Image (18K GIF file)]
SAPK Activity Is Stimulated by ACTH in Cultured Adrenocortical Y1
Cells
The effect of ACTH on SAPK and ERK activity was also
determined in cultured Y1 adrenal cells. ACTH (10 6
M) treatment for 30 min stimulated SAPK activity an average
of 3-fold in Y1 cells (Fig.
2A). To determine the time
course of SAPK induction by ACTH in Y1 cells, treatment with ACTH was
conducted for 15 min to 24 h, and the cells were harvested. SAPK
activity was induced 2.5-fold (n = 6, range
1.4-4-fold) within 15 min and was sustained at 2 h (Fig.
2B), returning to baseline at 6 h (data not shown). The
induction of SAPK was observed at 10 8 M and
10 10 M ACTH (Fig. 2B). SAPK
activity was also induced by ACTH in the absence of serum (Fig.
2C). In contrast with the effect of ACTH on SAPK, ERK
activity was reduced by ACTH treatment with a mean reduction of 45% at
30 min (Fig. 2, D and E). The inhibition of ERK
activity by ACTH was observed at 10 6 M and
10 8 M ACTH (Fig. 2E).
Fig. 2.
ACTH induces SAPK activity in Y1 cells.
Y1 cells were treated with 10 6 M ACTH or
vehicle alone for 30 min (n = 3) (A) for the
time points indicated (B). The cell extracts were
immunoprecipitated using the polyclonal SAPK antibody (17), and the
mean data ± S.E. for n = 3 are shown in
A. In C, Y1 cells were placed in serum-free medium for 24 h before the addition of ACTH, and SAPK assays were performed after 20 min of ACTH treatment. For the ERK assays
(D and E), the anti-Erk antibody (C16) was used.
The relative -fold induction was determined by comparison with
untreated cells, and the data are the mean ± S.E. for
n = 3.
[View Larger Version of this Image (38K GIF file)]
SAPK Activity Is Induced by Intracellular Stressors but Not by cAMP
in Y1 Cells
Studies were performed to investigate the second
messenger pathways regulating SAPK activity and involved in ACTH
regulation of SAPK activity. In previous studies of cultured
hepatocytes, heat shock and tumor necrosis factor (TNF ) were
shown to induce SAPK activity 4- and 5-fold, respectively (17). When Y1
cells were treated with heat shock (42 °C) or TNF (50 ng/ml) for
15 min, SAPK activity was induced 4-fold and 5-fold, respectively (Fig.
3A). ERK activity was induced
4.5-fold by heat shock but was induced only 1.5-fold by TNF (not
shown). As cAMP is activated by ACTH, the effect of cAMP on SAPK
activity was determined. cAMP (10 3 M)
treatment was associated with a modest reduction in SAPK activity shown
at 20 min (Fig. 3B). Previous studies have demonstrated activation of the PKC pathway in ACTH-treated Y1 cells (33). To examine
whether activation of the PKC pathway induced SAPK activity, Y1 cells
were treated with the phorbol ester TPA (100 ng/ml). SAPK activity was
induced 4-fold at 15 min and 5.5-fold at 30 min (Fig. 3C).
Intracellular Ca+2 fluxes played an important role in both
angiotensin II-induced SAPK activity in liver epithelial cells (19) and
T cell activation of SAPK activity (22). To examine the role of
intracellular Ca+2 on SAPK activity in Y1 cells, the effect
of the calcium ionophore A23187 was assessed. SAPK activity was induced
4.5-fold at 15 min and 12-fold at 30 min by A23187 (60 µM) (Fig. 3D). Together these studies indicate
that several distinct intracellular stressors induce, but that cAMP
inhibits, SAPK activity in Y1 cells.
Fig. 3.
Activators of SAPK activity in Y1 cells.
Y1 cells were treated for 15 min with heat shock (42 °C) or 10 ng/ml
TNF (A), 10 3 M cAMP
(B), 10 ng/ml TPA (C), of 60 µM
A23187 (D), and SAPK assays were performed as described
under "Materials and Methods."
[View Larger Version of this Image (48K GIF file)]
PKC and Extracellular Ca+2 Are Involved in
ACTH-mediated SAPK Induction
To further investigate the secondary
messenger pathways involved in ACTH-induced SAPK activity, chemical
inhibitors of the isoquinolinesulfonamide family were used. H-8 is a
preferential and potent inhibitor of PKA (Ki 1.3 µM) compared with its effect against protein kinase C
(Ki, 15 µM) (47). Treatment of Y1
cells with the PKA inhibitor H-8 (3 µM) did not significantly affect ACTH-induced SAPK activity (Fig.
4A). At higher concentrations,
H-8 (30 µM) inhibits the PKC pathway (48), and
ACTH-induced SAPK activity was inhibited 40% by pretreatment with 30 µM H-8 (Fig. 4A, lane 4). The
isoquinolinesulfonamide H-89 preferentially inhibits PKA
(Ki, 500 nM) compared with the PKC
pathway (Ki, 76 µM). Pretreatment of
Y1 cells with 76 µM H-89 abolished SAPK induction by ACTH
(not shown).
Fig. 4.
Intracellular Ca+2 and the PKC
pathway are involved in ACTH-mediated SAPK activity. Y1 cells were
treated with 10 6 M ACTH either with or
without a pretreatment with 3 or 30 µM H-8 (A)
or 1 mM EGTA (B). Relative -fold induction was
determined by comparison with untreated cells using a
densitometer.
[View Larger Version of this Image (33K GIF file)]
Intracellular Ca+2 levels are increased in ACTH-treated Y1
cells (33). To examine the role of Ca+2 levels in
ACTH-induced SAPK activity, the Ca+2 chelating agent EGTA
was used. The increase in SAPK activity by ACTH was completely blocked
by the addition of EGTA, suggesting that the transport of
Ca+2 from the extracellular to the intracellular space may
play a role in the ACTH-induced SAPK activity (Fig. 4B,
lanes 6 and 7 versus 8). Together these studies
suggest SAPK activity is induced by the PKC pathway and that ACTH
induction of SAPK involves both the PKC and Ca+2
pathway.
Because H-8 at 3 µM did not affect SAPK induction by ACTH
and was used to inhibit PKA activity, we examined the effect of H-8 at
this concentration on cAMP-induced activity in Y1 cells. cAMP activity
was assayed using either transient reporter studies or biochemical
assays. Recent studies have demonstrated the high sensitivity of a
luciferase reporter system using the CRE to assay cAMP-regulated
activity in cultured cells (49). We therefore employed a chorionic
gonadotropin subunit reporter gene 172 LUC (42) as a
synthetic cAMP-responsive reporter to examine the cAMP pathway in Y1
cells. cAMP treatment induced the 172 LUC reporter 12-fold (Fig.
5). Pretreatment of Y1 cells with H-8 (3 µM) reduced cAMP-induced reporter activity by
approximately one-half (Fig. 5). Comparison was made with the reporter
172 m4 LUC (42) in which the CRE was mutated to abolish binding of
the cAMP-responsive element binding protein. Mutation of the CRE
reduced induction by cAMP 90% (Fig. 5), indicating the induction of
the wild type CRE reporter was a specific measure of the
cAMP/cAMP-responsive element binding protein pathway in Y1 cells.
Fig. 5.
Inhibition of PKA signaling with H-8 in Y1
cells. Y1 cells were transfected with the cAMP-responsive reporter
172 LUC or the reporter 172 m4 LUC, which is mutated in the
cAMP response element. Cells were treated with 1.5 mM
8-bromo-cAMP either with or without a 15-min pretreatment with 3 µM H-8. Inset, PKA activity determined using
biotinylated Kemptide as substrate.
[View Larger Version of this Image (27K GIF file)]
The effect of H-8 on the PKA pathway was also assessed using the
SignaTECT cAMP-dependent protein kinase A assay system.
This assay is highly specific for PKA and uses biotinylated
Kemptide as substrate. This peptide substrate is derived from the
in vivo substrate pyruvate kinase. The high affinity of
Kemptide for PKA (Km = 5-10 µM) also
provides for high sensitivity. Y1 cells were pretreated with 3 µM H-8. Assays were performed in duplicate. The
cAMP-induced PKA activity (6.2-fold) was reduced by 3 µM
H-8 to 38% that of full induction (38% ± 9, n = 6, p < 0.05). These studies indicate that 3 µM H-8 inhibits cAMP-induced PKA activity in Y1
cells.
To examine the effect of H-8 (30 µM) on the PKC pathway,
the SignaTECT protein kinase C assay system was used (50). This assay
uses biotinylated Neurogranin peptide, which is the most specific
substrate commercially available for PKC activity. Treatment of Y1
cells with TPA (100 ng/ml) for 15 min induced PKC activity 1.5-fold
(1.54 ± 0.3 pmol of ATP/min/µg of protein, n = 3), consistent with studies in other cell types. The addition of 30 µM H-8 reduced the induction of PKC activity by TPA a
mean of 65% (n = 3) (not shown). These studies
indicate that 30 µM H-8 inhibits TPA-induced PKC activity
in Y1 cells.
ACTH Induces Immediate Early Gene Expression in Vivo
The
induction of SAPK activity is thought to induce expression of immediate
early and other specific target genes. To determine whether ACTH
regulated immediate early gene expression at concentrations that
induced SAPK activity, Western blotting was performed of the adrenal
cortex from ACTH-treated animals. Because experiments in cultured
adrenal cells suggested that JunB is induced by ACTH (51), the effect
of ACTH on adrenocortical JunB protein abundance was assessed. JunB
abundance was increased 17-fold after 30 min, with a peak 40-fold
increase at 2 h, returning to basal after 12 h (Fig.
6A). c-Fos was induced
1.3-fold within 30 min, returning to basal within 6 h (data not
shown). ACTH induced c-Myc abundance 2-fold after 30 min, returning to
basal at 24 h (Fig. 6C). The Western blots, which were
loaded with equal amounts of protein, were also probed for -tubulin.
The relative abundance of -tubulin was unchanged by ACTH (Fig.
6D). The abundance of JunD was increased 1.6-fold after
6 h (Fig. 6B). Together these studies demonstrate that
ACTH treatment, at the concentrations shown to induce SAPK activity,
induces several immediate early gene products including JunB, c-Fos,
c-Myc, and JunD in vivo.
Fig. 6.
ACTH induction of immediate early gene
expression in the adrenal cortex in vivo. Western blot
analysis was performed on cellular extracts derived from the adrenal
cortex of animals treated with ACTH for the indicated time points.
Western blotting was performed using antibodies specific for JunB,
JunD, c-Myc, and -tubulin as described under "Materials and
Methods."
[View Larger Version of this Image (50K GIF file)]
ACTH Induces Immediate Early Gene Expression and Promoter Activity
in Y1 Cells
Western blot analyses were performed to determine
whether ACTH treatment of Y1 cells induced similar immediate early
genes as those induced by ACTH in vivo. The abundance of
JunB was increased after 30 min of ACTH (10 6
M) treatment, with maximal 12-fold induction at 2 h,
returning to basal levels after 24 h (Fig.
7A). JunD increased 2.4-fold by 6 h, and c-Myc was increased 2.1-fold after 3 h as
previously shown (10, 11) (data not shown).
Fig. 7.
Immediate early gene expression is induced by
ACTH in Y1 cells. Western blot analysis was performed on Y1
cellular extracts from cells treated with ACTH (10 6
M) for the designated time points. Western blotting was
performed using antibodies specific for JunB (A). In
B, Y1 cells transfected with the junBLUC reporter
were treated with ACTH for the time points indicated (shaded
bars) and compared with untreated (open bars). The time
points are from a representative experiment with n = 8 for 6 h and n = 4 for 12 h. In C
and D, Y1 cells were transfected with the reporter
constructions indicated and treated with ACTH (C) or cAMP
(D) for 6 h. In E, cotransfection
experiments were conducted with either wild type protein kinase A
catalytic subunit (PKAc) expression plasmid (45) in
conjunction with the reporter constructions detailed. Throughout, the
data is shown as the mean ± S.E. for n = separate
experiments as indicated in the figure.
[View Larger Version of this Image (30K GIF file)]
To determine whether DNA sequences sufficient for ACTH responsiveness
were located within the promoter regions of the ACTH-responsive immediate early genes (junB, c-myc, and
c-fos), the promoters of these genes were cloned and linked
to the luciferase reporter gene. ACTH induced the junBLUC
reporter 2.5-fold at 3 h and 3.6-fold at 6 h (Fig.
7B). The effect of ACTH was assessed further at 6 h for
the other immediate early gene promoters. ACTH induced
c-fosLUC activity 2.5-fold, c-mycLUC activity
2-fold, and CRELUC activity 2.4-fold (Fig. 7C).
The effect of cAMP on promoter activity was next assessed. At 6 h,
junBLUC activity was induced 2-fold, c-fosLUC reporter was not induced significantly (1.1-fold), c-mycLUC
reporter was induced 1.4-fold, and CRELUC reporter was
induced 2.6-fold (Fig. 7D). In previous studies with a
c-fos chloramphenicol acetyl transferase reporter, the cAMP
induction of the c-fos promoter in NIH-3T3 cells was rapid
and transient, returning to basal at 3 h (52). To determine
whether sustained activation of the PKA pathway could induce
c-fosLUC reporter activity, the catalytic subunit for
protein kinase A was overexpressed with the c-fosLUC reporter. Overexpression of the PKA catalytic subunit induced the
c-fosLUC reporter 10-fold and CRELUC reporter
activity 27-fold (Fig. 7E), indicating that sustained
induction of cAMP activates the c-fos promoter in Y1 cells.
In addition, as previously shown with cAMP in Y1 cells (46), the
CYP11A1 promoter was induced 3-fold by overexpression of the
PKA catalytic subunit (Fig. 7E). These studies indicate that
ACTH induces immediate early gene expression and promoter activity at
the concentrations that induced SAPK activity.
DISCUSSION
The SAPKs are preferentially phosphorylated at tyrosine and
threonine residues in response to toxins and intracellular stressors (12, 17-21), and SAPK activity appears to be involved in
differentiation and apoptosis (53-55). The role of the SAPKs in
response to stress hormones in vivo remained to be
investigated. These studies demonstrate the novel finding that ACTH
induces SAPK activity both in the rat adrenal cortex in vivo
and in cultured Y1 adrenal cells. TPA, but not cAMP, induced SAPK
activity. ACTH-induced SAPK activity was reduced by
isoquinolinesulfonyl chemical inhibitors of the PKC pathway. EGTA
blocked ACTH-induced SAPK activity, indicating a requirement for
extracellular Ca+2 in ACTH-induced SAPK activity. Together
these studies suggest that the Ca+2 and PKC pathway are
involved in ACTH-induced SAPK activity.
The induction of SAPK activity by ACTH was inhibited by either H-8 or
H-89 at concentrations that inhibited PKC activity but not at
concentrations that inhibited PKA activity. H-8 is a preferential inhibitor of PKA with a Ki for PKA of 1.2 µM and a Ki for PKC of 15 µM (47). cAMP-induced PKA activity was assayed in Y1
cells using either a cAMP-responsive reporter gene system or
biotinylated Kemptide as substrate. At 3 µM, H-8
inhibited PKA activity approximately 40-50% using either of these
systems. This concentration of H-8 did not inhibit ACTH-induced SAPK
activity in Y1 cells. PKC activity was assayed using biotinylated
Neurogranin in Y1 cells. At the higher concentration of 30 µM H-8, previously shown to inhibit PKC activity (50),
TPA-induced PKC activity was inhibited approximately 60% in Y1 cells.
SAPK induction by ACTH was also inhibited 40% by 30 µM
H-8. Together these studies suggest that ACTH induction of SAPK
involves the PKC pathway.
EGTA blocked ACTH-induced SAPK activity, suggesting a requirement for
extracellular Ca+2 in ACTH-induced SAPK activity. EGTA was
recently shown to reduce SAPK activity induced by angiotensin II in
hepatic cells, suggesting that intracellular calcium may be a common
component required for SAPK activation by these two hormones (19). The
intracellular Ca+2 chelating agent BAPTA also reduced
angiotensin II-induced SAPK activity (19) and ACTH-induced SAPK
activity by 40%.2 Calcium plays an
important role in several aspects of normal adrenal function.
ACTH-induced steroid secretion was inhibited by calcium channel
blockade in cultured bovine adrenal cells (56, 57). In Y1 cells,
ACTH-stimulated steroid secretion was enhanced by the addition of
Ca+2 and inhibited by 5 mM EGTA (58). The
extracellular concentration of calcium affects the distribution of
microfilaments and the morphological response induced by ACTH (59). In
part this may be because the calcium-binding protein, calmodulin, is
both involved in the coupling of the ACTH receptor to the adenylyl
cyclase regulatory protein and also binds to cytoskeletal proteins (7).
Together these findings indicate the importance of Ca+2 in
ACTH-induced SAPK activity and normal adrenal steroid secretion.
ACTH inhibited basal ERK activity in the rat adrenal cortex in
vivo and in cultured Y1 cells. In many circumstances, induction of
ERK activity is associated with enhanced cellular proliferation (12,
60), S-phase progression, and DNA synthesis (25). ACTH inhibits
cellular proliferation in fetal adrenal cells (61) and inhibits DNA
synthesis in Y1 cells (2). The inhibition of ERK activity by ACTH may
contribute to the inhibition of cellular proliferation and DNA
synthesis induced by ACTH (2).
Several previous studies suggested that ACTH induced
PKA-dependent and PKA-independent effects in adrenal cells.
Although both ACTH and cAMP treatment of adrenal cells induced
immediate early gene expression, the magnitude of induction and the
kinetics of immediate early gene expression were different. The
induction of c-Fos (62) and JunB (11) by ACTH was greater than that observed with cAMP treatment in Y1 cells. The induction of
c-myc expression by ACTH in rat adrenal cells was
PKC-dependent (10), and the induction of CYP11A1
mRNA in fetal adrenal cells was partially inhibited by H-7 or
staurosporine, suggesting a role for the PKC pathway (61). Our studies
provide further evidence for an intracellular signaling pathway that is
induced by ACTH and not by cAMP, as SAPK was induced by ACTH and not by
cAMP. The induction of SAPK by ACTH may contribute to some of the
differences in immediate early gene expression induced by ACTH compared
with cAMP because SAPK is thought to induce expression of immediate
early genes. SAPK is thought to induce several different immediate
early genes through phosphorylation and activation of transcription
factors including c-Fos (63), c-Jun (13), Ets family proteins (64), and
ATF-2 (65). In our studies, at least at the time points examined, the
c-fos promoter and the JunB promoters were
induced preferentially by ACTH compared with cAMP. The independent role of SAPK in ACTH-induced immediate early gene expression and the other
effects mediated by ACTH in vivo may be investigated further when specific chemical inhibitors for SAPK become available.
ACTH also stimulates rounding of cultured adrenal cortical cells and
the induction of microfilament polymerization and plasma membrane
microvilli formation that facilitates endocytosis of precursors for
steroid hormone biosynthesis (66, 67). The induction of SAPK may also
be linked to these ACTH-induced cytoskeletal changes (66, 67). Recent
studies have suggested that the small GTPase Rac1 (68, 69) is
responsible for both actin polymerization and the induction of SAPK
activity. The role of the SAPK regulatory protein Rac1 in ACTH induced
cytoskeletal changes, and steroid hormone secretion is currently under
investigation in this laboratory.
Angiotensin II, which also signals through a G-protein-coupled
receptor, was recently shown to induce SAPK activity in cultured hepatic (19) and adrenal cells (24). Our results provide further evidence that seven transmembrane G-protein-coupled receptors regulate
SAPK activity (19, 23). The rapid and sustained induction of
adrenocortical SAPK activity by ACTH in vivo suggests an
important role for SAPK in the whole animal response to stress.
FOOTNOTES
*
This work was supported in part by Grant 1R29CA70897-01 (to
R. G. P.), National Institutes of Health Cancer Center Core Grant 5-P30-CA13330-26 (to R. G. P. and C. A.), and Grant DK 20378 (to J. B. Y.). A grant supplying equipment through the Lurie Cancer Center (to R. G. P.) is gratefully acknowledged.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
Supported by a travel fellowship from the Aichi Health Promotion
Foundation, the Owari Kenyu Committee, and the Takasu Foundation.
¶
Supported by a Fulbright Fellowship.
**
To whom correspondence should be addressed: Depts. of Medicine and
Developmental and Molecular Biology, The Albert Einstein Cancer Center,
Albert Einstein College of Medicine, Golding, Room 102/3, 1300 Morris
Park Ave., Bronx, NY 10461. Tel./Fax: 718-430-8674; E-mail:
pestell{at}aecom.yu.edu.
1
The abbreviations used are: PKA, protein kinase
A; PKC, protein kinase C; TPA,
12-O-tetradecanoylphorbol-13-acetate; SAPK, stress-activated
protein kinases; ERK, extracellular signal-regulated kinase; H-8,
N-(2-(methylamino)ethyl)-5-isoquinolinesulfonamide hydrochloride; H-89,
N-(2-(p-bromocinnamyl)amino)ethyl-5-isoquinolinesulfonamide hydrochloride; MOPS, 4-morpholinepropanesulfonic acid; TNF , tumor necrosis factor ; CRE, cAMP response element; 8-bromo-cAMP,
8-bromoadenosine 3 :5 -cyclic monophosphate.
2
G. Watanabe and R. G. Pestell, unpublished
data.
ACKNOWLEDGEMENTS
We are grateful to Drs. R. Maurer and N. Hay
and E. DesJardins for plasmids, Drs. J. Richards, L. Binder, J. Avruch,
and J. Kyriakis for antibodies, and Dr. B. Schimmer for Y1 cells.
REFERENCES
-
Rae, P. A., Gutman, N. S., Tsao, J., and Schimmer, B. P.
(1979)
Proc. Natl. Acad. Sci. U. S. A.
76,
1896-1900
[Abstract/Free Full Text]
-
Wong, M., Krolcyzk, A. J., and Schimmer, B. P.
(1992)
Mol. Endocrinol.
6,
1614-1624
[Abstract/Free Full Text]
-
Halkerston, I. D.
(1975)
Adv. Cyclic Nucleotide Res.
6,
99-136
[Medline]
[Order article via Infotrieve]
-
Schimmer, B. P.
(1980)
Adv. Cyclic Nucleotide Res.
13,
181-214
[Medline]
[Order article via Infotrieve]
-
Waterman, M. R.
(1994)
J. Biol. Chem.
269,
27783-27786
[Free Full Text]
-
Vilgrain, I., Cochet, C., and Chambaz, E. M.
(1984)
J. Biol. Chem.
259,
3403-3406
[Abstract/Free Full Text]
-
Papadopoulos, V., Brown, A. S., and Hall, P. F.
(1990)
Mol. Cell. Endocrinol.
74,
109-123
[CrossRef][Medline]
[Order article via Infotrieve]
-
Bird, I. M., Walker, S. W., and Williams, B. C.
(1990)
J. Mol. Endocrinol.
5,
191-209
[Abstract/Free Full Text]
-
Bird, I. M., Smith, A. D., and Schulster, D.
(1990)
J. Lipid Mediators
2,
343-354
[Medline]
[Order article via Infotrieve]
-
Heikkila, P., Arola, J., Salmi, A., and Kahri, A. I.
(1995)
J. Endocrinol.
145,
379-385
[Abstract/Free Full Text]
-
Kimura, E., Sonobe, M. H., Armelin, M. C. S., and Armelin, H. A.
(1993)
Mol. Endocrinol.
7,
1463-1471
[Abstract/Free Full Text]
-
Cobb, M. H., and Goldsmith, E. J.
(1995)
J. Biol. Chem.
270,
14843-14846
[Free Full Text]
-
Hibi, M., Lin, A., Smeal, T., Minden, A., and Karin, M.
(1993)
Genes Dev.
7,
2135-2148
[Abstract/Free Full Text]
-
Lin, A., Smeal, T., Binetruy, B., Deng, T., Chambard, J. C., and Karin, M.
(1993)
Adv. Second Messenger Phosphoprotein Res.
28,
255-260
[Medline]
[Order article via Infotrieve]
-
Minden, A., Lin, A., McMahon, M., Lange-Carter, C., Derijard, B., Davis, R. J., Johnson, G. J., and Karin, M.
(1994)
Science.
266,
1719-1722
[Abstract/Free Full Text]
-
Minden, A., Lin, A., Smeal, T., Derijard, B., Cobb, M., Davis, R., and Karin, M.
(1994)
Mol. Cell. Biol.
14,
6683-6688
[Abstract/Free Full Text]
-
Kyriakis, J. M., Banerjee, P., Nikolakaki, E., Dai, T., Rubie, E. A., Ahmad, M. F., Avruch, J., and Woodgett, J. R.
(1994)
Nature
369,
156-160
[CrossRef][Medline]
[Order article via Infotrieve]
-
Cano, E., Hazzalan, C. A., and Mahadevan, L. C.
(1994)
Mol. Cell. Biol.
14,
7352-7362
[Abstract/Free Full Text]
-
Zohn, I. E., Xiong, H. Y., Cox, A. D., and Earp, H. S.
(1995)
Mol. Cell. Biol.
15,
6160-6168
[Abstract]
-
Yan, M., Dai, T., Deak, J. C., Kyriakis, J. M., Zon, L. I., Woodgett, J. R., and Templeton, D. J.
(1994)
Nature
372,
798-800
[Medline]
[Order article via Infotrieve]
-
Sanchez, I., Hughes, R. T., Mayer, B. J., Yee, K., Woodgett, J. R., Avruch, J., Kyriakis, J. M., and Zon, L. I.
(1994)
Nature
372,
794-798
[Medline]
[Order article via Infotrieve]
-
Su, B., Jacinto, E., Hibi, M., Kallunki, T., Karin, M., and Ben-Neriah, Y.
(1994)
Cell
77,
727-736
[CrossRef][Medline]
[Order article via Infotrieve]
-
Vara Prasad, M. V. V. S., Dermott, J. M., Heasley, L. E., Johnson, G. J., and Dhanasekaran, N.
(1995)
J. Biol. Chem.
270,
18655-18659
[Abstract/Free Full Text]
-
Watanabe, G., Lee, R. J., Albanese, C., Rainey, W. E., Batlle, D., and Pestell, R. G.
(1996)
J. Biol. Chem.
271,
22570-22577
[Abstract/Free Full Text]
-
Marshall, C. J.
(1995)
Cell
80,
179-185
[CrossRef][Medline]
[Order article via Infotrieve]
-
Burgering, B. M. T., and Bos, J. L.
(1995)
Trends Biochem. Sci.
20,
18-22
[CrossRef][Medline]
[Order article via Infotrieve]
-
Burgering, B. M. T., Pronk, G. J., van Weeren, P. C., Chardin, P., and Bos, J. L.
(1993)
Mol. Cell. Biol.
13,
7248-7256
[Abstract/Free Full Text]
-
Wu, J., Jelinek, T., Wolfman, A., Weber, M. J., and Sturgill, T. W.
(1993)
Science
262,
1065-1068
[Abstract/Free Full Text]
-
Cook, S. J., and McCormick, F.
(1993)
Science
262,
1069-1072
[Abstract/Free Full Text]
-
Frodin, M., Peraldi, P., and Van Obberghen, E.
(1994)
J. Biol. Chem.
269,
6207-6214
[Abstract/Free Full Text]
-
Das, E., Maizels, E. T., DeManno, D., St. Clair, D., Adam, S. A., and Hunzicker-Dunn, M.
(1996)
Endocrinology
137,
967-974
[Abstract]
-
Lazou, A., Bogoyevitch, M. A., Clerk, A., Fuller, S. J., Marshall, C. J., and Sugden, P. H.
(1994)
Circ. Res.
75,
932-941
[Abstract/Free Full Text]
-
Clarke, B. L., Moore, D. R., and Blalock, J. E.
(1994)
Endocrinology
135,
1780-1786
[Abstract]
-
Gagliardino, J. J., Borelli, M. I., Boschero, A. C., Rojas, E., and Atwater, I.
(1995)
Arch. Physiol. Biochem.
103,
73-78
[Medline]
[Order article via Infotrieve]
-
Izawa, T., Mochizuki, T., Komabayashi, T., Suda, K., and Tsuboi, M.
(1994)
Am. J. Physiol.
266,
E418-E426
[Abstract/Free Full Text]
-
Pestell, R. G., Albanese, C., Watanabe, G., Johnson, J., Eklund, N., Lastowiecki, P., and Jameson, J. L.
(1995)
J. Biol. Chem.
270,
18301-18308
[Abstract/Free Full Text]
-
Caceres, A., Binder, L. I., Payne, M. R., Bender, P., Rebhun, L., and Steward, O.
(1983)
J. Neurosci.
4,
394-410
[Abstract]
-
Farkash, Y., Timberg, R., and Orly, J.
(1986)
Endocrinology
118,
1353-1365
[Abstract/Free Full Text]
-
Goldring, N. B., Durica, J. M., Lifka, J., Hedin, L., Ratoosh, S. L., Miller, W. L., Orly, J., and Richards, J. S.
(1987)
Endocrinology
120,
1942-1950
[Abstract/Free Full Text]
-
Wood, W. M., Kao, M. Y., Gordon, D. F., and Ridgway, E. C.
(1989)
J. Biol. Chem.
264,
14840-14847
[Abstract/Free Full Text]
-
DesJardins, E., and Hay, N.
(1993)
Mol. Cell. Biol.
13,
5710-5724
[Abstract/Free Full Text]
-
Pestell, R. G., Hollenberg, A., Albanese, C., and Jameson, J. L.
(1994)
J. Biol. Chem.
269,
31090-31096
[Abstract/Free Full Text]
-
Pestell, R. G., Albanese, C., Watanabe, G., Lee, R. J., Lastowiecki, P., Zon, L. I., Ostrowski, M., and Jameson, J. L.
(1996)
Mol. Endocrinol.
10,
1084-1094
[Abstract/Free Full Text]
-
Sanger, F., Nicklen, S., and Coulson, A. R.
(1977)
Proc. Natl. Acad. Sci. U. S. A.
74,
5463-5467
[Abstract/Free Full Text]
-
Maurer, R. A.
(1989)
J. Biol. Chem.
264,
6870-6873
[Abstract/Free Full Text]
-
Pestell, R. G., Hammond, V., and Crawford, R.
(1993)
J. Mol. Endocrinol.
10,
297-311
[Abstract/Free Full Text]
-
Ohtsuki, M., and Massague, J.
(1992)
Mol. Cell. Biol.
12,
261-265
[Abstract/Free Full Text]
-
Findik, D., Song, Q., Hidaka, H., and Lavin, M.
(1995)
J. Cell. Biochem.
57,
12-21
[CrossRef][Medline]
[Order article via Infotrieve]
-
Christin-Maitre, S., Taylor, A. E., Khoury, R. H., Hall, J. E., Martin, K. A., Smith, P. C., Albanese, C., Jameson, J. L., Crowley, W. F. J., and Sluss, P. M.
(1996)
J. Clin. Endocrinol. Metab.
81,
2080-2088
[Abstract]
-
Goueli, B. S., Hsiao, K., Tereba, A., and Goueli, S. A.
(1995)
Anal. Biochem.
225,
10-17
[CrossRef][Medline]
[Order article via Infotrieve]
-
Viard, I., Hall, S. H., Jaillard, C., Berthelon, M. C., and Saez, J. M.
(1992)
Endocrinology
130,
1193-1200
[Abstract/Free Full Text]
-
Fisch, T. M., Prywes, R., Simon, M. C., and Roeder, R. G.
(1989)
Genes Dev.
3,
198-211
[Abstract/Free Full Text]
-
Pombo, C. M., Kehrl, J. H., Sanchez, I., Katz, P., Avruch, J., Zon, L. I., Woodgett, J. R., Force, T., and Kyriakis, J. M.
(1995)
Nature
377,
750-754
[CrossRef][Medline]
[Order article via Infotrieve]
-
Verheij, M., Bose, R., Lin, X. H., Yao, B., Jarvis, W. D., Grant, S., Birrer, M. J., Szabo, E., Zon, L. I., Kyriakis, J. M., Haimovitz-Friedman, A., Fuks, Z., and Kolesnick, R. N.
(1996)
Nature
380,
75-79
[CrossRef][Medline]
[Order article via Infotrieve]
-
Xia, Z., Dickens, M., Raineguard, J., Davis, R. J., and Greenberg, M. E.
(1995)
Science
270,
1326-1331
[Abstract/Free Full Text]
-
Rossier, M. F., Python, C. P., Capponi, A. M., Schlegel, W., Kwan, C. Y., and Vallotton, M. B.
(1993)
Endocrinology
132,
1035-1043
[Abstract/Free Full Text]
-
Barbara, J., and Takeda, K.
(1995)
J. Physiol (Lond.)
488,
609-622
[Abstract/Free Full Text]
-
Mathias, S., Wei, L., Hunter, E., Wells, O., Mgbonyebi, O., and Mrotek, J.
(1995)
Endocr. Res.
21,
121-127
[Medline]
[Order article via Infotrieve]
-
Sugihara, H., Yonemitsu, N., Yun, K., and Miyabara, S.
(1985)
Cell Struct. Funct.
10,
295-303
[Medline]
[Order article via Infotrieve]
-
Woodgett, J., Avruch, J., and Kyriakis, J.
(1995)
Clin. Exp. Pharmacol. Physiol.
22,
281-283
[Medline]
[Order article via Infotrieve]
-
Arola, J., Heikkila, P., Voutilainen, R., and Kahri, A. I.
(1994)
J. Endocrinol.
141,
285-293
[Abstract/Free Full Text]
-
Kimura, E., and Armelin, H. A.
(1990)
J. Biol. Chem.
265,
3518-3521
[Abstract/Free Full Text]
-
Cavigelli, M., Dolfi, F., Claret, F.-X., and Karin, M.
(1995)
EMBO J.
14,
5957-5964
[Medline]
[Order article via Infotrieve]
-
Whitmarsh, A. J., Shore, P., Sharrocks, A. D., and Davis, R. J.
(1995)
Science
269,
403-407
[Abstract/Free Full Text]
-
van Dam, H., Dagmar, W., Herr, I., Steffen, A., Herrlich, P., and Angel, P.
(1995)
EMBO J.
14,
1798-1811
[Medline]
[Order article via Infotrieve]
-
Hall, P.
(1995)
J. Steroid Biochem. Mol. Biol.
55,
601-605
[CrossRef][Medline]
[Order article via Infotrieve]
-
Feuilloley, M., and Vaudry, H.
(1996)
Endocr. Rev.
17,
269-288
[Abstract/Free Full Text]
-
Minden, A., Lin, A., Claret, F.-X., Abo, A., and Karin, M.
(1995)
Cell
81,
1147-1157
[CrossRef][Medline]
[Order article via Infotrieve]
-
Westwick, J. K., Lambert, Q. T., Clark, G. J., Symons, M., Van Aelst, L., Pestell, R. G., and Der, C. J.
(1997)
Mol. Cell. Biol.
17,
1324-1335
[Abstract]
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
A. Hoeflich and M. Bielohuby
Mechanisms of adrenal gland growth: signal integration by extracellular signal regulated kinases1/2
J. Mol. Endocrinol.,
March 1, 2009;
42(3):
191 - 203.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Bielohuby, M. Sawitzky, I. Johnsen, D. Wittenburg, F. Beuschlein, E. Wolf, and A. Hoeflich
Decreased p44/42 Mitogen-Activated Protein Kinase Phosphorylation in Gender- or Hormone-Related But Not during Age-Related Adrenal Gland Growth in Mice
Endocrinology,
March 1, 2009;
150(3):
1269 - 1277.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Otis, S. Campbell, M. D. Payet, and N. Gallo-Payet
In Adrenal Glomerulosa Cells, Angiotensin II Inhibits Proliferation by Interfering with Fibronectin-Integrin Signaling
Endocrinology,
July 1, 2008;
149(7):
3435 - 3445.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Doufexis, H. L. Storr, P. J. King, and A. J. L. Clark
Interaction of the melanocortin 2 receptor with nucleoporin 50: evidence for a novel pathway between a G-protein-coupled receptor and the nucleus
FASEB J,
December 1, 2007;
21(14):
4095 - 4100.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Sjottem, C. Rekdal, G. Svineng, S. S. Johnsen, H. Klenow, R. D. Uglehus, and T. Johansen
The ePHD protein SPBP interacts with TopBP1 and together they co-operate to stimulate Ets1-mediated transcription
Nucleic Acids Res.,
October 8, 2007;
35(19):
6648 - 6662.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Otis, S. Campbell, M. D Payet, and N. Gallo-Payet
Expression of extracellular matrix proteins and integrins in rat adrenal gland: importance for ACTH-associated functions
J. Endocrinol.,
June 1, 2007;
193(3):
331 - 347.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. G Ferreira, C. D Cruz, D. Neves, and D. Pignatelli
Increased extracellular signal regulated kinases phosphorylation in the adrenal gland in response to chronic ACTH treatment
J. Endocrinol.,
March 1, 2007;
192(3):
647 - 658.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Fu, M. Rao, K. Wu, C. Wang, X. Zhang, M. Hessien, Y.-G. Yeung, D. Gioeli, M. J. Weber, and R. G. Pestell
The Androgen Receptor Acetylation Site Regulates cAMP and AKT but Not ERK-induced Activity
J. Biol. Chem.,
July 9, 2004;
279(28):
29436 - 29449.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Wu, Y. Yang, C. Wang, M. A. Davoli, M. D'Amico, A. Li, K. Cveklova, Z. Kozmik, M. P. Lisanti, R. G. Russell, et al.
DACH1 Inhibits Transforming Growth Factor-{beta} Signaling through Binding Smad4
J. Biol. Chem.,
December 19, 2003;
278(51):
51673 - 51684.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Fassnacht, S. Hahner, I. A. Hansen, T. Kreutzberger, M. Zink, K. Adermann, F. Jakob, J. Troppmair, and B. Allolio
N-Terminal Proopiomelanocortin Acts as a Mitogen in Adrenocortical Tumor Cells and Decreases Adrenal Steroidogenesis
J. Clin. Endocrinol. Metab.,
May 1, 2003;
88(5):
2171 - 2179.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Bey, A. B. Gorostizaga, P. M. Maloberti, R. C. Lozano, C. Poderoso, F. C. Maciel, E. J. Podesta, and C. Paz
Adrenocorticotropin Induces Mitogen-Activated Protein Kinase Phosphatase 1 in Y1 Mouse Adrenocortical Tumor Cells
Endocrinology,
April 1, 2003;
144(4):
1399 - 1406.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X.-z. Lin, H. Takemori, Y. Katoh, J. Doi, N. Horike, A. Makino, Y. Nonaka, and M. Okamoto
Salt-Inducible Kinase Is Involved in the ACTH/cAMP-Dependent Protein Kinase Signaling in Y1 Mouse Adrenocortical Tumor Cells
Mol. Endocrinol.,
August 1, 2001;
15(8):
1264 - 1276.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Lacroix, N. N'Diaye, J. Tremblay, and P. Hamet
Ectopic and Abnormal Hormone Receptors in Adrenal Cushing's Syndrome
Endocr. Rev.,
February 1, 2001;
22(1):
75 - 110.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
P. Pena, A. T. Reutens, C. Albanese, M. DAmico, G. Watanabe, A. Donner, I-W. Shu, T. Williams, and R. G. Pestell
Activator Protein-2 Mediates Transcriptional Activation of the CYP11A1 Gene by Interaction with Sp1 Rather than Binding to DNA
Mol. Endocrinol.,
August 1, 1999;
13(8):
1402 - 1416.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
A. W. Ashton, G. Watanabe, C. Albanese, E. O. Harrington, J. A. Ware, and R. G. Pestell
Protein Kinase Cdelta Inhibition of S-Phase Transition in Capillary Endothelial Cells Involves the Cyclin-dependent Kinase Inhibitor p27Kip1
J. Biol. Chem.,
July 23, 1999;
274(30):
20805 - 20811.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. K. Westwick, R. J. Lee, Q. T. Lambert, M. Symons, R. G. Pestell, C. J. Der, and I. P. Whitehead
Transforming Potential of Dbl Family Proteins Correlates with Transcription from the Cyclin D1 Promoter but Not with Activation of Jun NH2-terminal Kinase, p38/Mpk2, Serum Response Factor, or c-Jun
J. Biol. Chem.,
July 3, 1998;
273(27):
16739 - 16747.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Rekdal, E. Sjottem, and T. Johansen
The Nuclear Factor SPBP Contains Different Functional Domains and Stimulates the Activity of Various Transcriptional Activators
J. Biol. Chem.,
December 15, 2000;
275(51):
40288 - 40300.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. L. Gyles, C. J. Burns, B. J. Whitehouse, D. Sugden, P. J. Marsh, S. J. Persaud, and P. M. Jones
ERKs Regulate Cyclic AMP-induced Steroid Synthesis through Transcription of the Steroidogenic Acute Regulatory (StAR) Gene
J. Biol. Chem.,
September 7, 2001;
276(37):
34888 - 34895.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1997 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|