Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Watanabe, G.
Right arrow Articles by Pestell, R. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Watanabe, G.
Right arrow Articles by Pestell, R. G.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 32, Issue of August 8, 1997 pp. 20063-20069
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Adrenocorticotropin Induction of Stress-activated Protein Kinase in the Adrenal Cortex in Vivo*

(Received for publication, September 12, 1996, and in revised form, May 5, 1997)

Genichi Watanabe Dagger §, Pilar Pena Dagger , Chris Albanese Dagger , Lisa D. Wilsbacher par , James B. Young par and Richard G. Pestell Dagger **

From the Dagger  Departments of Medicine and Developmental and Molecular Biology, The Albert Einstein Cancer Center, Albert Einstein College of Medicine, Bronx, New York 10461 and par  Department of Medicine, Northwestern University Medical School, Chicago, Illinois 60611

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS---
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES


ABSTRACT

A broad array of stressors induce ACTH release from the anterior pituitary, with consequent stimulation of the adrenal cortex and release of glucocorticoids critical for survival of the animal. ACTH stimulates adrenocortical gene expression in vivo and inhibits adrenocortical cell proliferation. Binding of ACTH to its G-protein-coupled receptor stimulates the production of cAMP and activation of the protein kinase A pathway. The stress-activated protein kinases (SAPKs) (or c-Jun N-terminal kinases) and the extracellular signal-regulated kinases (ERKs) are members of the mitogen-activated protein kinase family of serine/threonine kinases, which have recently been implicated in G-protein-coupled receptor intracellular signaling. The SAPKs are preferentially induced by osmotic stress and UV light, whereas the ERKs are preferentially induced by growth factors and proliferative signals in cultured cells. In these studies, ACTH stimulated SAPK activity 3-4-fold both in the adrenal cortex in vivo and in the Y1 adrenocortical cell line. 12-O-Tetradecanoylphorbol-13-acetate but not cAMP induced SAPK activity in Y1 cells. The isoquinolinesulfonamide inhibitors H-8 and H-89 blocked ACTH induction of SAPK activity at protein kinase C inhibitory doses but not at protein kinase A inhibitory doses. The calcium chelating agent EGTA inhibited ACTH-induced SAPK activity and the calcium ionophore A23187 induced SAPK activity 3-fold. In contrast with the induction of SAPK by ACTH, ERK activity was inhibited in the adrenal cortex in vivo and in Y1 adrenal cells. Together these findings suggest that ACTH induces SAPK activity through a PKC and Ca+2-dependent pathway. The induction of SAPK and inhibition of ERK by ACTH in vivo may preferentially regulate target genes involved in the adrenocortical stress responses in the whole animal.


INTRODUCTION

ACTH binds to specific G-protein (Gs)-coupled surface receptors in the adrenal cortex to induce secretion of steroid hormones critical for the normal stress response. The stimulatory guanine nucleotide-bound Gs couples to adenylate cyclase, leading to a series of signaling cascades. The acute ACTH response is associated with a rapid increase in steroid secretion and is mediated by cAMP and cAMP-dependent protein kinase A (PKA)1 (1, 2). Although ACTH stimulates an increase in cAMP formation (3-5), other secondary messengers including protein kinase C (PKC) (6), Ca+2-calmodulin-dependent protein kinase (7) and the phosphoinositol pathway (8, 9) are also induced by ACTH. Early and delayed gene expression is elicited by ACTH (5). The immediate early genes junB, c-myc, and c-fos were stimulated by ACTH in cultured adrenocortical cells (10), and c-fos and c-jun mRNAs were induced by ACTH in the Y1 adrenal cell line (11). The steroidogenic P-450 genes, including P-450 side chain cleavage (CYP11A1), are induced in a more delayed manner in both the adrenal cortex in vivo and in Y1 cells (5).

Several observations suggest that ACTH regulates PKA-independent signaling. ACTH and cAMP induced immediate early gene expression with quite different kinetics (11). The immediate early gene expression profile induced by ACTH in Y1 cells resembled the expression profile induced by stimulating the PKC pathway with phorbol esters (11). In addition, c-myc mRNA levels were induced by the PKC activator 12-O-tetradecanoylphorbol-13-acetate (TPA), and ACTH-induced c-myc expression was blocked by the PKC inhibitor H-7 in rat primary adrenal cell cultures (10).

Stimuli that activate either the PKC, the Ca+2-calmodulin-dependent protein kinase, or the phosphoinositol pathway, also induce members of the mitogen-activated protein kinase family of serine/threonine kinases (12). Mitogen-activated protein kinases include the related but distinct p54 stress-activated protein kinases (SAPKs) (or c-Jun N-terminal kinases), the p42 and p44 extracellular signal-regulated kinases (ERKs), and p38 kinases (13-17). These serine/threonine kinases activate downstream transcription factors, which in turn induce expression of target genes. A variety of environmental stressors induce SAPK activity in cultured cells, including heat shock and UV irradiation and calcium ionophores (17-22). Angiotensin II, activating mutations of G-protein-coupled receptors, and activators of the PKC pathway also induce SAPK activity (13-17, 23, 24). Relatively little is known about the regulation of the SAPK pathway in vivo. The effects of ACTH on SAPK activity were previously unknown.

ERK activity is stimulated by proliferative stimuli including growth factors and increases in intracellular Ca+2 in a cell type-specific manner (25-27). ERK activity induced by either epidermal growth factor or platelet-derived growth factor in fibroblast cell lines was inhibited by cAMP (25, 28, 29). In contrast, cAMP induced ERK activity in PC12 cells (30), rat ovarian granulosa cells (31), and cardiac myocytes (32), indicating that the effect of cAMP on ERK activity is cell type-specific.

In addition to adrenal cells, ACTH receptors are expressed on a number of different cell types including lymphocytes (33), pancreatic islet cells (34), and adipose tissue (35); thus, an understanding of intracellular signaling by ACTH may have implications in a broad array of different cell types. To understand more fully the intracellular signaling pathways governing ACTH action, we examined the effect of ACTH on the activity of the mitogen-activated protein kinases, SAPK, and ERK kinases in vivo and in cultured adrenocortical cells. Since previous studies suggested that the induction of several immediate early genes by ACTH appeared to involve mechanisms separate from the PKA pathway, we examined the regulation of immediate early gene expression and promoter activity in response to ACTH.


MATERIALS AND METHODS---

Animals and Reagents

Male CD rats (175-200 g; Charles River Laboratories, Wilmington, MA) were used for the experiments. The rats used in this study were maintained in accordance with the guidelines of the animal care committee of Northwestern University. Free-feeding rats were injected with ACTH (5 units/100 g weight; Cortrosyn, Organon, Bedford, OH) by the tail vein and sacrificed by decapitation after CO2 inhalation. Adrenals were taken at the time point indicated in the text. The adrenal cortex was dissected free from the medulla and lysed with radioimmune precipitation buffer (100 mM Tris, pH 7.5, 150 mM NaCl, 0.1% SDS, 1% Nonidet P-40, 0.1 mM Na3VO4, 0.5% deoxycholate, 0.1 mM phenylmethylsulfonyl fluroide, 1 µg/ml leupeptin), and the extracts were used for immune complex kinase assays and Western blotting. Porcine adrenocorticotropic hormone (ACTH(1-39)) (Sigma), 8-bromo-cAMP (Sigma), N-(2-(methylamino)ethyl)-5-isoquinolinesulfonamide hydrochloride (H-8), N-(2-(p-bromocinnamyl)amino)ethyl-5-isoquinolinesulfonamide hydrochloride (H-89), A23187 (Calbiochem-Novabiochem International), BAPTA (Molecular Probes, Inc. Eugene, OR), EGTA (Sigma), and TPA (Sigma) were reconstituted and stored as recommended by the manufacturer. The SignaTECT cAMP-dependent protein kinase A assay system (Promega, Madison, WI), which uses biotinylated Leu-Arg-Arg-Ala-Ser-Leu-Gly (Kemptide) as substrate, and the SignaTECT protein kinase C assay system (Promega), which uses biotinylated Ala-Ala-Lys-Ile-Gln-Ala-Ser-Phe-Arg-Gly-His-Met-Ala-Arg-Lys-Lys (Neurogranin) peptide, were used as recommended by the manufacturer.

SAPK, p42ERK, p44ERK Immune Complex Assays

Assays were performed as recently described on extracts derived from rats or cultured cells (24, 36). Staphylococcal protein A-agarose beads were incubated with anti-ERK antibody (C14, Santa Cruz Biotechnology, Santa Cruz, CA) or anti-SAPK antibody (a gift from Dr. J. Kyriakis) (17) for 1 h at 4 °C. The antibody-beads complexes were washed once with radioimmune precipitation buffer and incubated with 200 µg of extracts for a further 2 h at 4 °C. The immunoprecipitates were washed with radioimmune precipitation buffer, wash buffer (0.5 M LiCl, 0.1 M Tris-Cl, pH 8.0, 1 mM dithiothreitol, and kinase buffer (for SAPK: 20 mM MOPS, pH 7.2, 2 mM EGTA, 10 mM MgCl2, 0.1% Triton X-100, 1 mM dithiothreitol; for ERK: 25 mM HEPES, pH 7.2, 10 mM MgCl2, 10 mM MnCl2, 1 mM dithiothreitol). The reactions were performed at 30 °C for 20 min in 40 µl of kinase buffer with 10 µCi of [gamma -32P]ATP (6000 Ci/mmol, 1 Ci = 37 GBq) and 2 µg of glutathione S-transferase c-Jun (1-135) protein fragment for SAPK activity or 2 µg of myelin basic protein for ERK activity. The samples were analyzed by SDS-polyacrylamide gel electrophoresis upon termination of the reaction with Laemmli buffer and boiling. The phosphorylation of glutathione S-transferase c-Jun or myelin basic protein was quantified by densitometry using a Bio-Rad Molecular Analyst 1.1.1.

Western Blots

The cell extracts used for immunoprecipitation kinase assays were also used to quantify protein abundance of the immediate early gene and Cyp11A1 gene products. Western blotting was performed as described previously using antibodies to JunB (N-17), JunD (329), c-Fos (K-25), c-Myc (C-8, Santa Cruz Biotechnology), alpha -tubulin (5H1) (37), and the rat Cyp11A1 (38, 39). Reactive proteins were visualized by the enhanced chemiluminescence system (Amersham Life Science, Inc.). The abundance of immunoreactive protein was quantified by densitometry using a Bio-Rad Molecular Analyst 1.1.1.

Reporter Genes, Expression Vectors, and Oligodeoxyribonucleotides

The reporter c-fosLUC (24) contains the human c-fos promoter from -361 to +157 in the pA3LUC reporter (40). The junB promoter was cloned by polymerase chain reaction using oligonucleotides to the published sequences (5' GGTACCCGCGAGCCGCCTCCTCCC, 3' AAGCTTCCGGGCGGCCCAGGCGGT) and was subcloned into the reporter pA3LUC to create the reporter junBLUC. The c-myc P1/P2 promoters from -157 to +500 (41) were linked to the pA3LUC reporter to form c-mycLUC. The cAMP-responsive chorionic gonadotropin alpha  subunit promoter fragments linked to the luciferase reporter gene -846alpha LUC referred to as CRELUC and -172alpha LUC were previously described (42). The reporter plasmid -172 m4alpha LUC reporter that contains a mutation within the chorionic gonadotropin alpha  subunit cAMP response element (CRE) which abolishes cAMP responsiveness and cAMP-responsive element binding protein binding was described previously (42). The -2700-base pair ovine CYP11A1 promoter fragment linked to the luciferase reporter gene, -2700 CYPLUC, was described previously (43). The integrity of all constructs was determined by restriction enzyme analysis and dideoxy DNA sequencing (44) using an Applied Biosystems Inc. automated sequencer. The construction of the plasmid encoding the wild type and inactive mutant catalytic subunits of protein kinase A were described previously (45).

Tissue Culture

Cell culture, DNA transfection, and luciferase assays were performed as described previously (42, 46). The Y1 cell line was a gift from Dr. B. Schimmer. Y1 cells were grown in Ham's F-10 medium with 1% penicillin, streptomycin, 2.5% fetal bovine serum, and 15% horse serum. 3 × 105 cells were transfected by calcium phosphate precipitation, the medium was changed after 6 h, and luciferase activity was determined after a further 24 h (42, 46). Luciferase assays were performed using an Autolumat LB 953 (EG & G Berthold). Luciferase content was measured by calculating the light emitted during the initial 30 s of the reaction, and the values are expressed in arbitrary light units (36, 42). The percent effect was determined by comparison with its untreated activity. Statistical analyses were performed using the Mann Whitney U test.


RESULTS

SAPK Activity Is Stimulated by ACTH in the Adrenal Cortex in Vivo

To examine the effect of ACTH on adrenal cortical SAPK activity in vivo, rats were treated with intravenous ACTH. The adrenal cortex was dissected from the medulla, and immune complex kinase assays were performed using a polyclonal SAPK antibody and the amino terminus of c-Jun (amino acids 1-135) as the substrate (17, 24, 43). Adrenal cortical SAPK activity was increased 2-fold at 15 min (Fig. 1A) and 3-fold (3.1 ± 0.5, n = 5) at 30 min (Fig. 1, A and B). SAPK activity remained elevated at 1 h (3.2-fold) and at 6 h (2-fold), indicating the response to ACTH was both rapid and sustained (Fig. 1, A and B). The sustained induction of SAPK activity contrasts with the transient induction of SAPK activity we previously observed in response to growth factors (43). In control animals treated with intravenous saline, there was no increase in SAPK activity. In contrast with the induction of SAPK activity, ERK activity was reduced 40% at 30 min in the same ACTH-treated adrenal cortical extracts (data not shown).


Fig. 1. The time course of SAPK induction by ACTH in vivo. The adrenal cortical cells from ACTH-treated animals were assayed at the time points indicated. The cell extracts were immunoprecipitated using the polyclonal SAPK antibody (17), and the kinase assays were performed with treated and untreated cell extracts. Relative -fold induction was determined by comparison with untreated cells using a densitometer. The mean data ± S.E. are shown.
[View Larger Version of this Image (18K GIF file)]

SAPK Activity Is Stimulated by ACTH in Cultured Adrenocortical Y1 Cells

The effect of ACTH on SAPK and ERK activity was also determined in cultured Y1 adrenal cells. ACTH (10-6 M) treatment for 30 min stimulated SAPK activity an average of 3-fold in Y1 cells (Fig. 2A). To determine the time course of SAPK induction by ACTH in Y1 cells, treatment with ACTH was conducted for 15 min to 24 h, and the cells were harvested. SAPK activity was induced 2.5-fold (n = 6, range 1.4-4-fold) within 15 min and was sustained at 2 h (Fig. 2B), returning to baseline at 6 h (data not shown). The induction of SAPK was observed at 10-8 M and 10-10 M ACTH (Fig. 2B). SAPK activity was also induced by ACTH in the absence of serum (Fig. 2C). In contrast with the effect of ACTH on SAPK, ERK activity was reduced by ACTH treatment with a mean reduction of 45% at 30 min (Fig. 2, D and E). The inhibition of ERK activity by ACTH was observed at 10-6 M and 10-8 M ACTH (Fig. 2E).


Fig. 2. ACTH induces SAPK activity in Y1 cells. Y1 cells were treated with 10-6 M ACTH or vehicle alone for 30 min (n = 3) (A) for the time points indicated (B). The cell extracts were immunoprecipitated using the polyclonal SAPK antibody (17), and the mean data ± S.E. for n = 3 are shown in A. In C, Y1 cells were placed in serum-free medium for 24 h before the addition of ACTH, and SAPK assays were performed after 20 min of ACTH treatment. For the ERK assays (D and E), the anti-Erk antibody (C16) was used. The relative -fold induction was determined by comparison with untreated cells, and the data are the mean ± S.E. for n = 3.
[View Larger Version of this Image (38K GIF file)]

SAPK Activity Is Induced by Intracellular Stressors but Not by cAMP in Y1 Cells

Studies were performed to investigate the second messenger pathways regulating SAPK activity and involved in ACTH regulation of SAPK activity. In previous studies of cultured hepatocytes, heat shock and tumor necrosis factor alpha  (TNFalpha ) were shown to induce SAPK activity 4- and 5-fold, respectively (17). When Y1 cells were treated with heat shock (42 °C) or TNFalpha (50 ng/ml) for 15 min, SAPK activity was induced 4-fold and 5-fold, respectively (Fig. 3A). ERK activity was induced 4.5-fold by heat shock but was induced only 1.5-fold by TNFalpha (not shown). As cAMP is activated by ACTH, the effect of cAMP on SAPK activity was determined. cAMP (10-3 M) treatment was associated with a modest reduction in SAPK activity shown at 20 min (Fig. 3B). Previous studies have demonstrated activation of the PKC pathway in ACTH-treated Y1 cells (33). To examine whether activation of the PKC pathway induced SAPK activity, Y1 cells were treated with the phorbol ester TPA (100 ng/ml). SAPK activity was induced 4-fold at 15 min and 5.5-fold at 30 min (Fig. 3C). Intracellular Ca+2 fluxes played an important role in both angiotensin II-induced SAPK activity in liver epithelial cells (19) and T cell activation of SAPK activity (22). To examine the role of intracellular Ca+2 on SAPK activity in Y1 cells, the effect of the calcium ionophore A23187 was assessed. SAPK activity was induced 4.5-fold at 15 min and 12-fold at 30 min by A23187 (60 µM) (Fig. 3D). Together these studies indicate that several distinct intracellular stressors induce, but that cAMP inhibits, SAPK activity in Y1 cells.


Fig. 3. Activators of SAPK activity in Y1 cells. Y1 cells were treated for 15 min with heat shock (42 °C) or 10 ng/ml TNFalpha (A), 10-3 M cAMP (B), 10 ng/ml TPA (C), of 60 µM A23187 (D), and SAPK assays were performed as described under "Materials and Methods."
[View Larger Version of this Image (48K GIF file)]

PKC and Extracellular Ca+2 Are Involved in ACTH-mediated SAPK Induction

To further investigate the secondary messenger pathways involved in ACTH-induced SAPK activity, chemical inhibitors of the isoquinolinesulfonamide family were used. H-8 is a preferential and potent inhibitor of PKA (Ki 1.3 µM) compared with its effect against protein kinase C (Ki, 15 µM) (47). Treatment of Y1 cells with the PKA inhibitor H-8 (3 µM) did not significantly affect ACTH-induced SAPK activity (Fig. 4A). At higher concentrations, H-8 (30 µM) inhibits the PKC pathway (48), and ACTH-induced SAPK activity was inhibited 40% by pretreatment with 30 µM H-8 (Fig. 4A, lane 4). The isoquinolinesulfonamide H-89 preferentially inhibits PKA (Ki, 500 nM) compared with the PKC pathway (Ki, 76 µM). Pretreatment of Y1 cells with 76 µM H-89 abolished SAPK induction by ACTH (not shown).


Fig. 4. Intracellular Ca+2 and the PKC pathway are involved in ACTH-mediated SAPK activity. Y1 cells were treated with 10-6 M ACTH either with or without a pretreatment with 3 or 30 µM H-8 (A) or 1 mM EGTA (B). Relative -fold induction was determined by comparison with untreated cells using a densitometer.
[View Larger Version of this Image (33K GIF file)]

Intracellular Ca+2 levels are increased in ACTH-treated Y1 cells (33). To examine the role of Ca+2 levels in ACTH-induced SAPK activity, the Ca+2 chelating agent EGTA was used. The increase in SAPK activity by ACTH was completely blocked by the addition of EGTA, suggesting that the transport of Ca+2 from the extracellular to the intracellular space may play a role in the ACTH-induced SAPK activity (Fig. 4B, lanes 6 and 7 versus 8). Together these studies suggest SAPK activity is induced by the PKC pathway and that ACTH induction of SAPK involves both the PKC and Ca+2 pathway.

Because H-8 at 3 µM did not affect SAPK induction by ACTH and was used to inhibit PKA activity, we examined the effect of H-8 at this concentration on cAMP-induced activity in Y1 cells. cAMP activity was assayed using either transient reporter studies or biochemical assays. Recent studies have demonstrated the high sensitivity of a luciferase reporter system using the CRE to assay cAMP-regulated activity in cultured cells (49). We therefore employed a chorionic gonadotropin alpha  subunit reporter gene -172alpha LUC (42) as a synthetic cAMP-responsive reporter to examine the cAMP pathway in Y1 cells. cAMP treatment induced the -172alpha LUC reporter 12-fold (Fig. 5). Pretreatment of Y1 cells with H-8 (3 µM) reduced cAMP-induced reporter activity by approximately one-half (Fig. 5). Comparison was made with the reporter -172 m4alpha LUC (42) in which the CRE was mutated to abolish binding of the cAMP-responsive element binding protein. Mutation of the CRE reduced induction by cAMP 90% (Fig. 5), indicating the induction of the wild type CRE reporter was a specific measure of the cAMP/cAMP-responsive element binding protein pathway in Y1 cells.


Fig. 5. Inhibition of PKA signaling with H-8 in Y1 cells. Y1 cells were transfected with the cAMP-responsive reporter -172alpha LUC or the reporter -172 m4alpha LUC, which is mutated in the cAMP response element. Cells were treated with 1.5 mM 8-bromo-cAMP either with or without a 15-min pretreatment with 3 µM H-8. Inset, PKA activity determined using biotinylated Kemptide as substrate.
[View Larger Version of this Image (27K GIF file)]

The effect of H-8 on the PKA pathway was also assessed using the SignaTECT cAMP-dependent protein kinase A assay system. This assay is highly specific for PKA and uses biotinylated Kemptide as substrate. This peptide substrate is derived from the in vivo substrate pyruvate kinase. The high affinity of Kemptide for PKA (Km = 5-10 µM) also provides for high sensitivity. Y1 cells were pretreated with 3 µM H-8. Assays were performed in duplicate. The cAMP-induced PKA activity (6.2-fold) was reduced by 3 µM H-8 to 38% that of full induction (38% ± 9, n = 6, p < 0.05). These studies indicate that 3 µM H-8 inhibits cAMP-induced PKA activity in Y1 cells.

To examine the effect of H-8 (30 µM) on the PKC pathway, the SignaTECT protein kinase C assay system was used (50). This assay uses biotinylated Neurogranin peptide, which is the most specific substrate commercially available for PKC activity. Treatment of Y1 cells with TPA (100 ng/ml) for 15 min induced PKC activity 1.5-fold (1.54 ± 0.3 pmol of ATP/min/µg of protein, n = 3), consistent with studies in other cell types. The addition of 30 µM H-8 reduced the induction of PKC activity by TPA a mean of 65% (n = 3) (not shown). These studies indicate that 30 µM H-8 inhibits TPA-induced PKC activity in Y1 cells.

ACTH Induces Immediate Early Gene Expression in Vivo

The induction of SAPK activity is thought to induce expression of immediate early and other specific target genes. To determine whether ACTH regulated immediate early gene expression at concentrations that induced SAPK activity, Western blotting was performed of the adrenal cortex from ACTH-treated animals. Because experiments in cultured adrenal cells suggested that JunB is induced by ACTH (51), the effect of ACTH on adrenocortical JunB protein abundance was assessed. JunB abundance was increased 17-fold after 30 min, with a peak 40-fold increase at 2 h, returning to basal after 12 h (Fig. 6A). c-Fos was induced 1.3-fold within 30 min, returning to basal within 6 h (data not shown). ACTH induced c-Myc abundance 2-fold after 30 min, returning to basal at 24 h (Fig. 6C). The Western blots, which were loaded with equal amounts of protein, were also probed for alpha -tubulin. The relative abundance of alpha -tubulin was unchanged by ACTH (Fig. 6D). The abundance of JunD was increased 1.6-fold after 6 h (Fig. 6B). Together these studies demonstrate that ACTH treatment, at the concentrations shown to induce SAPK activity, induces several immediate early gene products including JunB, c-Fos, c-Myc, and JunD in vivo.


Fig. 6. ACTH induction of immediate early gene expression in the adrenal cortex in vivo. Western blot analysis was performed on cellular extracts derived from the adrenal cortex of animals treated with ACTH for the indicated time points. Western blotting was performed using antibodies specific for JunB, JunD, c-Myc, and alpha -tubulin as described under "Materials and Methods."
[View Larger Version of this Image (50K GIF file)]

ACTH Induces Immediate Early Gene Expression and Promoter Activity in Y1 Cells

Western blot analyses were performed to determine whether ACTH treatment of Y1 cells induced similar immediate early genes as those induced by ACTH in vivo. The abundance of JunB was increased after 30 min of ACTH (10-6 M) treatment, with maximal 12-fold induction at 2 h, returning to basal levels after 24 h (Fig. 7A). JunD increased 2.4-fold by 6 h, and c-Myc was increased 2.1-fold after 3 h as previously shown (10, 11) (data not shown).


Fig. 7. Immediate early gene expression is induced by ACTH in Y1 cells. Western blot analysis was performed on Y1 cellular extracts from cells treated with ACTH (10-6 M) for the designated time points. Western blotting was performed using antibodies specific for JunB (A). In B, Y1 cells transfected with the junBLUC reporter were treated with ACTH for the time points indicated (shaded bars) and compared with untreated (open bars). The time points are from a representative experiment with n = 8 for 6 h and n = 4 for 12 h. In C and D, Y1 cells were transfected with the reporter constructions indicated and treated with ACTH (C) or cAMP (D) for 6 h. In E, cotransfection experiments were conducted with either wild type protein kinase A catalytic subunit (PKAc) expression plasmid (45) in conjunction with the reporter constructions detailed. Throughout, the data is shown as the mean ± S.E. for n = separate experiments as indicated in the figure.
[View Larger Version of this Image (30K GIF file)]

To determine whether DNA sequences sufficient for ACTH responsiveness were located within the promoter regions of the ACTH-responsive immediate early genes (junB, c-myc, and c-fos), the promoters of these genes were cloned and linked to the luciferase reporter gene. ACTH induced the junBLUC reporter 2.5-fold at 3 h and 3.6-fold at 6 h (Fig. 7B). The effect of ACTH was assessed further at 6 h for the other immediate early gene promoters. ACTH induced c-fosLUC activity 2.5-fold, c-mycLUC activity 2-fold, and CRELUC activity 2.4-fold (Fig. 7C). The effect of cAMP on promoter activity was next assessed. At 6 h, junBLUC activity was induced 2-fold, c-fosLUC reporter was not induced significantly (1.1-fold), c-mycLUC reporter was induced 1.4-fold, and CRELUC reporter was induced 2.6-fold (Fig. 7D). In previous studies with a c-fos chloramphenicol acetyl transferase reporter, the cAMP induction of the c-fos promoter in NIH-3T3 cells was rapid and transient, returning to basal at 3 h (52). To determine whether sustained activation of the PKA pathway could induce c-fosLUC reporter activity, the catalytic subunit for protein kinase A was overexpressed with the c-fosLUC reporter. Overexpression of the PKA catalytic subunit induced the c-fosLUC reporter 10-fold and CRELUC reporter activity 27-fold (Fig. 7E), indicating that sustained induction of cAMP activates the c-fos promoter in Y1 cells. In addition, as previously shown with cAMP in Y1 cells (46), the CYP11A1 promoter was induced 3-fold by overexpression of the PKA catalytic subunit (Fig. 7E). These studies indicate that ACTH induces immediate early gene expression and promoter activity at the concentrations that induced SAPK activity.


DISCUSSION

The SAPKs are preferentially phosphorylated at tyrosine and threonine residues in response to toxins and intracellular stressors (12, 17-21), and SAPK activity appears to be involved in differentiation and apoptosis (53-55). The role of the SAPKs in response to stress hormones in vivo remained to be investigated. These studies demonstrate the novel finding that ACTH induces SAPK activity both in the rat adrenal cortex in vivo and in cultured Y1 adrenal cells. TPA, but not cAMP, induced SAPK activity. ACTH-induced SAPK activity was reduced by isoquinolinesulfonyl chemical inhibitors of the PKC pathway. EGTA blocked ACTH-induced SAPK activity, indicating a requirement for extracellular Ca+2 in ACTH-induced SAPK activity. Together these studies suggest that the Ca+2 and PKC pathway are involved in ACTH-induced SAPK activity.

The induction of SAPK activity by ACTH was inhibited by either H-8 or H-89 at concentrations that inhibited PKC activity but not at concentrations that inhibited PKA activity. H-8 is a preferential inhibitor of PKA with a Ki for PKA of 1.2 µM and a Ki for PKC of 15 µM (47). cAMP-induced PKA activity was assayed in Y1 cells using either a cAMP-responsive reporter gene system or biotinylated Kemptide as substrate. At 3 µM, H-8 inhibited PKA activity approximately 40-50% using either of these systems. This concentration of H-8 did not inhibit ACTH-induced SAPK activity in Y1 cells. PKC activity was assayed using biotinylated Neurogranin in Y1 cells. At the higher concentration of 30 µM H-8, previously shown to inhibit PKC activity (50), TPA-induced PKC activity was inhibited approximately 60% in Y1 cells. SAPK induction by ACTH was also inhibited 40% by 30 µM H-8. Together these studies suggest that ACTH induction of SAPK involves the PKC pathway.

EGTA blocked ACTH-induced SAPK activity, suggesting a requirement for extracellular Ca+2 in ACTH-induced SAPK activity. EGTA was recently shown to reduce SAPK activity induced by angiotensin II in hepatic cells, suggesting that intracellular calcium may be a common component required for SAPK activation by these two hormones (19). The intracellular Ca+2 chelating agent BAPTA also reduced angiotensin II-induced SAPK activity (19) and ACTH-induced SAPK activity by 40%.2 Calcium plays an important role in several aspects of normal adrenal function. ACTH-induced steroid secretion was inhibited by calcium channel blockade in cultured bovine adrenal cells (56, 57). In Y1 cells, ACTH-stimulated steroid secretion was enhanced by the addition of Ca+2 and inhibited by 5 mM EGTA (58). The extracellular concentration of calcium affects the distribution of microfilaments and the morphological response induced by ACTH (59). In part this may be because the calcium-binding protein, calmodulin, is both involved in the coupling of the ACTH receptor to the adenylyl cyclase regulatory protein and also binds to cytoskeletal proteins (7). Together these findings indicate the importance of Ca+2 in ACTH-induced SAPK activity and normal adrenal steroid secretion.

ACTH inhibited basal ERK activity in the rat adrenal cortex in vivo and in cultured Y1 cells. In many circumstances, induction of ERK activity is associated with enhanced cellular proliferation (12, 60), S-phase progression, and DNA synthesis (25). ACTH inhibits cellular proliferation in fetal adrenal cells (61) and inhibits DNA synthesis in Y1 cells (2). The inhibition of ERK activity by ACTH may contribute to the inhibition of cellular proliferation and DNA synthesis induced by ACTH (2).

Several previous studies suggested that ACTH induced PKA-dependent and PKA-independent effects in adrenal cells. Although both ACTH and cAMP treatment of adrenal cells induced immediate early gene expression, the magnitude of induction and the kinetics of immediate early gene expression were different. The induction of c-Fos (62) and JunB (11) by ACTH was greater than that observed with cAMP treatment in Y1 cells. The induction of c-myc expression by ACTH in rat adrenal cells was PKC-dependent (10), and the induction of CYP11A1 mRNA in fetal adrenal cells was partially inhibited by H-7 or staurosporine, suggesting a role for the PKC pathway (61). Our studies provide further evidence for an intracellular signaling pathway that is induced by ACTH and not by cAMP, as SAPK was induced by ACTH and not by cAMP. The induction of SAPK by ACTH may contribute to some of the differences in immediate early gene expression induced by ACTH compared with cAMP because SAPK is thought to induce expression of immediate early genes. SAPK is thought to induce several different immediate early genes through phosphorylation and activation of transcription factors including c-Fos (63), c-Jun (13), Ets family proteins (64), and ATF-2 (65). In our studies, at least at the time points examined, the c-fos promoter and the JunB promoters were induced preferentially by ACTH compared with cAMP. The independent role of SAPK in ACTH-induced immediate early gene expression and the other effects mediated by ACTH in vivo may be investigated further when specific chemical inhibitors for SAPK become available.

ACTH also stimulates rounding of cultured adrenal cortical cells and the induction of microfilament polymerization and plasma membrane microvilli formation that facilitates endocytosis of precursors for steroid hormone biosynthesis (66, 67). The induction of SAPK may also be linked to these ACTH-induced cytoskeletal changes (66, 67). Recent studies have suggested that the small GTPase Rac1 (68, 69) is responsible for both actin polymerization and the induction of SAPK activity. The role of the SAPK regulatory protein Rac1 in ACTH induced cytoskeletal changes, and steroid hormone secretion is currently under investigation in this laboratory.

Angiotensin II, which also signals through a G-protein-coupled receptor, was recently shown to induce SAPK activity in cultured hepatic (19) and adrenal cells (24). Our results provide further evidence that seven transmembrane G-protein-coupled receptors regulate SAPK activity (19, 23). The rapid and sustained induction of adrenocortical SAPK activity by ACTH in vivo suggests an important role for SAPK in the whole animal response to stress.


FOOTNOTES

*   This work was supported in part by Grant 1R29CA70897-01 (to R. G. P.), National Institutes of Health Cancer Center Core Grant 5-P30-CA13330-26 (to R. G. P. and C. A.), and Grant DK 20378 (to J. B. Y.). A grant supplying equipment through the Lurie Cancer Center (to R. G. P.) is gratefully acknowledged.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§   Supported by a travel fellowship from the Aichi Health Promotion Foundation, the Owari Kenyu Committee, and the Takasu Foundation.
   Supported by a Fulbright Fellowship.
**   To whom correspondence should be addressed: Depts. of Medicine and Developmental and Molecular Biology, The Albert Einstein Cancer Center, Albert Einstein College of Medicine, Golding, Room 102/3, 1300 Morris Park Ave., Bronx, NY 10461. Tel./Fax: 718-430-8674; E-mail: pestell{at}aecom.yu.edu.
1   The abbreviations used are: PKA, protein kinase A; PKC, protein kinase C; TPA, 12-O-tetradecanoylphorbol-13-acetate; SAPK, stress-activated protein kinases; ERK, extracellular signal-regulated kinase; H-8, N-(2-(methylamino)ethyl)-5-isoquinolinesulfonamide hydrochloride; H-89, N-(2-(p-bromocinnamyl)amino)ethyl-5-isoquinolinesulfonamide hydrochloride; MOPS, 4-morpholinepropanesulfonic acid; TNFalpha , tumor necrosis factor alpha ; CRE, cAMP response element; 8-bromo-cAMP, 8-bromoadenosine 3':5'-cyclic monophosphate.
2   G. Watanabe and R. G. Pestell, unpublished data.

ACKNOWLEDGEMENTS

We are grateful to Drs. R. Maurer and N. Hay and E. DesJardins for plasmids, Drs. J. Richards, L. Binder, J. Avruch, and J. Kyriakis for antibodies, and Dr. B. Schimmer for Y1 cells.


REFERENCES

  1. Rae, P. A., Gutman, N. S., Tsao, J., and Schimmer, B. P. (1979) Proc. Natl. Acad. Sci. U. S. A. 76, 1896-1900 [Abstract/Free Full Text]
  2. Wong, M., Krolcyzk, A. J., and Schimmer, B. P. (1992) Mol. Endocrinol. 6, 1614-1624 [Abstract/Free Full Text]
  3. Halkerston, I. D. (1975) Adv. Cyclic Nucleotide Res. 6, 99-136 [Medline] [Order article via Infotrieve]
  4. Schimmer, B. P. (1980) Adv. Cyclic Nucleotide Res. 13, 181-214 [Medline] [Order article via Infotrieve]
  5. Waterman, M. R. (1994) J. Biol. Chem. 269, 27783-27786 [Free Full Text]
  6. Vilgrain, I., Cochet, C., and Chambaz, E. M. (1984) J. Biol. Chem. 259, 3403-3406 [Abstract/Free Full Text]
  7. Papadopoulos, V., Brown, A. S., and Hall, P. F. (1990) Mol. Cell. Endocrinol. 74, 109-123 [CrossRef][Medline] [Order article via Infotrieve]
  8. Bird, I. M., Walker, S. W., and Williams, B. C. (1990) J. Mol. Endocrinol. 5, 191-209 [Abstract/Free Full Text]
  9. Bird, I. M., Smith, A. D., and Schulster, D. (1990) J. Lipid Mediators 2, 343-354 [Medline] [Order article via Infotrieve]
  10. Heikkila, P., Arola, J., Salmi, A., and Kahri, A. I. (1995) J. Endocrinol. 145, 379-385 [Abstract/Free Full Text]
  11. Kimura, E., Sonobe, M. H., Armelin, M. C. S., and Armelin, H. A. (1993) Mol. Endocrinol. 7, 1463-1471 [Abstract/Free Full Text]
  12. Cobb, M. H., and Goldsmith, E. J. (1995) J. Biol. Chem. 270, 14843-14846 [Free Full Text]
  13. Hibi, M., Lin, A., Smeal, T., Minden, A., and Karin, M. (1993) Genes Dev. 7, 2135-2148 [Abstract/Free Full Text]
  14. Lin, A., Smeal, T., Binetruy, B., Deng, T., Chambard, J. C., and Karin, M. (1993) Adv. Second Messenger Phosphoprotein Res. 28, 255-260 [Medline] [Order article via Infotrieve]
  15. Minden, A., Lin, A., McMahon, M., Lange-Carter, C., Derijard, B., Davis, R. J., Johnson, G. J., and Karin, M. (1994) Science. 266, 1719-1722 [Abstract/Free Full Text]
  16. Minden, A., Lin, A., Smeal, T., Derijard, B., Cobb, M., Davis, R., and Karin, M. (1994) Mol. Cell. Biol. 14, 6683-6688 [Abstract/Free Full Text]
  17. Kyriakis, J. M., Banerjee, P., Nikolakaki, E., Dai, T., Rubie, E. A., Ahmad, M. F., Avruch, J., and Woodgett, J. R. (1994) Nature 369, 156-160 [CrossRef][Medline] [Order article via Infotrieve]
  18. Cano, E., Hazzalan, C. A., and Mahadevan, L. C. (1994) Mol. Cell. Biol. 14, 7352-7362 [Abstract/Free Full Text]
  19. Zohn, I. E., Xiong, H. Y., Cox, A. D., and Earp, H. S. (1995) Mol. Cell. Biol. 15, 6160-6168 [Abstract]
  20. Yan, M., Dai, T., Deak, J. C., Kyriakis, J. M., Zon, L. I., Woodgett, J. R., and Templeton, D. J. (1994) Nature 372, 798-800 [Medline] [Order article via Infotrieve]
  21. Sanchez, I., Hughes, R. T., Mayer, B. J., Yee, K., Woodgett, J. R., Avruch, J., Kyriakis, J. M., and Zon, L. I. (1994) Nature 372, 794-798 [Medline] [Order article via Infotrieve]
  22. Su, B., Jacinto, E., Hibi, M., Kallunki, T., Karin, M., and Ben-Neriah, Y. (1994) Cell 77, 727-736 [CrossRef][Medline] [Order article via Infotrieve]
  23. Vara Prasad, M. V. V. S., Dermott, J. M., Heasley, L. E., Johnson, G. J., and Dhanasekaran, N. (1995) J. Biol. Chem. 270, 18655-18659 [Abstract/Free Full Text]
  24. Watanabe, G., Lee, R. J., Albanese, C., Rainey, W. E., Batlle, D., and Pestell, R. G. (1996) J. Biol. Chem. 271, 22570-22577 [Abstract/Free Full Text]
  25. Marshall, C. J. (1995) Cell 80, 179-185 [CrossRef][Medline] [Order article via Infotrieve]
  26. Burgering, B. M. T., and Bos, J. L. (1995) Trends Biochem. Sci. 20, 18-22 [CrossRef][Medline] [Order article via Infotrieve]
  27. Burgering, B. M. T., Pronk, G. J., van Weeren, P. C., Chardin, P., and Bos, J. L. (1993) Mol. Cell. Biol. 13, 7248-7256 [Abstract/Free Full Text]
  28. Wu, J., Jelinek, T., Wolfman, A., Weber, M. J., and Sturgill, T. W. (1993) Science 262, 1065-1068 [Abstract/Free Full Text]
  29. Cook, S. J., and McCormick, F. (1993) Science 262, 1069-1072 [Abstract/Free Full Text]
  30. Frodin, M., Peraldi, P., and Van Obberghen, E. (1994) J. Biol. Chem. 269, 6207-6214 [Abstract/Free Full Text]
  31. Das, E., Maizels, E. T., DeManno, D., St. Clair, D., Adam, S. A., and Hunzicker-Dunn, M. (1996) Endocrinology 137, 967-974 [Abstract]
  32. Lazou, A., Bogoyevitch, M. A., Clerk, A., Fuller, S. J., Marshall, C. J., and Sugden, P. H. (1994) Circ. Res. 75, 932-941 [Abstract/Free Full Text]
  33. Clarke, B. L., Moore, D. R., and Blalock, J. E. (1994) Endocrinology 135, 1780-1786 [Abstract]
  34. Gagliardino, J. J., Borelli, M. I., Boschero, A. C., Rojas, E., and Atwater, I. (1995) Arch. Physiol. Biochem. 103, 73-78 [Medline] [Order article via Infotrieve]
  35. Izawa, T., Mochizuki, T., Komabayashi, T., Suda, K., and Tsuboi, M. (1994) Am. J. Physiol. 266, E418-E426 [Abstract/Free Full Text]
  36. Pestell, R. G., Albanese, C., Watanabe, G., Johnson, J., Eklund, N., Lastowiecki, P., and Jameson, J. L. (1995) J. Biol. Chem. 270, 18301-18308 [Abstract/Free Full Text]
  37. Caceres, A., Binder, L. I., Payne, M. R., Bender, P., Rebhun, L., and Steward, O. (1983) J. Neurosci. 4, 394-410 [Abstract]
  38. Farkash, Y., Timberg, R., and Orly, J. (1986) Endocrinology 118, 1353-1365 [Abstract/Free Full Text]
  39. Goldring, N. B., Durica, J. M., Lifka, J., Hedin, L., Ratoosh, S. L., Miller, W. L., Orly, J., and Richards, J. S. (1987) Endocrinology 120, 1942-1950 [Abstract/Free Full Text]
  40. Wood, W. M., Kao, M. Y., Gordon, D. F., and Ridgway, E. C. (1989) J. Biol. Chem. 264, 14840-14847 [Abstract/Free Full Text]
  41. DesJardins, E., and Hay, N. (1993) Mol. Cell. Biol. 13, 5710-5724 [Abstract/Free Full Text]
  42. Pestell, R. G., Hollenberg, A., Albanese, C., and Jameson, J. L. (1994) J. Biol. Chem. 269, 31090-31096 [Abstract/Free Full Text]
  43. Pestell, R. G., Albanese, C., Watanabe, G., Lee, R. J., Lastowiecki, P., Zon, L. I., Ostrowski, M., and Jameson, J. L. (1996) Mol. Endocrinol. 10, 1084-1094 [Abstract/Free Full Text]
  44. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A. 74, 5463-5467 [Abstract/Free Full Text]
  45. Maurer, R. A. (1989) J. Biol. Chem. 264, 6870-6873 [Abstract/Free Full Text]
  46. Pestell, R. G., Hammond, V., and Crawford, R. (1993) J. Mol. Endocrinol. 10, 297-311 [Abstract/Free Full Text]
  47. Ohtsuki, M., and Massague, J. (1992) Mol. Cell. Biol. 12, 261-265 [Abstract/Free Full Text]
  48. Findik, D., Song, Q., Hidaka, H., and Lavin, M. (1995) J. Cell. Biochem. 57, 12-21 [CrossRef][Medline] [Order article via Infotrieve]
  49. Christin-Maitre, S., Taylor, A. E., Khoury, R. H., Hall, J. E., Martin, K. A., Smith, P. C., Albanese, C., Jameson, J. L., Crowley, W. F. J., and Sluss, P. M. (1996) J. Clin. Endocrinol. Metab. 81, 2080-2088 [Abstract]
  50. Goueli, B. S., Hsiao, K., Tereba, A., and Goueli, S. A. (1995) Anal. Biochem. 225, 10-17 [CrossRef][Medline] [Order article via Infotrieve]
  51. Viard, I., Hall, S. H., Jaillard, C., Berthelon, M. C., and Saez, J. M. (1992) Endocrinology 130, 1193-1200 [Abstract/Free Full Text]
  52. Fisch, T. M., Prywes, R., Simon, M. C., and Roeder, R. G. (1989) Genes Dev. 3, 198-211 [Abstract/Free Full Text]
  53. Pombo, C. M., Kehrl, J. H., Sanchez, I., Katz, P., Avruch, J., Zon, L. I., Woodgett, J. R., Force, T., and Kyriakis, J. M. (1995) Nature 377, 750-754 [CrossRef][Medline] [Order article via Infotrieve]
  54. Verheij, M., Bose, R., Lin, X. H., Yao, B., Jarvis, W. D., Grant, S., Birrer, M. J., Szabo, E., Zon, L. I., Kyriakis, J. M., Haimovitz-Friedman, A., Fuks, Z., and Kolesnick, R. N. (1996) Nature 380, 75-79 [CrossRef][Medline] [Order article via Infotrieve]
  55. Xia, Z., Dickens, M., Raineguard, J., Davis, R. J., and Greenberg, M. E. (1995) Science 270, 1326-1331 [Abstract/Free Full Text]
  56. Rossier, M. F., Python, C. P., Capponi, A. M., Schlegel, W., Kwan, C. Y., and Vallotton, M. B. (1993) Endocrinology 132, 1035-1043 [Abstract/Free Full Text]
  57. Barbara, J., and Takeda, K. (1995) J. Physiol (Lond.) 488, 609-622 [Abstract/Free Full Text]
  58. Mathias, S., Wei, L., Hunter, E., Wells, O., Mgbonyebi, O., and Mrotek, J. (1995) Endocr. Res. 21, 121-127 [Medline] [Order article via Infotrieve]
  59. Sugihara, H., Yonemitsu, N., Yun, K., and Miyabara, S. (1985) Cell Struct. Funct. 10, 295-303 [Medline] [Order article via Infotrieve]
  60. Woodgett, J., Avruch, J., and Kyriakis, J. (1995) Clin. Exp. Pharmacol. Physiol. 22, 281-283 [Medline] [Order article via Infotrieve]
  61. Arola, J., Heikkila, P., Voutilainen, R., and Kahri, A. I. (1994) J. Endocrinol. 141, 285-293 [Abstract/Free Full Text]
  62. Kimura, E., and Armelin, H. A. (1990) J. Biol. Chem. 265, 3518-3521 [Abstract/Free Full Text]
  63. Cavigelli, M., Dolfi, F., Claret, F.-X., and Karin, M. (1995) EMBO J. 14, 5957-5964 [Medline] [Order article via Infotrieve]
  64. Whitmarsh, A. J., Shore, P., Sharrocks, A. D., and Davis, R. J. (1995) Science 269, 403-407 [Abstract/Free Full Text]
  65. van Dam, H., Dagmar, W., Herr, I., Steffen, A., Herrlich, P., and Angel, P. (1995) EMBO J. 14, 1798-1811 [Medline] [Order article via Infotrieve]
  66. Hall, P. (1995) J. Steroid Biochem. Mol. Biol. 55, 601-605 [CrossRef][Medline] [Order article via Infotrieve]
  67. Feuilloley, M., and Vaudry, H. (1996) Endocr. Rev. 17, 269-288 [Abstract/Free Full Text]
  68. Minden, A., Lin, A., Claret, F.-X., Abo, A., and Karin, M. (1995) Cell 81, 1147-1157 [CrossRef][Medline] [Order article via Infotrieve]
  69. Westwick, J. K., Lambert, Q. T., Clark, G. J., Symons, M., Van Aelst, L., Pestell, R. G., and Der, C. J. (1997) Mol. Cell. Biol. 17, 1324-1335 [Abstract]

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J Mol EndocrinolHome page
A. Hoeflich and M. Bielohuby
Mechanisms of adrenal gland growth: signal integration by extracellular signal regulated kinases1/2
J. Mol. Endocrinol., March 1, 2009; 42(3): 191 - 203.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Bielohuby, M. Sawitzky, I. Johnsen, D. Wittenburg, F. Beuschlein, E. Wolf, and A. Hoeflich
Decreased p44/42 Mitogen-Activated Protein Kinase Phosphorylation in Gender- or Hormone-Related But Not during Age-Related Adrenal Gland Growth in Mice
Endocrinology, March 1, 2009; 150(3): 1269 - 1277.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Otis, S. Campbell, M. D. Payet, and N. Gallo-Payet
In Adrenal Glomerulosa Cells, Angiotensin II Inhibits Proliferation by Interfering with Fibronectin-Integrin Signaling
Endocrinology, July 1, 2008; 149(7): 3435 - 3445.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
M. Doufexis, H. L. Storr, P. J. King, and A. J. L. Clark
Interaction of the melanocortin 2 receptor with nucleoporin 50: evidence for a novel pathway between a G-protein-coupled receptor and the nucleus
FASEB J, December 1, 2007; 21(14): 4095 - 4100.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
E. Sjottem, C. Rekdal, G. Svineng, S. S. Johnsen, H. Klenow, R. D. Uglehus, and T. Johansen
The ePHD protein SPBP interacts with TopBP1 and together they co-operate to stimulate Ets1-mediated transcription
Nucleic Acids Res., October 8, 2007; 35(19): 6648 - 6662.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
M. Otis, S. Campbell, M. D Payet, and N. Gallo-Payet
Expression of extracellular matrix proteins and integrins in rat adrenal gland: importance for ACTH-associated functions
J. Endocrinol., June 1, 2007; 193(3): 331 - 347.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
J. G Ferreira, C. D Cruz, D. Neves, and D. Pignatelli
Increased extracellular signal regulated kinases phosphorylation in the adrenal gland in response to chronic ACTH treatment
J. Endocrinol., March 1, 2007; 192(3): 647 - 658.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Fu, M. Rao, K. Wu, C. Wang, X. Zhang, M. Hessien, Y.-G. Yeung, D. Gioeli, M. J. Weber, and R. G. Pestell
The Androgen Receptor Acetylation Site Regulates cAMP and AKT but Not ERK-induced Activity
J. Biol. Chem., July 9, 2004; 279(28): 29436 - 29449.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Wu, Y. Yang, C. Wang, M. A. Davoli, M. D'Amico, A. Li, K. Cveklova, Z. Kozmik, M. P. Lisanti, R. G. Russell, et al.
DACH1 Inhibits Transforming Growth Factor-{beta} Signaling through Binding Smad4
J. Biol. Chem., December 19, 2003; 278(51): 51673 - 51684.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Fassnacht, S. Hahner, I. A. Hansen, T. Kreutzberger, M. Zink, K. Adermann, F. Jakob, J. Troppmair, and B. Allolio
N-Terminal Proopiomelanocortin Acts as a Mitogen in Adrenocortical Tumor Cells and Decreases Adrenal Steroidogenesis
J. Clin. Endocrinol. Metab., May 1, 2003; 88(5): 2171 - 2179.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
P. Bey, A. B. Gorostizaga, P. M. Maloberti, R. C. Lozano, C. Poderoso, F. C. Maciel, E. J. Podesta, and C. Paz
Adrenocorticotropin Induces Mitogen-Activated Protein Kinase Phosphatase 1 in Y1 Mouse Adrenocortical Tumor Cells
Endocrinology, April 1, 2003; 144(4): 1399 - 1406.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
X.-z. Lin, H. Takemori, Y. Katoh, J. Doi, N. Horike, A. Makino, Y. Nonaka, and M. Okamoto
Salt-Inducible Kinase Is Involved in the ACTH/cAMP-Dependent Protein Kinase Signaling in Y1 Mouse Adrenocortical Tumor Cells
Mol. Endocrinol., August 1, 2001; 15(8): 1264 - 1276.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
A. Lacroix, N. N'Diaye, J. Tremblay, and P. Hamet
Ectopic and Abnormal Hormone Receptors in Adrenal Cushing's Syndrome
Endocr. Rev., February 1, 2001; 22(1): 75 - 110.
[Abstract] [Full Text]


Home page
Mol. Endocrinol.Home page
P. Pena, A. T. Reutens, C. Albanese, M. D’Amico, G. Watanabe, A. Donner, I-W. Shu, T. Williams, and R. G. Pestell
Activator Protein-2 Mediates Transcriptional Activation of the CYP11A1 Gene by Interaction with Sp1 Rather than Binding to DNA
Mol. Endocrinol., August 1, 1999; 13(8): 1402 - 1416.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
A. W. Ashton, G. Watanabe, C. Albanese, E. O. Harrington, J. A. Ware, and R. G. Pestell
Protein Kinase Cdelta Inhibition of S-Phase Transition in Capillary Endothelial Cells Involves the Cyclin-dependent Kinase Inhibitor p27Kip1
J. Biol. Chem., July 23, 1999; 274(30): 20805 - 20811.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. K. Westwick, R. J. Lee, Q. T. Lambert, M. Symons, R. G. Pestell, C. J. Der, and I. P. Whitehead
Transforming Potential of Dbl Family Proteins Correlates with Transcription from the Cyclin D1 Promoter but Not with Activation of Jun NH2-terminal Kinase, p38/Mpk2, Serum Response Factor, or c-Jun
J. Biol. Chem., July 3, 1998; 273(27): 16739 - 16747.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Rekdal, E. Sjottem, and T. Johansen
The Nuclear Factor SPBP Contains Different Functional Domains and Stimulates the Activity of Various Transcriptional Activators
J. Biol. Chem., December 15, 2000; 275(51): 40288 - 40300.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. L. Gyles, C. J. Burns, B. J. Whitehouse, D. Sugden, P. J. Marsh, S. J. Persaud, and P. M. Jones
ERKs Regulate Cyclic AMP-induced Steroid Synthesis through Transcription of the Steroidogenic Acute Regulatory (StAR) Gene
J. Biol. Chem., September 7, 2001; 276(37): 34888 - 34895.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Watanabe, G.
Right arrow Articles by Pestell, R. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Watanabe, G.
Right arrow Articles by Pestell, R. G.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1997 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement