INTRODUCTION

ACTH binds to specific G-protein (Gs)-coupled surface receptors in the adrenal cortex to induce secretion of steroid hormones critical for the normal stress response. The stimulatory guanine nucleotide-bound Gs couples to adenylate cyclase, leading to a series of signaling cascades. The acute ACTH response is associated with a rapid increase in steroid secretion and is mediated by cAMP and cAMP-dependent protein kinase A (PKA)¹ (1, 2). Although ACTH stimulates an increase in cAMP formation (3-5), other secondary messengers including protein kinase C (PKC) (6), Ca⁺²-calmodulin-dependent protein kinase (7) and the phosphoinositol pathway (8, 9) are also induced by ACTH. Early and delayed gene expression is elicited by ACTH (5). The immediate early genes junB, c-myc, and c-fos were stimulated by ACTH in cultured adrenocortical cells (10), and c-fos and c-jun mRNAs were induced by ACTH in the Y1 adrenal cell line (11). The steroidogenic P-450 genes, including P-450 side chain cleavage (CYP11A1), are induced in a more delayed manner in both the adrenal cortex in vivo and in Y1 cells (5).

Several observations suggest that ACTH regulates PKA-independent signaling. ACTH and cAMP induced immediate early gene expression with quite different kinetics (11). The immediate early gene expression profile induced by ACTH in Y1 cells resembled the expression profile induced by stimulating the PKC pathway with phorbol esters (11). In addition, c-myc mRNA levels were induced by the PKC activator 12-O-tetradecanoylphorbol-13-acetate (TPA), and ACTH-induced c-myc expression was blocked by the PKC inhibitor H-7 in rat primary adrenal cell cultures (10).

Stimuli that activate either the PKC, the Ca⁺²-calmodulin-dependent protein kinase, or the phosphoinositol pathway, also induce members of the mitogen-activated protein kinase family of serine/threonine kinases (12). Mitogen-activated protein kinases include the related but distinct p54 stress-activated protein kinases (SAPKs) (or c-Jun N-terminal kinases), the p42 and p44 extracellular signal-regulated kinases (ERKs), and p38 kinases (13-17). These serine/threonine kinases activate downstream transcription factors, which in turn induce expression of target genes. A variety of environmental stressors induce SAPK activity in cultured cells, including heat shock and UV irradiation and calcium ionophores (17-22). Angiotensin II, activating mutations of G-protein-coupled receptors, and activators of the PKC pathway also induce SAPK activity (13-17, 23, 24). Relatively little is known about the regulation of the SAPK pathway in vivo. The effects of ACTH on SAPK activity were previously unknown.

ERK activity is stimulated by proliferative stimuli including growth factors and increases in intracellular Ca⁺² in a cell type-specific manner (25-27). ERK activity induced by either epidermal growth factor or platelet-derived growth factor in fibroblast cell lines was inhibited by cAMP (25, 28, 29). In contrast, cAMP induced ERK activity in PC12 cells (30), rat ovarian granulosa cells (31), and cardiac myocytes (32), indicating that the effect of cAMP on ERK activity is cell type-specific.

In addition to adrenal cells, ACTH receptors are expressed on a number of different cell types including lymphocytes (33), pancreatic islet cells (34), and adipose tissue (35); thus, an understanding of intracellular signaling by ACTH may have implications in a broad array of different cell types. To understand more fully the intracellular signaling pathways governing ACTH action, we examined the effect of ACTH on the activity of the mitogen-activated protein kinases, SAPK, and ERK kinases in vivo and in cultured adrenocortical cells. Since previous studies suggested that the induction of several immediate early genes by ACTH appeared to involve mechanisms separate from the PKA pathway, we examined the regulation of immediate early gene expression and promoter activity in response to ACTH.

MATERIALS AND METHODS

Male CD rats (175-200 g; Charles River Laboratories, Wilmington, MA) were used for the experiments. The rats used in this study were maintained in accordance with the guidelines of the animal care committee of Northwestern University. Free-feeding rats were injected with ACTH (5 units/100 g weight; Cortrosyn, Organon, Bedford, OH) by the tail vein and sacrificed by decapitation after CO₂ inhalation. Adrenals were taken at the time point indicated in the text. The adrenal cortex was dissected free from the medulla and lysed with radioimmune precipitation buffer (100 mM Tris, pH 7.5, 150 mM NaCl, 0.1% SDS, 1% Nonidet P-40, 0.1 mM Na₃VO₄, 0.5% deoxycholate, 0.1 mM phenylmethylsulfonyl fluroide, 1 µg/ml leupeptin), and the extracts were used for immune complex kinase assays and Western blotting. Porcine adrenocorticotropic hormone (ACTH_(1-39)) (Sigma), 8-bromo-cAMP (Sigma), N-(2-(methylamino)ethyl)-5-isoquinolinesulfonamide hydrochloride (H-8), N-(2-(p-bromocinnamyl)amino)ethyl-5-isoquinolinesulfonamide hydrochloride (H-89), A23187 (Calbiochem-Novabiochem International), BAPTA (Molecular Probes, Inc. Eugene, OR), EGTA (Sigma), and TPA (Sigma) were reconstituted and stored as recommended by the manufacturer. The SignaTECT cAMP-dependent protein kinase A assay system (Promega, Madison, WI), which uses biotinylated Leu-Arg-Arg-Ala-Ser-Leu-Gly (Kemptide) as substrate, and the SignaTECT protein kinase C assay system (Promega), which uses biotinylated Ala-Ala-Lys-Ile-Gln-Ala-Ser-Phe-Arg-Gly-His-Met-Ala-Arg-Lys-Lys (Neurogranin) peptide, were used as recommended by the manufacturer.

Assays were performed as recently described on extracts derived from rats or cultured cells (24, 36). Staphylococcal protein A-agarose beads were incubated with anti-ERK antibody (C14, Santa Cruz Biotechnology, Santa Cruz, CA) or anti-SAPK antibody (a gift from Dr. J. Kyriakis) (17) for 1 h at 4 °C. The antibody-beads complexes were washed once with radioimmune precipitation buffer and incubated with 200 µg of extracts for a further 2 h at 4 °C. The immunoprecipitates were washed with radioimmune precipitation buffer, wash buffer (0.5 M LiCl, 0.1 M Tris-Cl, pH 8.0, 1 mM dithiothreitol, and kinase buffer (for SAPK: 20 mM MOPS, pH 7.2, 2 mM EGTA, 10 mM MgCl₂, 0.1% Triton X-100, 1 mM dithiothreitol; for ERK: 25 mM HEPES, pH 7.2, 10 mM MgCl₂, 10 mM MnCl₂, 1 mM dithiothreitol). The reactions were performed at 30 °C for 20 min in 40 µl of kinase buffer with 10 µCi of [-³²P]ATP (6000 Ci/mmol, 1 Ci = 37 GBq) and 2 µg of glutathione S-transferase c-Jun (1-135) protein fragment for SAPK activity or 2 µg of myelin basic protein for ERK activity. The samples were analyzed by SDS-polyacrylamide gel electrophoresis upon termination of the reaction with Laemmli buffer and boiling. The phosphorylation of glutathione S-transferase c-Jun or myelin basic protein was quantified by densitometry using a Bio-Rad Molecular Analyst 1.1.1.

The cell extracts used for immunoprecipitation kinase assays were also used to quantify protein abundance of the immediate early gene and Cyp11A1 gene products. Western blotting was performed as described previously using antibodies to JunB (N-17), JunD (329), c-Fos (K-25), c-Myc (C-8, Santa Cruz Biotechnology), -tubulin (5H1) (37), and the rat Cyp11A1 (38, 39). Reactive proteins were visualized by the enhanced chemiluminescence system (Amersham Life Science, Inc.). The abundance of immunoreactive protein was quantified by densitometry using a Bio-Rad Molecular Analyst 1.1.1.

The reporter c-fosLUC (24) contains the human c-fos promoter from 361 to +157 in the pA₃LUC reporter (40). The junB promoter was cloned by polymerase chain reaction using oligonucleotides to the published sequences (5 GGTACCCGCGAGCCGCCTCCTCCC, 3 AAGCTTCCGGGCGGCCCAGGCGGT) and was subcloned into the reporter pA₃LUC to create the reporter junBLUC. The c-myc P1/P2 promoters from 157 to +500 (41) were linked to the pA₃LUC reporter to form c-mycLUC. The cAMP-responsive chorionic gonadotropin  subunit promoter fragments linked to the luciferase reporter gene 846LUC referred to as CRELUC and 172LUC were previously described (42). The reporter plasmid 172 m4LUC reporter that contains a mutation within the chorionic gonadotropin  subunit cAMP response element (CRE) which abolishes cAMP responsiveness and cAMP-responsive element binding protein binding was described previously (42). The 2700-base pair ovine CYP11A1 promoter fragment linked to the luciferase reporter gene, 2700 CYPLUC, was described previously (43). The integrity of all constructs was determined by restriction enzyme analysis and dideoxy DNA sequencing (44) using an Applied Biosystems Inc. automated sequencer. The construction of the plasmid encoding the wild type and inactive mutant catalytic subunits of protein kinase A were described previously (45).

Cell culture, DNA transfection, and luciferase assays were performed as described previously (42, 46). The Y1 cell line was a gift from Dr. B. Schimmer. Y1 cells were grown in Ham's F-10 medium with 1% penicillin, streptomycin, 2.5% fetal bovine serum, and 15% horse serum. 3 × 10⁵ cells were transfected by calcium phosphate precipitation, the medium was changed after 6 h, and luciferase activity was determined after a further 24 h (42, 46). Luciferase assays were performed using an Autolumat LB 953 (EG & G Berthold). Luciferase content was measured by calculating the light emitted during the initial 30 s of the reaction, and the values are expressed in arbitrary light units (36, 42). The percent effect was determined by comparison with its untreated activity. Statistical analyses were performed using the Mann Whitney U test.

RESULTS

To examine the effect of ACTH on adrenal cortical SAPK activity in vivo, rats were treated with intravenous ACTH. The adrenal cortex was dissected from the medulla, and immune complex kinase assays were performed using a polyclonal SAPK antibody and the amino terminus of c-Jun (amino acids 1-135) as the substrate (17, 24, 43). Adrenal cortical SAPK activity was increased 2-fold at 15 min (Fig. 1A) and 3-fold (3.1 ± 0.5, n = 5) at 30 min (Fig. 1, A and B). SAPK activity remained elevated at 1 h (3.2-fold) and at 6 h (2-fold), indicating the response to ACTH was both rapid and sustained (Fig. 1, A and B). The sustained induction of SAPK activity contrasts with the transient induction of SAPK activity we previously observed in response to growth factors (43). In control animals treated with intravenous saline, there was no increase in SAPK activity. In contrast with the induction of SAPK activity, ERK activity was reduced 40% at 30 min in the same ACTH-treated adrenal cortical extracts (data not shown).

The effect of ACTH on SAPK and ERK activity was also determined in cultured Y1 adrenal cells. ACTH (10⁶ M) treatment for 30 min stimulated SAPK activity an average of 3-fold in Y1 cells (Fig. 2A). To determine the time course of SAPK induction by ACTH in Y1 cells, treatment with ACTH was conducted for 15 min to 24 h, and the cells were harvested. SAPK activity was induced 2.5-fold (n = 6, range 1.4-4-fold) within 15 min and was sustained at 2 h (Fig. 2B), returning to baseline at 6 h (data not shown). The induction of SAPK was observed at 10⁸ M and 10¹⁰ M ACTH (Fig. 2B). SAPK activity was also induced by ACTH in the absence of serum (Fig. 2C). In contrast with the effect of ACTH on SAPK, ERK activity was reduced by ACTH treatment with a mean reduction of 45% at 30 min (Fig. 2, D and E). The inhibition of ERK activity by ACTH was observed at 10⁶ M and 10⁸ M ACTH (Fig. 2E).

6

Studies were performed to investigate the second messenger pathways regulating SAPK activity and involved in ACTH regulation of SAPK activity. In previous studies of cultured hepatocytes, heat shock and tumor necrosis factor  (TNF) were shown to induce SAPK activity 4- and 5-fold, respectively (17). When Y1 cells were treated with heat shock (42 °C) or TNF (50 ng/ml) for 15 min, SAPK activity was induced 4-fold and 5-fold, respectively (Fig. 3A). ERK activity was induced 4.5-fold by heat shock but was induced only 1.5-fold by TNF (not shown). As cAMP is activated by ACTH, the effect of cAMP on SAPK activity was determined. cAMP (10³ M) treatment was associated with a modest reduction in SAPK activity shown at 20 min (Fig. 3B). Previous studies have demonstrated activation of the PKC pathway in ACTH-treated Y1 cells (33). To examine whether activation of the PKC pathway induced SAPK activity, Y1 cells were treated with the phorbol ester TPA (100 ng/ml). SAPK activity was induced 4-fold at 15 min and 5.5-fold at 30 min (Fig. 3C). Intracellular Ca⁺² fluxes played an important role in both angiotensin II-induced SAPK activity in liver epithelial cells (19) and T cell activation of SAPK activity (22). To examine the role of intracellular Ca⁺² on SAPK activity in Y1 cells, the effect of the calcium ionophore A23187 was assessed. SAPK activity was induced 4.5-fold at 15 min and 12-fold at 30 min by A23187 (60 µM) (Fig. 3D). Together these studies indicate that several distinct intracellular stressors induce, but that cAMP inhibits, SAPK activity in Y1 cells.

3

To further investigate the secondary messenger pathways involved in ACTH-induced SAPK activity, chemical inhibitors of the isoquinolinesulfonamide family were used. H-8 is a preferential and potent inhibitor of PKA (K_i 1.3 µM) compared with its effect against protein kinase C (K_i, 15 µM) (47). Treatment of Y1 cells with the PKA inhibitor H-8 (3 µM) did not significantly affect ACTH-induced SAPK activity (Fig. 4A). At higher concentrations, H-8 (30 µM) inhibits the PKC pathway (48), and ACTH-induced SAPK activity was inhibited 40% by pretreatment with 30 µM H-8 (Fig. 4A, lane 4). The isoquinolinesulfonamide H-89 preferentially inhibits PKA (K_i, 500 nM) compared with the PKC pathway (K_i, 76 µM). Pretreatment of Y1 cells with 76 µM H-89 abolished SAPK induction by ACTH (not shown).

6

Intracellular Ca⁺² levels are increased in ACTH-treated Y1 cells (33). To examine the role of Ca⁺² levels in ACTH-induced SAPK activity, the Ca⁺² chelating agent EGTA was used. The increase in SAPK activity by ACTH was completely blocked by the addition of EGTA, suggesting that the transport of Ca⁺² from the extracellular to the intracellular space may play a role in the ACTH-induced SAPK activity (Fig. 4B, lanes 6 and 7 versus 8). Together these studies suggest SAPK activity is induced by the PKC pathway and that ACTH induction of SAPK involves both the PKC and Ca⁺² pathway.

Because H-8 at 3 µM did not affect SAPK induction by ACTH and was used to inhibit PKA activity, we examined the effect of H-8 at this concentration on cAMP-induced activity in Y1 cells. cAMP activity was assayed using either transient reporter studies or biochemical assays. Recent studies have demonstrated the high sensitivity of a luciferase reporter system using the CRE to assay cAMP-regulated activity in cultured cells (49). We therefore employed a chorionic gonadotropin  subunit reporter gene 172LUC (42) as a synthetic cAMP-responsive reporter to examine the cAMP pathway in Y1 cells. cAMP treatment induced the 172LUC reporter 12-fold (Fig. 5). Pretreatment of Y1 cells with H-8 (3 µM) reduced cAMP-induced reporter activity by approximately one-half (Fig. 5). Comparison was made with the reporter 172 m4LUC (42) in which the CRE was mutated to abolish binding of the cAMP-responsive element binding protein. Mutation of the CRE reduced induction by cAMP 90% (Fig. 5), indicating the induction of the wild type CRE reporter was a specific measure of the cAMP/cAMP-responsive element binding protein pathway in Y1 cells.

The effect of H-8 on the PKA pathway was also assessed using the SignaTECT cAMP-dependent protein kinase A assay system. This assay is highly specific for PKA and uses biotinylated Kemptide as substrate. This peptide substrate is derived from the in vivo substrate pyruvate kinase. The high affinity of Kemptide for PKA (K_m = 5-10 µM) also provides for high sensitivity. Y1 cells were pretreated with 3 µM H-8. Assays were performed in duplicate. The cAMP-induced PKA activity (6.2-fold) was reduced by 3 µM H-8 to 38% that of full induction (38% ± 9, n = 6, p < 0.05). These studies indicate that 3 µM H-8 inhibits cAMP-induced PKA activity in Y1 cells.

To examine the effect of H-8 (30 µM) on the PKC pathway, the SignaTECT protein kinase C assay system was used (50). This assay uses biotinylated Neurogranin peptide, which is the most specific substrate commercially available for PKC activity. Treatment of Y1 cells with TPA (100 ng/ml) for 15 min induced PKC activity 1.5-fold (1.54 ± 0.3 pmol of ATP/min/µg of protein, n = 3), consistent with studies in other cell types. The addition of 30 µM H-8 reduced the induction of PKC activity by TPA a mean of 65% (n = 3) (not shown). These studies indicate that 30 µM H-8 inhibits TPA-induced PKC activity in Y1 cells.

The induction of SAPK activity is thought to induce expression of immediate early and other specific target genes. To determine whether ACTH regulated immediate early gene expression at concentrations that induced SAPK activity, Western blotting was performed of the adrenal cortex from ACTH-treated animals. Because experiments in cultured adrenal cells suggested that JunB is induced by ACTH (51), the effect of ACTH on adrenocortical JunB protein abundance was assessed. JunB abundance was increased 17-fold after 30 min, with a peak 40-fold increase at 2 h, returning to basal after 12 h (Fig. 6A). c-Fos was induced 1.3-fold within 30 min, returning to basal within 6 h (data not shown). ACTH induced c-Myc abundance 2-fold after 30 min, returning to basal at 24 h (Fig. 6C). The Western blots, which were loaded with equal amounts of protein, were also probed for -tubulin. The relative abundance of -tubulin was unchanged by ACTH (Fig. 6D). The abundance of JunD was increased 1.6-fold after 6 h (Fig. 6B). Together these studies demonstrate that ACTH treatment, at the concentrations shown to induce SAPK activity, induces several immediate early gene products including JunB, c-Fos, c-Myc, and JunD in vivo.

Western blot analyses were performed to determine whether ACTH treatment of Y1 cells induced similar immediate early genes as those induced by ACTH in vivo. The abundance of JunB was increased after 30 min of ACTH (10⁶ M) treatment, with maximal 12-fold induction at 2 h, returning to basal levels after 24 h (Fig. 7A). JunD increased 2.4-fold by 6 h, and c-Myc was increased 2.1-fold after 3 h as previously shown (10, 11) (data not shown).

6

To determine whether DNA sequences sufficient for ACTH responsiveness were located within the promoter regions of the ACTH-responsive immediate early genes (junB, c-myc, and c-fos), the promoters of these genes were cloned and linked to the luciferase reporter gene. ACTH induced the junBLUC reporter 2.5-fold at 3 h and 3.6-fold at 6 h (Fig. 7B). The effect of ACTH was assessed further at 6 h for the other immediate early gene promoters. ACTH induced c-fosLUC activity 2.5-fold, c-mycLUC activity 2-fold, and CRELUC activity 2.4-fold (Fig. 7C). The effect of cAMP on promoter activity was next assessed. At 6 h, junBLUC activity was induced 2-fold, c-fosLUC reporter was not induced significantly (1.1-fold), c-mycLUC reporter was induced 1.4-fold, and CRELUC reporter was induced 2.6-fold (Fig. 7D). In previous studies with a c-fos chloramphenicol acetyl transferase reporter, the cAMP induction of the c-fos promoter in NIH-3T3 cells was rapid and transient, returning to basal at 3 h (52). To determine whether sustained activation of the PKA pathway could induce c-fosLUC reporter activity, the catalytic subunit for protein kinase A was overexpressed with the c-fosLUC reporter. Overexpression of the PKA catalytic subunit induced the c-fosLUC reporter 10-fold and CRELUC reporter activity 27-fold (Fig. 7E), indicating that sustained induction of cAMP activates the c-fos promoter in Y1 cells. In addition, as previously shown with cAMP in Y1 cells (46), the CYP11A1 promoter was induced 3-fold by overexpression of the PKA catalytic subunit (Fig. 7E). These studies indicate that ACTH induces immediate early gene expression and promoter activity at the concentrations that induced SAPK activity.

DISCUSSION

The SAPKs are preferentially phosphorylated at tyrosine and threonine residues in response to toxins and intracellular stressors (12, 17-21), and SAPK activity appears to be involved in differentiation and apoptosis (53-55). The role of the SAPKs in response to stress hormones in vivo remained to be investigated. These studies demonstrate the novel finding that ACTH induces SAPK activity both in the rat adrenal cortex in vivo and in cultured Y1 adrenal cells. TPA, but not cAMP, induced SAPK activity. ACTH-induced SAPK activity was reduced by isoquinolinesulfonyl chemical inhibitors of the PKC pathway. EGTA blocked ACTH-induced SAPK activity, indicating a requirement for extracellular Ca⁺² in ACTH-induced SAPK activity. Together these studies suggest that the Ca⁺² and PKC pathway are involved in ACTH-induced SAPK activity.

The induction of SAPK activity by ACTH was inhibited by either H-8 or H-89 at concentrations that inhibited PKC activity but not at concentrations that inhibited PKA activity. H-8 is a preferential inhibitor of PKA with a K_i for PKA of 1.2 µM and a K_i for PKC of 15 µM (47). cAMP-induced PKA activity was assayed in Y1 cells using either a cAMP-responsive reporter gene system or biotinylated Kemptide as substrate. At 3 µM, H-8 inhibited PKA activity approximately 40-50% using either of these systems. This concentration of H-8 did not inhibit ACTH-induced SAPK activity in Y1 cells. PKC activity was assayed using biotinylated Neurogranin in Y1 cells. At the higher concentration of 30 µM H-8, previously shown to inhibit PKC activity (50), TPA-induced PKC activity was inhibited approximately 60% in Y1 cells. SAPK induction by ACTH was also inhibited 40% by 30 µM H-8. Together these studies suggest that ACTH induction of SAPK involves the PKC pathway.

EGTA blocked ACTH-induced SAPK activity, suggesting a requirement for extracellular Ca⁺² in ACTH-induced SAPK activity. EGTA was recently shown to reduce SAPK activity induced by angiotensin II in hepatic cells, suggesting that intracellular calcium may be a common component required for SAPK activation by these two hormones (19). The intracellular Ca⁺² chelating agent BAPTA also reduced angiotensin II-induced SAPK activity (19) and ACTH-induced SAPK activity by 40%.² Calcium plays an important role in several aspects of normal adrenal function. ACTH-induced steroid secretion was inhibited by calcium channel blockade in cultured bovine adrenal cells (56, 57). In Y1 cells, ACTH-stimulated steroid secretion was enhanced by the addition of Ca⁺² and inhibited by 5 mM EGTA (58). The extracellular concentration of calcium affects the distribution of microfilaments and the morphological response induced by ACTH (59). In part this may be because the calcium-binding protein, calmodulin, is both involved in the coupling of the ACTH receptor to the adenylyl cyclase regulatory protein and also binds to cytoskeletal proteins (7). Together these findings indicate the importance of Ca⁺² in ACTH-induced SAPK activity and normal adrenal steroid secretion.

ACTH inhibited basal ERK activity in the rat adrenal cortex in vivo and in cultured Y1 cells. In many circumstances, induction of ERK activity is associated with enhanced cellular proliferation (12, 60), S-phase progression, and DNA synthesis (25). ACTH inhibits cellular proliferation in fetal adrenal cells (61) and inhibits DNA synthesis in Y1 cells (2). The inhibition of ERK activity by ACTH may contribute to the inhibition of cellular proliferation and DNA synthesis induced by ACTH (2).

Several previous studies suggested that ACTH induced PKA-dependent and PKA-independent effects in adrenal cells. Although both ACTH and cAMP treatment of adrenal cells induced immediate early gene expression, the magnitude of induction and the kinetics of immediate early gene expression were different. The induction of c-Fos (62) and JunB (11) by ACTH was greater than that observed with cAMP treatment in Y1 cells. The induction of c-myc expression by ACTH in rat adrenal cells was PKC-dependent (10), and the induction of CYP11A1 mRNA in fetal adrenal cells was partially inhibited by H-7 or staurosporine, suggesting a role for the PKC pathway (61). Our studies provide further evidence for an intracellular signaling pathway that is induced by ACTH and not by cAMP, as SAPK was induced by ACTH and not by cAMP. The induction of SAPK by ACTH may contribute to some of the differences in immediate early gene expression induced by ACTH compared with cAMP because SAPK is thought to induce expression of immediate early genes. SAPK is thought to induce several different immediate early genes through phosphorylation and activation of transcription factors including c-Fos (63), c-Jun (13), Ets family proteins (64), and ATF-2 (65). In our studies, at least at the time points examined, the c-fos promoter and the JunB promoters were induced preferentially by ACTH compared with cAMP. The independent role of SAPK in ACTH-induced immediate early gene expression and the other effects mediated by ACTH in vivo may be investigated further when specific chemical inhibitors for SAPK become available.

ACTH also stimulates rounding of cultured adrenal cortical cells and the induction of microfilament polymerization and plasma membrane microvilli formation that facilitates endocytosis of precursors for steroid hormone biosynthesis (66, 67). The induction of SAPK may also be linked to these ACTH-induced cytoskeletal changes (66, 67). Recent studies have suggested that the small GTPase Rac1 (68, 69) is responsible for both actin polymerization and the induction of SAPK activity. The role of the SAPK regulatory protein Rac1 in ACTH induced cytoskeletal changes, and steroid hormone secretion is currently under investigation in this laboratory.

Angiotensin II, which also signals through a G-protein-coupled receptor, was recently shown to induce SAPK activity in cultured hepatic (19) and adrenal cells (24). Our results provide further evidence that seven transmembrane G-protein-coupled receptors regulate SAPK activity (19, 23). The rapid and sustained induction of adrenocortical SAPK activity by ACTH in vivo suggests an important role for SAPK in the whole animal response to stress.