|
Volume 272, Number 32,
Issue of August 8, 1997
pp. 20077-20081
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.
Riboflavin 5 -Hydroxymethyl Oxidation
MOLECULAR CLONING, EXPRESSION, AND GLYCOPROTEIN NATURE OF THE
5 -ALDEHYDE-FORMING ENZYME FROM SCHIZOPHYLLUM
COMMUNE*
(Received for publication, April 21, 1997)
Haoyuan
Chen
and
Donald B.
McCormick
From the Department of Biochemistry, Rollins Research Center, Emory
University, Atlanta, Georgia 30322-3050
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
FOOTNOTES
REFERENCES
ABSTRACT
Vitamin B2-aldehyde-forming
enzyme catalyzes oxidation of the 5 -hydroxymethyl of riboflavin to the
formyl group. We have purified the enzyme from the culture media of
Schizophyllum commune (ATCC 38719) by modifying the
procedure of Tachibana and Oka (Tachibana, S., and Oka, M. (1981)
J. Biol. Chem. 256, 6682-6685) for cell-free extract.
By SDS-polyacrylamine gel electrophoresis, the enzyme appears to be 78 kDa. The enzyme has a blocked amino terminus, so fragments were
obtained by cleaving the purified enzyme with lysyl endopeptidase.
Selected peptides were sequenced from their amino termini. We have
isolated a full-length cDNA clone using a DNA hybridization probe
amplified by polymerase chain reaction with two degenerate
oligonucleotide primers, the design of which was based on one of the
partial amino acid sequences. From the cDNA clone, it is evident
that the enzyme has a Ser/Thr-rich fragment near the COOH-terminal Asp.
The enzyme was determined to be a glycoprotein; however,
O-deglucosylation only slightly affects activity.
Computer searches showed that the B2-aldehyde-forming enzyme has little homology with other proteins, but domain motifs may
reflect N-myristoylation of a dehydrogenase with a
signature similar to 4Fe-4S ferredoxins. The enzyme cDNA was
subcloned into a Pichia expression vector pPIC9K to produce
a recombinant protein which exhibited B2-aldehyde-forming
enzyme activity.
INTRODUCTION
The metabolism of riboflavin is better understood in terms of
enzymes responsible for the biosynthetic conversion of this vitamin to
its functional coenzymes than as concerns enzymes catalyzing catabolic
degradation of the vitamin (1). Complete purification of flavokinase
(2), which catalyzes formation of FMN, and FAD synthetase (3), have led
to significant understanding of flavocoenzyme formation and its kinetic
control (4); however, not one of the enzymes responsible for
degradation of riboflavin had been sequenced or obtained in sufficient
quantity to allow suitable molecular characterization.
The considerable extent to which riboflavin is apparently catabolized
in the human was reflected by early balance experiments in adult men
(5). Although diverse flavin catabolites have been described in nature
(6), little has been done to elucidate the enzyme systems responsible
for their formation. Certain bacteria have been found able to degrade
the flavin isoalloxazine ring (7, 8) as well as D-ribityl
chain (9, 10) and its analogues (11). Oxidations of flavin 7- and
8-methyl functions lead to the corresponding hydroxymethyl compounds
found in urine (12-14) and milk (15, 16) and to
7 -hydroxymethyl-riboflavin as the main catabolite in human plasma
(17). The enzyme system responsible for forming so-called
"schizoflavins", which are the aldehyde and carboxylic acid derived
from oxidation of the terminal 5 -hydroxymethyl of the riboflavin side
chain (18), was purified from the fungus Schizophyllum
commune by Tachibana and Oka (19, 20). Our laboratory first
ascertained the rather narrow flavin specificity of the S. commune riboflavin 5 -hydroxymethyl oxidase (21). However, the
trace of protein obtained in previous studies was insufficient to allow
characterization other than indirect indications that a conventional
alcohol pyridine-nucleotide dehydrogenase or even an azide-sensitive
cytochrome P450-dependent system did not seem to be
involved (20).
As will be described in this paper, we have now succeeded in modifying
the original purification to obtain enzyme from which peptide fragments
were derived to ultimately obtain a complete cDNA for reflecting
the primary sequence of the enzyme, further to express its activity in
Pichia pastoris, and additionally to determine that
deglycosylation has little effect on the overall activity.
EXPERIMENTAL PROCEDURES
Growth of Microorganism
S. commune (ATCC 38719)
was obtained from the American Type Culture Collection and maintained
on YM (Difco) agar plates. Seed cultures were prepared by cultivation
in a YM medium with shaking on a reciprocal shaker for 3 days at
30 °C. Large scale cultures (4 liters) were prepared by inoculation
with 0.2 liter of seed culture with shaking as before. Mycelia were
separated from culture media by filtration onto cheesecloth. The
resulting culture medium was used for enzyme purification.
Enzyme Assay
B2-aldehyde-forming enzyme
activity was assayed by the method described by Tachibana and Oka (19).
The rate of dichlorophenol indophenol reduction was monitored by the
decrease in absorbance at 600 nm using a Milton Roy spectrophotometer
at 25 °C. One unit of enzyme activity is defined as the amount of
enzyme that riboflavin reduces 1 µmol of dichlorophenol
indophenol/min at 25 °C as calculated from its molar extinction
coefficient (7.6 × 103 at pH 5.5). Protein was
determined by the method of Bradford (22) using bovine serum albumin as
standard.
Purification of B2-aldehyde-forming Enzyme
Four
liters of culture media of S. commune was brought to 50%
saturation by addition with stirring of solid ammonium sulfate at
4 °C. The resultant precipitate was removed by centrifugation for 30 min at 25,000 × g. The supernatant fluid at 4 °C
was then brought to 90% saturation by further addition with stirring
of solid ammonium sulfate. After standing overnight the resultant precipitate was collected by centrifugation for 30 min at 25,000 × g. The precipitate was resuspended and dialyzed overnight
against 50 mM sodium acetate buffer, pH 5.0. The enzyme
solution was then applied to a DEAE-Sepharose column (4 × 40 cm)
equilibrated with the pH 5 acetate buffer. After removal of the unbound
material, the column was eluted with 1 liter of 0-1 M
linear NaCl gradient. Fractions of 10 ml were collected and assayed for
activity. The fractions containing the enzyme activity were pooled and
dialyzed against the pH 5 acetate buffer.
For the purpose of partial amino acid sequencing, the enzyme solution
was concentrated by ultrafiltration to a total volume of 1 ml, applied
to a nondenaturing gel, and electrophoresed at 4 °C. The location of
the enzyme activity on the gel was determined as described by Tachibana
and Oka (19). The protein band containing the enzyme activity was
excised and homogenized with minimal volume of the pH 5 acetate
buffer.
Affinity chromatography with flavin immobilized gel has also been used
for the final purification step. Flavin immobilized gel was synthesized
by the method described by Kasai et al. (23). The partially
purified enzyme from the DEAE-Sepharose column was subjected to an
affinity column (1 × 10 cm) equilibrated with the pH 5 acetate
buffer. The column was washed with the buffer until the washes were
nearly free of 280-nm-absorbing material. The desired protein was then
eluted with the buffer containing 0.1 mM riboflavin. The
fractions containing the enzyme activity were pooled and stored at
20 °C.
Peptide Sequencing
The suspension of purified enzyme from
the nondenatured gel was resolved on
SDS-PAGE1 and transferred to
a polyvinylidene difluoride membrane using a mini-trans-blot cell
(Bio-Rad). The enzyme band was then excised. Direct sequencing of the
enzyme indicated that it had a blocked amino terminus. Therefore, the
purified enzyme on polyvinylidene difluoride membrane was digested with
lysyl endopeptidase. The resulting peptides were purified using a C-18
silica reversed-phase column (1 × 250 mm). The isolated peptides
were selected for sequencing.
Construction of a Schizophyllum cDNA Library
S.
commune was grown for 3 days as described above. Mycelia were
harvested by filtration onto cheesecloth. Harvested mycelia were
blotted on paper toweling, frozen at 20 °C, and lyophilized. Lyophilized mycelia were then frozen in liquid nitrogen, ground in a
mortar, and broken with a Bead-Beater (Biospec Products). RNA was
extracted and isolated with a total RNA isolation kit (Life
Technologies, Inc.). Poly(A)+ RNA was purified on
oligo(dT)-cellulose columns and used as template for the construction
of a cDNA library in phage ZAPII by using a commercial kit
(Stratagene).
Isolation of the cDNA Clone
Two degenerate
oligonucleotides derived from one peptide were synthesized:
5 -CARGCNCARATHGTNGAYGA (384-fold degeneracy) and 5 -AARTAYTCRAANARNCCYTG (512-fold degeneracy). These degenerate primers
were used in the polymerase chain reaction to synthesize a
nondegenerate probe with purified poly(A)+ RNA as template.
This sequence was then labeled with biotin-14-dCTP using a polymerase
chain reaction nonradioactive labeling system (Life Technologies,
Inc.). Phages (105) were screened, and one pure positive
clone was achieved with two rounds of screening. Plaques were lifted on
MagnaGraph nylon transfer membranes (Micron Separations Inc.) and were
treated as described by the manufacturer. A PhotoGene nucleic acid
detection system (Life Technologies, Inc.) was used to detect the
biotinylated probes hybridized to nucleic acids immobilized on the
membranes. Hybridization was done overnight at 42 °C in 6 × SSC (0.3 M sodium citrate buffer, pH 7, containing 3.0 M NaCl), 0.5% SDS, 50% formamide, 5 × Denhardt's
reagent, and 100 mg/ml of sheared, denatured, herring sperm DNA. The
final wash was performed in 0.1 × SSC with 1% SDS at 55 °C
for 30 min. Techniques for prehybridization and hybridization were as
described by the manufacturer.
5 -Rapid Amplification of cDNA Ends
A 5 -RACE kit was
purchased from Boehringer Mannheim. Total RNA for the 5 -RACE
experiments was isolated from 1 g of lyophilized mycelia as
described above. Primers for the 5 -RACE experiments were GSP1
(AAAGTCAGAAGCCTGGTTCA) and GSP2 (AGGGGAGAGGATAGAAAG); both were
designed with the cDNA sequence as shown in Fig. 3. The 5 -RACE
products were separated by agarose (1%) gel electrophoresis. Each
product was then purified from the agarose gel using a Geneclean II kit
from BIO 101, Inc. (Vista, CA) and subcloned using a TA cloning kit
(Invitrogen), and subclones containing the 5 -RACE products were
sequenced.
Fig. 3.
Nucleotide sequence and predicted amino acid
sequence (single-letter amino acid code) of the S. commune
vitamin B2-aldehyde-forming enzyme. The
open reading frame, defined by assigning the initiation codon ATG (at
position 304), is in frame with the amino acid sequences of the
peptides previously determined (underlined). The translation stop code (TGA) is shown with an asterisk.
[View Larger Version of this Image (76K GIF file)]
DNA Sequencing
A Sequenase kit (U. S. Biochemical Corp.)
was used for plasmid sequencing. Sequence analysis was performed using
the sequence analysis software package (GCG) of the University of
Wisconsin Genetics Computer Group (24) and other tools via the World
Wide Web.
Expression of B2-aldehyde-forming Enzyme in P. pastoris
A Pichia expression kit (Invitrogen) was used
for functional expression of the enzyme in P. pastoris. The
pPIC9K vector (Invitrogen) was selected to construct the expression
plasmid. P. pastoris strain KM71 was maintained and
transformed as described in the manual version F of the
Pichia expression kit. His+ transformants in
KM71 were purified on regeneration dextrose plates (Invitrogen) without
histidine. Gene integration was detected using a rapid DNA dot blot
technique (25). To express the enzyme, a single colony of multiple
integration transformants was inoculated into 25 ml of pH 6-buffered
complex glycerol media (Invitrogen). After growing at 30 °C with
shaking (250 rpm) for 18 h, cells were harvested by centrifuging
and transferred to 250 ml of pH 6-buffered complex methanol media
(Invitrogen) with 1% casamino acids. The culture was then returned to
the incubator to continue growth for 72 h.
Deglycosylation of B2-aldehyde-forming
Enzyme
An enzymatic deglycosylation kit (Bio-Rad) was used to
enzymatically cleave all possible N- and O-linked
oligosaccharides from the B2-aldehyde-forming enzyme.
Partially purified enzyme from the affinity purification step was used
in deglycosylation reactions using a denaturing protocol described by
the manufacturer. The effect of deglycosylation with only
O-glycosidase on the B2-aldehyde-forming enzyme
activity was examined using a nondenaturing protocol as described by
the manufacturer.
RESULTS AND DISCUSSION
Enzyme Purification and Sequencing
In the previous method for
the purification of B2-aldehyde-forming enzyme from
S. commune, only a trace of purified enzyme was obtained
from very large amounts of mycelia because of very low specific
activity in the cell-free extract (19). We have found that the culture
medium of S. commune also contains the enzyme with a
specific activity about 15-fold higher than that of cell-free extract.
So it is possible to obtain pure enzyme from the culture media in
greater yield and in much shorter time. To facilitate the purification,
we have chosen the S. commune (ATCC 38719) strain. which
secreted very small amounts of polysaccharide to the media (26). Table
I summarizes the partial purification of
B2-aldehyde-forming enzyme from the S. commune
culture media. After the DEAE-Sepharose chromatography step, the enzyme
was purified about 90-fold based on the activity of the culture
supernatant. Analysis of the partially purified enzyme by SDS-PAGE
showed that there are five major bands on the gel (Fig.
1). In the previous method (19), Sephadex
G-100 chromatography was used for the final purification. However, a
substantial loss in yield in this step has been found. For the purpose
of partial amino acid sequencing, we have separated the partially
purified enzyme on a nondenaturing gel. The final product of this
purification showed a single protein with an apparent molecular mass of
78 kDa on SDS-PAGE (Fig. 1). But this also resulted in a significant
activity loss. A potential procedure for the final purification step is
to use flavinyl-agaroses as biospecific affinity materials as described
by Merrill and McCormick (27). This technique has been successfully
used for the purification of proteins that bind riboflavin, such as
flavokinase from rat liver (27, 28) or from small intestine (23). The elution pattern for affinity chromatography of the
B2-aldehyde-forming enzyme is shown in Fig.
2. The addition of 0.1 mM
riboflavin released the enzyme in 20% yield. The rest of the enzyme
activity was eluted with 0.1% Tween 20, suggesting additional binding
to the matrix.
Table I.
Partial purification of B2-aldehyde-forming enzyme from S. commune culture media
|
| Purification step |
Volume |
Total protein |
Total
activity |
Specific activity |
Yield
|
|
|
ml |
mg |
units |
units/mg |
% |
| Culture
supernatant |
4,000 |
852.0 |
3.25 |
0.0038 |
100
|
| (NH4)2SO4
fractionation |
200 |
53.9 |
2.81 |
0.052 |
86.5
|
| DEAE-Sepharose
chromatography |
14 |
5.6 |
1.90 |
0.34 |
58.5 |
|
Fig. 1.
SDS-polyacrylamide gel electrophoresis of
S. commune B2-aldehyde-forming
enzyme. Lane a, 20 µg of protein obtained from the
DEAE-Sepharose column as described under "Experimental Procedures."
Lane b, 5 µg of the purified enzyme obtained from the
nondenatured gel.
[View Larger Version of this Image (46K GIF file)]
Fig. 2.
The elution pattern for affinity
chromatography of the B2-aldehyde-forming
enzyme. Open circles, activity; filled circles,
protein concentration.
[View Larger Version of this Image (21K GIF file)]
The purified enzyme obtained from the nondenaturing gel was transferred
to a polyvinylidene difluoride membrane for amino acid sequencing.
Attempts to directly sequence the polypeptide demonstrated that it had
a blocked amino terminus. Therefore, the purified enzyme was cleaved
with lysyl endopeptidase. Peptide fragments were separated by high
performance liquid chromatography, and selected peptides were
sequenced. Two resultant amino acid sequences (underlined)
are shown in Fig. 3.
cDNA Sequencing
A 78-bp probe was amplified from S. commune cDNA with two degenerate primers as described under
"Experimental Procedures" and was used for screening the S. commune cDNA library. One phage that showed the strongest
hybridization to the probe was converted into pBluescript SK( )
(Stratagene) by in vivo excision. This recombinant plasmid,
designated pBRAF, was then sequenced (Fig. 3). The whole sequence
contained 1080 bp with a 19-mer poly(A) tail at its 3 end. To obtain
the complete coding region for the enzyme, we employed the 5 -RACE
procedure. No more nucleotide sequence at the 5 end of the
B2-aldehyde-forming enzyme cDNA was found from the two
major 5 -RACE products. An open reading frame in the cDNA was
identified with ATG as putative start codon 304 bp from the beginning
of the insert. This open reading frame encodes a polypeptide of 200 residues with two internal peptides matching the amino acid sequences
of the peptides previously determined (underlined). The
calculated molecular weight and pI value of the encoded polypeptide are
20,384 and 3.6, respectively. Computer searches with known sequences
showed that this sequence has little similarity to other proteins.
However, searches on the PRINTS data base (29) via World Wide Web
exhibited three motif fragments in the predicted amino acid sequence.
The fragment from position 41 to 52 matches to a 4FE4SFRDOXIN motif,
which is a two-element fingerprint that provides a signature for 4Fe-4S
ferredoxins; fragment 61-71 matches to a BCTRLSENSOR motif, which is a
four-element fingerprint that provides a signature for the bacterial
sensor proteins; fragment (186-197) is similar to a GLFDHDRGNASE
motif, which is a four-element fingerprint that provides a signature for glutamate, leucine, and phenylalanine dehydrogenases. These latter
are NAD- and/or NADP-dependent enzymes (30-32). However, Tachibana and Oka (20) have demonstrated that neither NAD nor NADP
function as coenzyme for B2-aldehyde-forming enzyme,
although binding of NADPH stimulates aldehyde-forming activity
under aerobic conditions. ScanProsite searches showed that there were
three potential N-myristoylation sites near the
NH2 terminus (fragments 1-5, 20-25, and 24-29). These
results suggest that the NH2-terminal block is due to the
N-myristoylation.
In the predicted amino acid sequence, there is a Ser/Thr-rich fragment
(98-176) near the COOH-terminal Asp residue. BLAST searches with this
fragment as a query sequence revealed that many glycoproteins have
similar Ser/Thr-rich sequences near their COOH termini. One of these
glycoproteins, acid phosphatase from Leishmania mexicana,
has been found to have its Ser/Thr-rich domains serve as targets for
O-linked modification of phosphoserines by mannooligosaccharides and phosphoglycans (33). It has been found that
the calculated molecular mass of the encoded polypeptide (20.4 kDa) is
much less than that (78 kDa) revealed by SDS-PAGE (cf. Fig.
1). Because no more nucleotide sequence at the 5 end of the
B2-aldehyde-forming enzyme cDNA was found using the
5 -RACE procedure, it appeared that B2-aldehyde-forming
enzyme is also a glycoprotein with saccharides O-linked to
its Ser/Thr-rich domain. No consensus Asn-X-Thr/Ser sequence
for covalent attachment of N-linked glycans was found in the
predicted amino acid sequence. Deglycosylation substantiated that
B2-aldehyde-forming enzyme is a glycoprotein with an
expected polypeptide size of approximately 20 kDa (Fig.
4). The removal of O-linked
oligosaccharides from B2-aldehyde-forming enzyme has only a
slight effect on the enzyme activity (data not shown). This implies
that O-linked oligosaccharides are not essential for the
catalysis.
Fig. 4.
Deglycosylation of the the partially purified
B2-aldehyde-forming enzyme obtained from the
affinity chromatography. 20 µg of deglycosylated enzyme was
applied per lane of a 12% SDS-PAGE. Lane a, 0 h;
lane b, 5 h; and lane c, 12 h.
[View Larger Version of this Image (50K GIF file)]
Expression of B2-aldehyde-forming Enzyme
Activity
The methylotrophic yeast P. pastoris has been
developed as an efficient system for high-level production of foreign
proteins (34, 35). We therefore chose the P. pastoris
expression system (Invitrogen) to express the
B2-aldehyde-forming enzyme activity. Because the enzyme is
glycosylated and then secreted by the fungus, we have selected a vector
pPIC9K (Invitrogen) that has an -factor signal sequence to secrete
the protein. A plasmid, derived from pPIC9K and designated pPICRAF9K,
for the expression of the B2-aldehyde-forming enzyme was
constructed. In plasmid pPICRAF9K, polymerase chain reaction was used
to generate an EcoRI site before the first ATG and a
NotI site after the poly(A) end in the
B2-aldehyde-forming enzyme cDNA. After digestion with
EcoRI/NotI, the polymerase chain reaction product
was subcloned into the pPIC9K vector, which had also been digested with
EcoRI/NotI. DNA sequencing showed that the
inserted fragment (304-1080 in Fig. 3) is in frame with the secretion
signal open reading frame. pPICRAF9K was linearized with
Bpu1102I, and was then transformed to P. pastoris
strain KM71 as described by the manufacturer.
Ninety-one His+ transformants were tested for gene
integration into the Pichia genome using a rapid DNA
dot-blot technique (25). There were seven transformants that exhibited
strong hybridization signals. These transformants were chosen to
produce B2-aldehyde-forming enzyme in the induced cultures.
For the examination of the enzyme activity, culture media were
concentrated to 10-fold using a centrifugal filter device (Millipore).
The enzyme activity could be detected in all the seven concentrated
cultures. Fig. 5 showed the time courses
of the enzyme activity (A) and protein concentration
(B) for a pPICRAF9K transformant and a control transformant
with pPIC9K. These results confirmed that the cloned 1080 bp cDNA
represents the gene for the B2-aldehyde-forming enzyme from
S. commune. Unfortunately, the enzyme was secreted in a very
low expression level, as shown in Fig. 5. Analysis by SDS-PAGE showed
that the cell pellets of the pPICRAF9K transformant contained
recombinant protein (data not shown). This implies that the recombinant
protein may not be processed correctly and, hence, fails to be
secreted.
Fig. 5.
A, time course of the secretion of
B2-aldehyde-forming enzyme activity from a pPICRAF9K
transformant (filled circles) and a control transformant
with pPIC9K (open circles). B, time course for
the secretion of protein from a pPICRAF9K transformant (filled triangles) and a control transformant with pPIC9K (open
triangles).
[View Larger Version of this Image (16K GIF file)]
Overall, the present work has led to the first-time cloning,
sequencing, and expression of the cDNA encoding the enzyme that uniquely oxidizes the 5 -hydroxymethyl terminus of riboflavin. That the
enzyme is O-glycosylated in a manner that does not
significantly affect its activity may relate to its biologic function,
which could conceivably be to remove a nutrient that is essential for other organisms. Hence, as with penicillin or streptomycin production by fungi that can decrease competition for nutrients in their environment, this may be an example of the production of an enzyme for
such a purpose.
FOOTNOTES
*
This work was supported by Grant DK 38940 from the National
Institutes of Health, by the Coca-Cola Foundation, and by the Huguley
Memorial Endowment of Emory University.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF005405.
To whom correspondence and reprint requests should be addressed.
Tel.: 404-727-6737; Fax: 404-727-2738 or 3452; E-mail: mccormic{at}sph.emory.edu.
1
The abbreviations used are: PAGE, polyacrylamide
gel electrophoresis; bp, base pair(s); RACE, rapid amplification of
cDNA ends; bp, base pair(s).
REFERENCES
-
McCormick, D. B.
(1994)
in
Modern Nutrition in Health and Disease (Shils, M. E., Shike, M., and Olson, J. A., eds), 8th Ed., pp. 366-375, Lea & Febiger, Malvern, PA
-
Merrill, A. H., Jr., and McCormick, D. B.
(1980)
J. Biol. Chem.
255,
1335-1338
[Abstract/Free Full Text]
-
Oka, M., and McCormick, D. B.
(1987)
J. Biol. Chem.
262,
7418-7422
[Abstract/Free Full Text]
-
Yamada, Y., Merrill, A. H., Jr., and McCormick, D. B.
(1990)
Arch. Biochem. Biophys.
278,
125-130
[CrossRef][Medline]
[Order article via Infotrieve]
-
Horwitt, M. K., Harvey, C. C., Hills, O. W., and Liebert, E.
(1950)
J. Nutr.
41,
247-264
-
Chastain, J. L., and McCormick, D. B.
(1991)
in
Chemistry and Biochemistry of Flavins (Müller, F., ed), pp. 195-200, CRC Press, Boca Raton, FL
-
Miles, H. T., Smyrniotis, P. Z., and Stadtman, E. R.
(1959)
J. Am. Chem. Soc.
81,
1946-1951
-
Harkness, D. R., Tsai, L., and Stadtman, E. R.
(1964)
Arch. Biochem. Biophys.
108,
323-333
[Medline]
[Order article via Infotrieve]
-
Yanagita, T., and Foster, J. W.
(1956)
J. Biol. Chem.
221,
593-607
[Free Full Text]
-
Tsai, L., Smyrniotis, P. Z., and Harkness, D. R.
(1963)
Biochem. Z.
338,
561-581
[Medline]
[Order article via Infotrieve]
-
Yang, C. S., and McCormick, D. B.
(1967)
Biochim. Biophys. Acta
132,
511-513
[Medline]
[Order article via Infotrieve]
-
Ohkawa, H., Ohishi, N., and Yagi, K.
(1983)
J. Biol. Chem.
258,
5623-5628
[Abstract/Free Full Text]
-
Chastain, J. L., and McCormick, D. B.
(1987)
J. Nutr.
117,
468-475
-
Chastain, J. L., and McCormick, D. B.
(1987)
Am. J. Clin. Nutr.
46,
830-834
[Abstract/Free Full Text]
-
Roughead, Z. K., and McCormick, D. B.
(1990)
J. Nutr.
120,
382-388
-
Roughead, Z. K., and McCormick, D. B.
(1990)
Am. J. Clin. Nutr.
52,
854-857
[Abstract/Free Full Text]
-
Zempleni, J., Galloway, J. R., and McCormick, D. B.
(1996)
Int. J. Vitam. Nutr. Res.
66,
151-157
[Medline]
[Order article via Infotrieve]
-
Tachibana, S., and Murakami, T.
(1980)
Methods Enzymol.
66,
333-338
[Medline]
[Order article via Infotrieve]
-
Tachibana, S., and Oka, M.
(1981)
J. Biol. Chem.
256,
6682-6685
[Abstract/Free Full Text]
-
Tachibana, S., and Oka, M.
(1982)
J. Nutr. Sci. Vitaminol.
28,
335-342
-
Kekelidze, T. N., Edmondson, D. E., and McCormick, D. B.
(1994)
Arch. Biochem. Biophys.
315,
100-103
[Medline]
[Order article via Infotrieve]
-
Bradford, M. M.
(1976)
Anal. Biochem.
72,
248-254
[CrossRef][Medline]
[Order article via Infotrieve]
-
Kasai, S., Nakano, H., Maeda, K., and Matsui, K.
(1989)
Bull. Chem. Soc. Jpn.
62,
611-613
-
Devereux, J., Haeberli, P., and Smithies, O.
(1984)
Nucleic Acids Res.
12,
387-395
-
Romanos, M. A., Clare, J. J., Beesley, K. M., Rayment, F. B., Ballantine, S. P., Makoff, A. J., Dougan, G., Fairweather, N. F., and Charles, I. G.
(1991)
Vaccine
9,
901-906
[CrossRef][Medline]
[Order article via Infotrieve]
-
Prokop, A., Rapp, P., and Wagner, F.
(1992)
Exp. Mycol.
16,
197-206
-
Merrill, A., and McCormick, D.
(1978)
Anal. Biochem.
89,
87-102
[Medline]
[Order article via Infotrieve]
-
Merrill, A. H., Jr., and McCormick, D. B.
(1980)
J. Biol. Chem.
255,
1335-1338
-
Attwood, T. K., Beck, M. E., Bleasby, A. J., Degtyarenko, K., Michie, A. D., and Parry-Smith, D. J.
(1997)
Nucleic Acids Res.
25,
212-216
[Abstract/Free Full Text]
-
Mavrothalassitis, G., Tzimagiorgis, G., Mitsialis, A., Zannis, V., Plaitakits, A., Papamatheakis, J., and Moschonas, N.
(1988)
Proc. Natl. Acad. Sci. U. S. A.
85,
3494-3498
[Abstract/Free Full Text]
-
Moye, W. S., Amuro, N., Rao, J. K. M., and Zalkin, H.
(1985)
J. Biol. Chem.
260,
8502-8508
[Abstract/Free Full Text]
-
Okazaki, N., Hibino, Y., Asano, Y., Ohmori, M., Numao, N., and Kondo, K.
(1988)
Gene (Amst.)
63,
337-341
[CrossRef][Medline]
[Order article via Infotrieve]
-
Wiese, M., IIg, T., Lottspeich, F., and Overath, P.
(1995)
EMBO J.
14,
1067-1074
[Medline]
[Order article via Infotrieve]
-
Buckholz, R. G., and Gleeson, M. A. G.
(1991)
Bio/Technology
9,
1067-1072
[CrossRef][Medline]
[Order article via Infotrieve]
-
Cregg, J. M., Vedvick, T. S., and Raschke, W. C.
(1993)
Bio/Technology
11,
905-910
[CrossRef][Medline]
[Order article via Infotrieve]
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
D. B. McCormick
A Trail of Research on Cofactors: An Odyssey with Friends
J. Nutr.,
February 1, 2000;
130(2):
323 - 323.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
J. R. Miller and D. E. Edmondson
Influence of Flavin Analogue Structure on the Catalytic Activities and Flavinylation Reactions of Recombinant Human Liver Monoamine Oxidases A and B
J. Biol. Chem.,
August 13, 1999;
274(33):
23515 - 23525.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1997 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|