Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by IJpenberg, A.
Right arrow Articles by Desvergne, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by IJpenberg, A.
Right arrow Articles by Desvergne, B.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 32, Issue of August 8, 1997 pp. 20108-20117
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Polarity and Specific Sequence Requirements of Peroxisome Proliferator-activated Receptor (PPAR)/Retinoid X Receptor Heterodimer Binding to DNA
A FUNCTIONAL ANALYSIS OF THE MALIC ENZYME GENE PPAR RESPONSE ELEMENT*

(Received for publication, April 16, 1997, and in revised form, May 23, 1997)

Annemieke IJpenberg , Elisabeth Jeannin , Walter Wahli and Béatrice Desvergne Dagger

From the Institut de Biologie Animale, Université de Lausanne, Bâtiment de Biologie, CH-1015 Lausanne, Switzerland

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
Note Added in Proof
REFERENCES


ABSTRACT

The malic enzyme (ME) gene is a target for both thyroid hormone receptors and peroxisome proliferator-activated receptors (PPAR). Within the ME promoter, two direct repeat (DR)-1-like elements, MEp and MEd, have been identified as putative PPAR response elements (PPRE). We demonstrate that only MEp and not MEd is able to bind PPAR/retinoid X receptor (RXR) heterodimers and mediate peroxisome proliferator signaling. Taking advantage of the close sequence resemblance of MEp and MEd, we have identified crucial determinants of a PPRE. Using reciprocal mutation analyses of these two elements, we show the preference for adenine as the spacing nucleotide between the two half-sites of the PPRE and demonstrate the importance of the two first bases flanking the core DR1 in 5'. This latter feature of the PPRE lead us to consider the polarity of the PPAR/RXR heterodimer bound to its cognate element. We demonstrate that, in contrast to the polarity of RXR/TR and RXR/RAR bound to DR4 and DR5 elements respectively, PPAR binds to the 5' extended half-site of the response element, while RXR occupies the 3' half-site. Consistent with this polarity is our finding that formation and binding of the PPAR/RXR heterodimer requires an intact hinge T region in RXR while its integrity is not required for binding of the RXR/TR heterodimer to a DR4.


INTRODUCTION

The peroxisome proliferator-activated receptors (PPAR)1 form a group of lipid-activated transcription factors that belong to the nuclear receptor superfamily. Members of this superfamily are characterized by a structural organization in functional modules, comprising a N-terminal domain, a DNA binding domain, a hinge region, and a ligand binding domain that also contains a potent ligand-dependent transactivation domain and offers several interfaces for dimerization and protein-protein interaction. Although some of these receptors may bind to DNA as monomers, the majority binds as dimers to specific DNA sequences formed of two consensus half-sites. PPAR, thyroid hormone receptor (TR), vitamin D receptor (VDR), and all-trans-retinoic acid receptor (RAR) form a subgroup within the superfamily which heterodimerize with the 9-cis-retinoic acid receptor (RXR) and bind to response elements composed of two AGGTCA half-sites predominantly organized in a direct repeat. All the natural PPAR response elements (PPREs) described so far indeed consist of a direct repeat of two more or less conserved AGGTCA hexamers separated by a single base pair and are thus referred to as DR1 elements (1, 2). This organization as direct repeat imposes a head to tail polarity to the bound heterodimer complex. Recent work has shown that in the case of TR/RXR and RAR/RXR bound to a DR4 and DR5, respectively, RXR occupies the 5' half-site (3-5). However, the polarity of RAR/RXR bound to a DR1 is opposite and results in a silencing of the ligand-dependent transactivation properties of RAR (6-8). So far, the polarity of the PPAR/RXR heterodimer has not been determined.

Three different PPAR subtypes have been identified (alpha , beta /delta , and gamma ). Each of them displays a distinct expression pattern in adult amphibians and rodents. PPARalpha is predominantly expressed in hepatocytes, cardiomyocytes, proximal tubule cells of the kidney, and enterocytes. PPARbeta (also called PPARdelta or FAAR in rodents and NUCI in man) is more widely and often more abundantly expressed than PPARalpha and gamma , whereas PPARgamma is mainly restricted to the adipose tissue with some expression in spleen, retina, and hematopoietic cells (reviewed in Refs. 9 and 10). PPARs were named by virtue of their ability to be activated by peroxisome proliferators. However, new specific activators and ligands for the different PPAR subtypes are now emerging. Recent studies have shown that various fatty acids, eicosanoids, and hypolipidemic compounds, such as fibrates, directly bind to PPARalpha , beta , and gamma . In addition, PPARgamma binds antidiabetic thiazolidinediones, which lower the plasma levels of glucose, triglycerides, and insulin (reviewed in Ref. 11). Interestingly, not only can PPARgamma direct adipocyte differentiation but all the PPAR target genes identified so far are involved in major steps of fatty acid metabolism, including fatty acid transport, intracellular binding, omega - and beta -oxidation, as well as fatty acid synthesis and storage as triglycerides (reviewed in Ref. 10). Thus, the nature of the PPAR ligands together with the observation that all PPARalpha and gamma  target genes discovered so far are directly involved in lipid metabolism reinforce the novel concept of fatty acids and their derivatives acting as hormones and controlling their own fate through these specific nuclear receptors (reviewed in Refs. 12-14).

The malic enzyme (ME) gene is one of the PPAR target genes whose product is involved in lipogenesis. ME catalyzes the oxidative decarboxylation of malate to pyruvate, which results in the production of NADPH for fatty acid synthesis. Thyroid hormone (T3) leads to a pronounced stimulation of ME gene expression in the liver (15) and is involved in adipose differentiation for which ME is a late marker (16, 17). Interestingly, thyromimetic effects of hypolipidemic fibrates on ME expression in rat liver have been observed (18, 19). Since these compounds are PPAR ligands, these thyromimetic effects may be mediated by PPAR/RXR heterodimers binding to the ME promoter. We2 and others (20, 21) have identified two DR1-like elements in the ME promoter, hereafter referred to as MEp (proximal, located at bp -340/-328 with respect to the transcription initiation site) and MEd (distal, located at bp -463/-451). However, conflicting results have been reported on the respective role of these two elements in PPAR-mediated regulation of ME gene expression; Castelein et al. (20) have identified MEp and Hertz et al. (21) MEd as the functional PPRE. Our interest in the hormonal cross-talk in adipocytes between the T3 and fatty acids signaling pathways prompted us to pursue the characterization of the ME promoter with respect to PPAR-mediated gene regulation. In particular, we studied its regulation by PPARgamma , the subtype abundantly expressed in adipose tissue.

In this work, the demonstration that only MEp and not MEd is a functional PPRE gave us a tool to identify the determinants of a functional PPRE, which go beyond the characteristics of the core DR1 element. Furthermore, we unveiled the polarity of the heterodimer PPAR/RXR bound to a DR1, which explains the nature of the PPRE-specific requirements.


EXPERIMENTAL PROCEDURES

Plasmids

The Xenopus PPARgamma (1), human RXRalpha (22) and rat TRalpha 1 were subcloned into a modified pSG5, pSG5PL (gift of Dr. Hélène Richard-Foy). To optimize in vitro translation of the PPARgamma and RXRalpha receptors, a Kozak (23) consensus sequence was introduced by recombinant polymerase chain reaction at the translational start site of the receptor.

The P box mutants of PPARgamma and RXRalpha were obtained in two sequential mutagenic steps using the Kunkel et al. (24) method. The primers 5'-GCGTCCATGCATGTGGATCTTGCAAGGGGTTCTT-3' and 5'-GTGGATCTTGCAAGGTGTTCTTTAGAAGAAC-3' were used to create PPARpgr; the primers 5'-GAGTGTACAGCTGCGGGTCGTGCAAGGGCTTCTT-3' and 5'-GCGGGTCGTGCAAGGTCTTCTTCAAGCGGAC-3' were used to create RXRpgr. The primer 5'-GGCATGAAGCGGGAATTCGAGGGGGAGGAGCGGCAGCG-3' was used to create the RXR(T) mutant, using the same approach.

pME775 was created by cloning the 809-bp XbaI-BamHI fragment (bp -775/+34) of the pME882 plasmid (25) into pBLCAT3 (26). The mutant reporter plasmids pME775pko and pME775dko, in which, respectively, the proximal or the distal putative PPRE has been mutated, were generated by recombinant polymerase chain reaction using the ExpandTM High Fidelity kit (Boehringer Mannheim). The mutated sequences are as follow: within pME775dko from bp -469 to -445: TGCACTAGATCTGTCCGGTCTAACA; within pME775pko from bp -346 to -322: CATTCTAAGCTTGAGTTGATCCCCT.

The reporter constructs containing the wild-type or mutated PPREs upstream of the heterologous thymidine kinase promoter were created by cloning a single copy of the response element into the BamHI/HindIII sites of the pBL-CAT8+ plasmid. All the constructs were verified by DNA sequencing.

Cell Culture and Transfections

NIH3T3 cells were maintained in culture and transfected as described previously (27). Briefly, each cuvette for electroporation contained 4 × 106 cells at a density of 12.5 × 106 cells/ml and a total of 70 µg of plasmid DNA (20 µg of chloramphenicol acetyl transferase (CAT)-reporter plasmid, 12 µg of each expression vector as indicated in the figure legends, 1 µg of pCMVbeta gal as internal control for transfection efficiency, and pUC19 or salmon sperm DNA to complete to 70 µg). After electroporation, cells were resuspended and equally distributed in four 60-mm dishes containing the transfection medium supplemented with the appropriate activator. After 48 h, cell extracts were prepared and beta -galactosidase and CAT activities were determined as described previously (27).

Electrophoretic Mobility Shift Assays

Proteins for electrophoretic mobility shift assays (EMSA) were obtained by in vitro transcription and translation using the TNT® coupled reticulocyte lysate system (Promega). Parallel translations using [35S]methionine (Amersham Corp.) followed by SDS-PAGE analysis and exposure in the phosphor-analyst (Bio-Rad) allowed standardization of the different protein preparations. Alternatively, nuclear extracts from Sf9 cells infected with a recombinant baculovirus overexpressing the mouse RXRbeta were used.

The probes and competitors corresponded to the double-stranded oligonucleotides indicated in the figures flanked on their 5' side and 3' side by the BamHI and HindIII overhang sequence, respectively. The ACO(A) and METRE oligonucleotides are (5'-GATCCCGAACGTGACCTTTGTCCTGGTCCCGATC-3') and (5'-GATCAGGACGTTGGGGTTAGGGGAGGACAGATC-3'), respectively.

In vitro translated proteins were preincubated for 15 min at room temperature, in a buffer containing 25 mM HEPES, pH 7.5, 5 mM MgCl2, 1 mM EDTA, 10% glycerol, 40 mM KCl, 1 mM dithiothreitol, and 8 µg poly(dI-dC). After a further 20-min incubation period at room temperature in the presence of 20,000 cpm of labeled probe, the complexes were separated on a 6% native polyacrylamide gel with 0.25 × TBE running buffer at 500 V, 25 mA, 4 °C. For DNA binding competition experiments, a 10-100-fold molar excess (as indicated) of the unlabeled double-stranded competitor oligonucleotide was added to the preincubation reaction. Gels were dried and exposed at -80 °C to a Kodak X-Omat AR film with an intensifying screen. Scanning and treatment of the images were performed using the Cirrus 1.2 software. When appropriate, gels were analyzed by phosphor-analyst or densitometry.


RESULTS

The ME Promoter Contains an Element Responsive to PPARgamma

The possibility of cross-talk between PPAR and TR signaling pathways at the level of ME gene expression might be important in cells, such as adipocytes, in which all three proteins, PPAR, TR, and ME, are expressed. We thus tested if the ME promoter is responsive to PPARgamma , the PPAR subtype which is crucial for adipogenesis and is present at high levels in mature adipocytes (28, 29). As seen in the schematic representation of the ME promoter in Fig. 1A, two DR1 elements, MEp (proximal, at bp -340/-328) and MEd (distal, at bp -463/-451), are located upstream of the thyroid hormone response element METRE (27). Conflicting reports from Castelein et al. (20) and Hertz et al. (21) indicated mediation of the ME peroxisome proliferator response through either of these elements.


Fig. 1. The ME promoter contains a functional PPRE. A, schematic representation of the pME775 reporter construct. The respective position and sequence of the thyroid hormone response element (METRE) and of the DR1 elements, MEp and MEd, are given. B, the proximal element is able to mediate ligand dependent transactivation by PPAR. NIH3T3 were cotransfected with pME775, pME775pko, pME775dko, pMEpfl, or pMEdfl reporter plasmid, and either TR-encoding, PPAR-encoding, or empty expression vector as indicated (see "Experimental Procedures"). Following transfection, the cells were cultivated for 48 h in the absence of hormone (black bars) or in the presence of either 100 nM T3 (dotted bars) or 100 µM Wy 14,643 (hatched bars). CAT activity levels were standardized to beta -galactosidase expression used as transfection internal control. The basal activity of each of the reporter plasmids in the absence of receptor and activator was set to 1. Means ± S.D. of at least three independent experiments are shown. C, specificity of PPAR/RXR binding to MEpfl. Radioactively labeled MEpfl was incubated with PPAR expressed in rabbit reticulocyte lysate and RXRbeta expressed in Sf9 cells by a recombinant baculovirus (lanes 2-14). Competition was performed with 10-, 50-, and 100-fold molar excess of unlabeled MEpfl (lanes 3-5), ACO(A) PPRE (lanes 6-8), METRE (lanes 9-11), or MEdfl (lanes 12-14). Lane 1 is the probe incubated with unprogrammed lysate.
[View Larger Version of this Image (33K GIF file)]

To clarify this point, we first tested whether the ME promoter, from -775 to +34 base pairs relative to the initiation site was responsive to PPARgamma and, as a positive control, to TR. Transfection analyses using a CAT reporter gene in NIH3T3 cells confirm that TRalpha 1 can control the ME promoter, as a T3-dependent 7-fold stimulation of the reporter gene expression was observed. Cotransfection of the reporter gene with a vector expressing PPARgamma in the absence of PPAR activator moderately but reproducibly induced expression of the reporter gene (2.5-fold). Whether this induction was due to a constitutive activity of PPARgamma or to endogenous PPAR activators was not further analyzed. Addition of the PPAR activator Wy 14,643 to the culture medium resulted in a 5.5-fold stimulation over the basal expression level of the reporter construct. A similar induction was obtained using the thiazolidinedione BRL49653, a PPARgamma specific ligand (data not shown). These effects are receptor-specific, since T3 and Wy 14,643 stimulated the ME promoter activity only in the presence of TR and PPAR, respectively (Fig. 1B).

Second, we determined the relative contribution of the two putative PPREs to PPARgamma responsiveness. For that purpose, we first mutated either the MEd or the MEp sequence within the homologous promoter creating pME775dko and pME775pko, respectively. The mutation of the MEd sequence did not alter the response of the reporter gene to Wy 14,643, while mutation of MEp suppressed responsiveness, indicating that MEp is the responsive element (Fig. 1B; see also Castelein et al. (20)). To test if this result was independent of the position or relative orientation of each of these elements within the ME promoter (see Fig. 1A), we inserted, in the same orientation, the two elements encompassing the DR1 motif plus their 6 bp flanking either side, upstream of the herpes simplex virus thymidine kinase heterologous promoter in a CAT reporter gene. pMEpfl, containing the proximal element, and pMEdfl, containing the distal element, were then transfected into NIH3T3 cells. As shown in Fig. 1B, PPARgamma increased the basal level of pMEpfl expression 7-fold in the absence of an exogenous PPAR activator, and 28-fold in the presence of Wy 14,643. In contrast, pMEdfl was not responsive to PPARgamma , neither in the absence nor in the presence of Wy 14,643 (Fig. 1B). No response of either reporter construct was observed in presence of TR and T3 (data not shown).

To test if the above reported difference in PPAR responsiveness of MEp and MEd reflects their ability to bind PPAR/RXR heterodimers, we performed EMSAs. We used MEpfl as a probe, in vitro translated PPARgamma , and cellular extracts from Sf9 cells infected by a recombinant baculovirus expressing RXRbeta . Fig. 1C shows that PPARgamma /RXR binding complex could form on MEpfl, whereas no PPAR binding was observed in absence of RXR (data not shown). Unlabeled double-stranded oligonucleotides encompassing either the PPRE of the acyl-CoA oxidase gene (ACO(A)) or MEpfl itself efficiently competed PPAR/RXR complex formation on the probe MEpfl, whereas MEdfl, which was unresponsive in the functional test, was a very inefficient competitor. As expected, METRE did not compete for the PPAR/RXR complex binding.

These data show that of the two DR1 elements present in the ME promoter, only the MEp is able to bind PPARgamma /RXR heterodimers in a sequence-specific manner and can mediate peroxisome proliferator signaling.

Conversion of MEd to a Functional PPRE; Role of the DR1 Spacing Nucleotide and of Flanking Nucleotides

The inability of MEd to act as PPRE was puzzling since its sequence is closer to the consensus DR1 than that of the functional element MEp. Analysis of the compilation of the natural PPREs characterized so far (Fig. 2) and recent reports suggested that two regions of the PPRE may be given particular attention: the spacing nucleotide between the two half-sites which is predominantly an A and the sequence immediately 5' upstream of the DR1 core element (Fig. 2) (13, 31, 32).3 In contrast to MEp, MEd strikingly diverges from the consensus in these two regions suggesting that these differences might be responsible for the lack of responsiveness of MEd to PPARgamma and Wy 14,643. The role of the spacing nucleotide was first analyzed by changing the spacing nucleotide A of MEpfl to either G, C, or T, resulting in the MEp(G), MEp(C), and MEp(T) elements, respectively (see Fig. 3A). The presence of an A as in MEpfl reproducibly resulted in the strongest binding, while a C at this position always resulted in the weakest interaction (Fig. 3A). Notably, the nonfunctional sequence MEd has a C at the corresponding spacing position. Thus, we introduced the converse mutation in MEd, changing its spacing nucleotide from a C to an A, and observed a partial restoration of PPARgamma /RXR binding (MEd(DR-A); Fig. 3B). The inability of MEdfl to function as a PPRE might also be determined by the 5'-flanking nucleotides: TTCT in MEp versus TTAG in MEd. Indeed, transversion of AG to CT, creating MEd(CT), enhances the formation of PPARgamma ·RXR complexes. Finally, combination of the mutations in the two regions, the spacing and the 5'-flanking nucleotides, in MEd(CTA) had a synergistic effect on PPARgamma /RXR binding (Fig. 3B), which was comparable to that observed on MEpfl.


Fig. 2. Native PPREs. Alignment of the 19 native PPREs characterized so far. Based on this alignment, the relative frequencies of the 4 bases for the different positions are given in the table below, and the derived consensus sequence is indicated in bold. The bases found in MEd, which is not functional in our assay and therefore not part of the list, are underlined. This compilation emphasizes the critical positions 3, 4, 11, and 17, where the corresponding nucleotides found in MEd (A, G, C, and C, respectively, identified by superscript d) are poorly represented in the functional PPREs, while the ones found in MEp (C, T, A, and A, respectively, identified by superscript p) are well represented. ME, malic enzyme; ACO/ACOX, acyl-CoA oxidase (1, 2, 59-61); ACS, acyl-CoA synthase (62); Apo A-II, apolipoprotein A-II (63); ApoC-III, apolipoprotein C-III (44, 65); aP2, adipocyte lipid-binding protein (66); Cyp4A, microsomal omega -fatty acid hydroxylase (59, 67, 68); HD, enoyl-CoA hydratase/3-OH-acyl-CoA dehydrogenase or bifunctional enzyme (59, 69, 70); L-FABP, liver fatty acid binding protein (71); LPL, lipoprotein lipase (72); MCAD, medium chain acyl-CoA dehydrogenase (73); MTHMGS, mitochondrial 3-hydroxy-3-methylglutaryl-CoA synthase (74); PEPCK, phosphoenolpyruvate carboxykinase (75); UCP, brown adipocyte uncoupling protein (76).
[View Larger Version of this Image (27K GIF file)]


Fig. 3. Mutational analyses of MEp and MEd. Mutations in MEpfl and MEdfl are indicated in the left part of panels A and B, respectively. The corresponding oligonucleotides were radiolabeled and incubated with standardized amounts of either Sf9 expressed recombinant RXRbeta alone, rabbit reticulocyte lysate expressed PPAR alone, or a combination of RXRbeta and PPAR, as indicated. A, mutation analysis of the spacing nucleotide in MEpfl. B, mutation analysis of the spacing and 5'-flanking nucleotides in Medfl. MEpfl is shown for a direct comparison of the efficiency of PPAR/RXR binding to the various elements. C, functional analysis of the mutated elements. NIH3T3 cells were cotransfected as indicated (see "Experimental Procedures"). Following transfection, the cells were cultivated for 48 h in the absence (black bars) or in the presence of 100 µM Wy 14,643 (hatched bars). CAT activity levels were standardized to beta -galactosidase expression used as transfection internal control and expressed as a function of the basal activity of the pMEpfl reporter plasmid in the absence of receptor and activator. The transactivation pattern of the MEpfl and MEdfl reporter genes are presented again for a direct comparison. Means ± S.D. of at least three independent experiments are shown. *Student's t test p value = 0.073.
[View Larger Version of this Image (31K GIF file)]

To correlate PPAR binding affinity and transcriptional activity, MEp(C) and the MEd mutants were inserted upstream of the herpes simplex thymidine kinase promoter and used as reporter constructs in cotransfection experiments (Fig. 3C). Compared with MEpfl, MEp(C) lost most of its capacity to mediate PPARgamma induction. While the mutants MEd(DR-A) and MEd(CT) did not confer a PPAR responsiveness to the reporter gene, the double mutant MEd(CTA) mediated a PPAR-dependent increase of the basal level of expression, which was further induced by Wy 14,643. This transactivation pattern of MEd(CTA) correlates well with its capacity to bind PPAR/RXR and closely resembled that observed with MEpfl, confirming the importance of both the central adenylate and the 5' flank in defining a PPRE.

The Relative Importance of the 5'-Flanking Sequences Depends on the Core DR1

Previous work on PPREs stressed their DR1-type structure, particularly since a synthetic perfect DR1 core sequence exhibits a high PPAR/RXR binding affinity. The newly discovered role of the 5' flank in native elements raises the question as to whether it mainly compensates for a weak interaction of the heterodimer with imperfect DR1 core sequences as found in native elements (see Fig. 2). In that respect, the poorly conserved 3' half-site (AGTTGA) of the MEp PPRE is an excellent example. To answer the above question, we assessed the importance of the flanking sequences for PPAR/RXR binding both in the context of the native MEp and that of a perfect synthetic DR1 element. EMSAs, as the one shown in Fig. 4, demonstrate that PPAR/RXR binding to MEp is 80% less efficient (mean of two independent experiments) when its specific 5' flank is mutated. In contrast, binding to the perfect DR1 is affected to a lesser extent by the sequence of the 5' flank, exhibiting a 26% loss of binding efficiency in presence of the mutated versus the wild-type 5' MEp flank (mean of three independent experiments). This result reinforces the hypothesis that the 5'-flanking sequence does play a role in the specific DNA recognition by PPAR, as PPAR/RXR heterodimer; together with an imperfect core DR1, it contributes to selective binding of PPAR (see "Discussion").


Fig. 4. Analysis of the importance of the flanking nucleotides for a functional PPRE. Comparative analysis of PPAR/RXR binding to the native MEp DR1 core sequence and to a perfect synthetic DR1 element, flanked in 5' with either the 6 bp flanking the native MEp (Mepfl and DR1fl) or 6 unrelated bp (MEp and DR1). Each radiolabeled probe was incubated with standardized amounts of both rabbit reticulocyte lysate expressed RXRalpha and PPAR, as indicated.
[View Larger Version of this Image (55K GIF file)]

Polarity of the PPARgamma /RXR Complex on MEp

Based on the results described above, we hypothesized that PPAR may bind to the extended 5' half-site of a PPRE, while RXR binds to the 3' hexamer. To determine the PPAR/RXR binding polarity, we converted the P box of PPAR and of RXR, into that of the glucocorticoid receptor (GR), creating PPARpgr and RXRpgr, respectively (Fig. 5A). Such hybrid receptors will recognize the consensus hexamer -AGAACA- of the GR response element (GRE) (3, 4). Consequently, we tested in EMSA two hybrid MEp elements in which either the 5' hexamer or the 3' hexamer was replaced by a GRE half-site, giving MEpfl:GRE5' and MEpfl:GRE3', respectively (Fig. 5A). The formation of PPAR/RXR complex was barely detectable either on MEpfl:GRE5' or on MEpfl:GRE3' (Fig. 5A, compare lane 1 to lanes 5 and 9). In contrast, the combination of PPAR and RXRpgr led to the formation and binding of a complex to MEpfl:GRE3' but neither to MEpfl nor to MEpfl:GRE5' (Fig. 5A, compare lane 6 to lanes 2 and 10). This result suggested that RXR indeed binds to the 3' half-site of the PPRE. As expected, the heterodimer PPARpgr/RXR did not bind to MEpfl:GRE3' (Fig. 5A, lane 7); however, it was not able to bind to MEpfl:GRE5' either (Fig. 5A, lane 11). As shown in the top panel of Fig. 5, that latter probe associates a GRE half-site -AGAACA- in 5' and the poorly conserved MEp 3' half-site -AGTTGA-. Thus, it is likely that the divergence of the overall sequence of MEpfl:GRE5' from a DR1-like element is too important to accommodate nuclear receptor binding.


Fig. 5. Polarity of the PPAR/RXR complex on its binding site. A and B, binding of standardized amounts of rabbit reticulocyte lysate expressed wild-type (PPAR and RXR) and mutant (PPARpgr and RXRpgr) receptors to radiolabeled PPREs and chimeric PPRE:GRE elements depicted at the top of the each panel. In DR1, the 6-bp flanking the core sequence in 5' correspond to the mutated sequence used in Fig. 4. Schematic representations of the DNA binding domains of the mutant and wild-type receptors are depicted at the top of the panel A. C, functional analysis of the polarity of the PPAR/RXR complex. NIH3T3 cells were cotransfected with reporter constructs and expression vectors, as indicated. Following transfection, the cells were cultivated for 48 h in the absence of hormone (black bars) or in the presence of 100 µM Wy 14,643 (hatched bars). CAT activity levels were standardized to beta -galactosidase expression used as transfection internal control. The basal activity of the pMEpfl reporter plasmid in the absence of receptor and activator was set to 1. Means ± S.D. of at least three independent experiments are shown.
[View Larger Version of this Image (37K GIF file)]

To circumvent this experimental limitation, we repeated the same experiment using the synthetic element DR1fl and chimeric response elements in which we introduced a GRE half-site in place of the 5' hexamer or of the 3' hexamer giving DR1fl:GRE5' and DR1fl:GRE3', respectively (Fig. 5B). Very clearly, the PPAR/RXRpgr heterodimer bound to DR1fl:GRE3' but not to DR1fl:GRE5' (Fig. 5B, lanes 11 and 7, respectively), whereas PPARpgr/RXR heterodimer bound to DR1fl:GRE5' but not to DR1fl:GRE3' (Fig. 5B, lanes 8 and 12, respectively). In other words, the complex that contained the mutant PPARpgr could form only on the response element that bears the GRE sequence in the 5' position while the complex containing the mutant RXRpgr could form only on the element with the GRE sequence in the 3' position. Together these results provide evidence for a defined binding polarity of the PPAR/RXR heterodimer onto its response element, with PPAR anchored to the 5' extended half-site and RXR to the 3' half-site. Interestingly, the role of the 5'-flanking sequences clearly appeared in the context of the mutant receptors and mutant PPREs, as exemplified by PPAR/RXR and PPARpgr/RXR which bound to DR1fl:GRE5' with a greater efficiency than to DR1:GRE5' (Fig. 5B, compare lane 6 to lane 18 and lane 8 to lane 20; see "Discussion").

In agreement with these binding studies, PPARpgr was unable to activate the expression of the MEpfl reporter construct while it could efficiently activate the reporter DR1fl:GRE5' (Fig. 5C). Cotransfection of RXRpgr with either of these reporter genes strongly inhibited the PPARgamma -induced expression, suggesting a dominant negative effect of this mutant receptor. In contrast, the reporter construct that contains the GRE at the 3' half-site was not activated by PPARpgr, was poorly activated by PPAR in presence of the endogenous RXR, but was significantly stimulated if RXRpgr is cotransfected with PPAR (Fig. 5C). Thus, these functional studies further confirmed the binding polarity of PPAR/RXR to PPRE.

Dimerization Interface in PPAR/RXR Interactions

The binding polarity of PPAR/RXR onto a PPRE should be reflected in the dimerization surface used by each partner. Structural and biochemical analyses of nuclear receptor heterodimers bound to direct repeat elements demonstrate that the second zinc finger of the receptor which binds to the 5' half-site contacts the T box and the first zinc finger of the receptor which binds to the 3' half-site (3-5, 32-37). Hence we mutated 3 amino acids in the T box of RXR, creating RXR(T) (Fig. 6). These mutations should affect the function of RXR as the 3'-binding receptor and thus the formation and binding of the heterodimer PPAR/RXR to a PPRE such as MEp. In contrast, they should not alter the function of RXR as the 5'-binding receptor, and consequently still allow the formation and binding of the complex RXR/TR on a TRE such as the METRE. Indeed, as seen in Fig. 6, PPAR is not able to bind MEp when using RXR(T) as partner while a complex corresponding to the heterodimer TR/RXR(T) can form on METRE albeit with a weaker affinity than TR/RXR (Fig. 6, lanes 3 and 6, respectively). These results are clearly consistent with the polarity that we demonstrate for the PPAR/RXR complex bound to PPRE and further suggest that the T region of RXR is involved in the dimerization surface between RXR and PPAR.


Fig. 6. An intact RXR T box is required for the interaction of RXR with PPAR. Binding analysis of wild-type PPAR or TR with either RXR or RXR(T) to MEpfl and METRE. Radiolabeled probes, as indicated, were incubated with standardized amounts of rabbit reticulocyte translated wild-type or mutant receptors. A schematic representation of the DNA binding domain indicating the position of the T box is shown at the top.
[View Larger Version of this Image (30K GIF file)]


DISCUSSION

The analysis of the regulation by peroxisome proliferators of the ME promoter led us to a better understanding of the molecular mechanisms governing PPAR-mediated gene regulation. First, the observation that in our experimental model, only the proximal DR1 sequence located at -340/-328 (MEp) can function as a PPRE, while the element -451/-463 (MEd) does not, prompted us to further analyze the structural definition of a PPRE. Our results add the following three main properties of native PPREs to the initial definition as DR1: (i) an extended 5' half-site, (ii) an imperfect core DR1, and (iii) an adenine as a spacing nucleotide between the two hexamers. Second, we provide evidence that this PPRE structure reflects the polarity with which PPAR/RXR binds to the element: PPAR recognizes the 5' extended half-site and RXR the 3' half-site.

Specificity and Promiscuousness of PPRE and DR1 Elements

Binding of PPAR/RXR to DR1-like elements raises the question of the selectivity of this interaction since these elements are binding sites for several members of the nuclear receptor superfamily. DR1 elements were shown to mediate 9-cis-retinoic acid responsiveness through binding of RXR homodimers, as first demonstrated on the cellular retinol binding protein II element (CRBP-II) (38). Moreover, an unbiased search for RXRE as well as analyses of synthetic elements revealed the importance of an A or a G as the base immediately 5' of perfect core hexanucleotides in a DR1 configuration (39-42). Interestingly, however, no or very weak binding of RXR homodimer was observed in previous work describing naturally occurring PPREs, indicating that discriminating parameters must account for RXR homodimer and PPAR/RXR heterodimer selectivity. In addition, DR1 elements are also binding sites for at least three orphan members of the nuclear receptor superfamily: HNF-4, ARP-1, and ear-3 (or COUP-TF), the most promiscuous response element being a synthetic DR1-G element, in which the two consensus hexamer are flanked by a G in 5' (see Ref. 41 and references therein). Competition for binding and functional interference can indeed occur between PPAR/RXR and HNF4 (43, 44) as well as between PPAR/RXR and COUP-TF (45, 46). However, the native HNF4 binding site characterized in the alpha 1-antitrypsine gene only poorly fits the DR1 consensus and binds neither COUP-TF nor ARP1 (47). Again this underscores that subtle differences in the natural DR1-type response elements must be important for their selectivity. The alignment in Fig. 2 of the sequence of 19 native PPREs previously characterized, with the number of occurrences for each nucleotide at each position (from 1 to 17) presented in the bottom panel, reveals specific characteristics of native PPREs. DR1 motifs clearly appear between position 5 and 17, with an obvious lack of nucleotide preference only at a single position (nucleotide 8), while the spacing nucleotide between the half-sites (position 11) is remarkably conserved. Our mutation analyses show that indeed an adenine as the spacing base results in the strongest heterodimer binding, whereas cytidine is the least desirable of the four possibilities at that position. A certain degree of conservation is also present in the 5'-flanking nucleotides (AACT, position 1-4), suggesting a potential role for this region. Herein, we demonstrate that the nucleotides in positions 3 and 4 extend the 5' half-site and are an integral part of the PPRE, in agreement with recent work done with the PPRE of the CYP4A6 gene (31). Importantly, the role of the 5'-flanking sequence is especially apparent when the DR1 sequence is poorly conserved with respect to a perfect DR1, as for MEp and MEpfl (Fig. 4) but also as in the chimeric elements DR1:GRE5' and DR1fl:GRE5' (Fig. 5B). The same applies when RXR itself binds poorly because it has been altered, as in RXRpgr, leading to a PPAR/RXRpgr complex that binds to DR1fl but not to DR1. Thus, it appears that a weakened interaction of PPAR/RXR with the core DR1 is tolerated as long as specific contacts in the 5' flank can stabilize it. These results clearly plead for the importance of the association of a specific 5'-flanking sequence, an imperfect core DR1, and a central adenine as structural characteristics allowing the discrimination of PPRE from other DR1 response elements by the PPAR/RXR heterodimer.

Polarity of the DNA-bound PPAR/RXR Heterodimer

Consistent with the discriminatory role of the PPRE 5' flank, we demonstrated that PPAR binds to the extended 5' half-site of the PPRE, while RXR binds to the 3' hexamer. This is in contrast to the RXR/VDR, RXR/TR, and RXR/RAR heterodimers which bind with the reverse polarity to DR3, DR4, and DR5, respectively (3-5), but is in register with the RAR/RXR complex bound to a DR1 (6-8). Asymmetric contacts operating between the two partners of a heterodimer bound to a direct repeat occur between their respective DNA binding domain (DBD) and carboxyl-terminal extension (CTE) that comprises the T box and A box. The hinge region, which also includes the CTE, would allow adequate rotation of the interacting ligand binding domains with respect to the DBD (reviewed in Refs. 49 and 50). While the three-dimensional structure of the DBD and CTE region of PPAR has not yet been solved, some of its properties can be inferred from the polarity to which PPAR binds to PPRE and from detailed biochemical studies and structural analyses of RAR/RXR and TR/RXR heterodimers bound to direct repeat sequences (3-5, 32-37). In the configuration of an RAR/RXR heterodimer bound to a DR1 element, the crucial amino acids for heterodimerization of the 5'-positioned receptor (RAR) are located in the second zinc finger outside its first knuckle or D box while the 3'-positioned receptor (RXR) contributes to the dimerization interface via its T box. Exclusion from the dimerization interface of the D box of the 5'-positioned receptor could explain why PPARs have a D box of 3 amino acids instead of 5 in other members of the superfamily. Consistently, exchanging this D box with that of RXR did not alter PPAR/RXR binding to a PPRE.4

Because of the 5' location of the PPAR molecule on a PPRE, its T/A region may be involved in the recognition of the 5' extension of the PPRE half-site. This has been described for receptors which can bind extended half-sites as monomers such as FTZ-F1, NGFI-B/Nurr1, ROR/RZR, Rev-erbalpha , and TRalpha 1. Their recognition of the base pairs extending the consensus hexamer in 5' involves critical amino acids in their respective CTE region (48, 50-55). In PPARs the corresponding region is highly conserved between the different subtypes but differs from the other above mentioned receptors. The closest similarity to PPAR within this region is found in ROR/RZR and Rev-erbAalpha , which correlates with the closest 5'-extended sequence similarity of their respective response elements (see Fig. 7). However, in contrast to these latter receptors, PPAR is unable to bind as a monomer.


Fig. 7. Alignment of the T/A regions of different receptors which recognize an extended half-sites. In the extended half-sites, shown on the left, the additional bases with respect to the consensus core hexanucleotide are indicated in bold. Descriptions of the consensus sequences for the additional bases are from: Rev-ErbAalpha (53), RZRalpha /RORalpha (54), rTRalpha 1 (52), NGF1-B (Nurr1) (50), FTZ-F1 (51). Peptide sequences of the cognate receptor region involved in the specific recognition of these additional bases, are aligned starting at the end of helix 2, as defined for the glucocorticoid and estrogen receptors (77, 78). Identical residues are boxed. For comparison the T/A region of RXR is shown; the three amino acids that are mutated in RXR(T) are underlined.
[View Larger Version of this Image (25K GIF file)]

The polarity of PPAR/RXR onto the direct repeat may also explain the spacing of 1 nucleotide between the two half-sites of the PPRE. Indeed, VDR, TR, and RAR by occupying the 3' half-site of DR3, DR4, and DR5 respectively, dictate the spacing that provides the specificity of their respective response element, since all of them have the same partner RXR. Accordingly, RXR on the 3' half-site of RXRE and PPRE elements dictates the common spacing of 1 nucleotide, likely through physical constraints residing in the role of its T region as dimerization surface. One consequence of this reasoning is that if RXR binds to the 3' half-site, as it does in the context of the RAR/RXR, PPAR/RXR and RXR/RXR dimers, selectivity cannot be conferred by spacing. Instead, like PPAR, the heterodimerization partner might select a specific 5' extended half-site, allowing discrimination between DR1 elements.

Elucidating the polarity with which nuclear receptors bind to their cognate response elements is not only important for understanding the molecular mechanism of DNA-protein interaction and of dimerization properties, but it may give insight into some functional aspects of receptor activation by the ligand and of transactivation. Along this line of thought, Kurokawa et al. (7) recently demonstrated that in the context of the DR1-bound RAR/RXR complex, RAR fails to release NCoR in the presence of ligand, suggesting a molecular mechanism for the repression caused by RAR/RXR complexed to a DR1. How do co-activators and co-repressors interact with each receptor within a PPAR/RXR heterodimer and how do the respective ligands influence these interactions remain to be solved. Interestingly, cooperativity in PPAR and RXR signaling pathways is also mediated by PPRE, as demonstrated by the additive and synergistic transcriptional effect of their respective ligands in cell culture (56, 57) and in vivo (58). In that respect, our detailed characterization of the ME PPRE unveils some critical mechanisms by which PPAR can achieve functional specificity and as such is a first step toward the understanding of the molecular mechanisms underlying cooperativity and hormonal cross-talk via the ME promoter.


FOOTNOTES

*   This work was supported by the Etat de Vaud and by grants from the Swiss National Science Foundation (to W. W. and B. D.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Dagger    To whom correspondence should be addressed: Tel.: 41 21 692 41 40; Fax: 41 21 692 41 15; E-mail: beatrice.desvergne{at}iba.unil.ch.
1   The abbreviations used are: PPAR, peroxisome proliferator-activated receptor; TR, thyroid hormone receptor; RXR, retinoid X receptor; RAR, retinoic acid receptor; GR, glucocorticoid receptor; VDR, vitamin D receptor; PPRE, PPAR response element; TRE, TR response element; GRE, GR response element; RXRE, RXR response element; DR1, DR4, DR5, direct repeat with 1-, 4-, or 5-bp spacing, respectively; ME, malic enzyme; DBD, DNA binding domain; CTE, carboxyl-terminal extension; CAT, chloramphenicol acetyl transferase; T3, thyroid hormone; EMSA, electrophoretic mobility shift assay; bp, base pair(s). For target gene abbreviations, see the legend to Fig. 2.
2   A. IJpenberg, E. Jeannin, W. Wahli, and B. Desvergne, unpublished results.
3   Juge-Aubry, A. Pernin, A. G. Burger, W. Wahli, C. A. Meier, and B. Desvergne, submitted for publication.
4   G. Krey and W. Wahli, unpublished observations.

ACKNOWLEDGEMENTS

We thank H. Richard-Foy and A. Hihi for the gift of pSG5-PL and RXR-containing Sf9 cellular extracts, respectively. We also thank E. Beale for reading the manuscript.


Note Added in Proof

Peroxisome proliferator-activated receptors and retinoic acid receptors differentially control the interactions of retinoid X receptor heterodimers with ligands, coactivators, and corepressors (64).


REFERENCES

  1. Dreyer, C., Krey, G., Keller, H., Givel, F., Helftenbein, G., and Wahli, W. (1992) Cell 68, 879-887 [CrossRef][Medline] [Order article via Infotrieve]
  2. Tugwood, J. D., Issemann, I., Anderson, R. G., Bundell, K. R., McPheat, W. L., and Green, S. (1992) EMBO J. 11, 433-439 [Medline] [Order article via Infotrieve]
  3. Perlmann, T., Rangara, P. N., Umesono, K., and Evans, R. M. (1993) Genes Dev. 7, 1411-1422 [Abstract/Free Full Text]
  4. Kurokawa, R., Yu, V. C., Näär, A., Kyakumoto, S., Han, Z., Silverman, S., Rosenfeld, M. G., and Glass, C. K. (1993) Genes Dev. 7, 1423-1435 [Abstract/Free Full Text]
  5. Zechel, C., Shen, X.-Q., Chen, J.-Y., Chen, Z.-P., Chambon, P., and Gronmeyer, H. (1994) EMBO J. 13, 1425-1433 [Medline] [Order article via Infotrieve]
  6. Kurokawa, R., DiRenzo, J., Boehm, M., Sugarman, J., Gloss, B., Rosenfeld, M. G., Heyman, R. A., and Glass, C. K. (1994) Nature 371, 528-531 [CrossRef][Medline] [Order article via Infotrieve]
  7. Kurokawa, R., Soderstrom, M., Horlein, A., Halachmi, S., Brown, M., Rosenfeld, M. G., and Glass, C. K. (1995) Nature 377, 451-454 [CrossRef][Medline] [Order article via Infotrieve]
  8. Forman, B. M., Umesono, K., Chen, J., and Evans, R. M. (1995) Cell 81, 541-550 [CrossRef][Medline] [Order article via Infotrieve]
  9. Lemberger, T., Desvergne, B., and Wahli, W. (1996) Annu. Rev. Cell Dev. Biol. 12, 335-363 [CrossRef][Medline] [Order article via Infotrieve]
  10. Wahli, W., Braissant, O., and Desvergne, B. (1995) Chem. Biol. 2, 261-266 [CrossRef][Medline] [Order article via Infotrieve]
  11. Willson, T. M., and Wahli, W. (1997) Curr. Opin. Chem. Biol., in press
  12. MacDougald, O. A., and Daniel Lane, M. (1995) Annu. Rev. Biochem. 64, 345-373 [CrossRef][Medline] [Order article via Infotrieve]
  13. Desvergne, B., and Wahli, W. (1995) in Inducible Gene Expression (Baeuerle, P. A., ed), Vol. 1, pp. 142-176, Birkhäuser, Boston
  14. Green, S., and Wahli, W. (1994) Mol. Cell. Endocrinol. 100, 149-153 [CrossRef][Medline] [Order article via Infotrieve]
  15. Dozin, B., Magnuson, M. A., and Nikodem, V. M. (1986) J. Biol. Chem. 261, 10290-10292 [Abstract/Free Full Text]
  16. Teboul, M., Bismuth, J., Gharbi-Chihi, J., Vallette, A., Bonne, J., Ghiringhelli, O., and Torresani, J. (1992) Endocrinology 130, 1475-1482 [Abstract/Free Full Text]
  17. Garcia-Jimenez, C., Hernandez, A., Obregon, M. J., and Santisteban, P. (1993) Endocrinology 132, 1537-1543 [Abstract/Free Full Text]
  18. Hertz, R., Aurbach, R., Hashimoto, T., and Bar-Tana, J. (1991) Biochem. J. 274, 745-751
  19. Castelein, H., Declerq, P. E., Mannaerts, G. P., and Baes, M. I. (1993) FEBS Lett. 332, 24-26 [CrossRef][Medline] [Order article via Infotrieve]
  20. Castelein, H., Gulick, T., Declercq, E. P., Mannaerts, G. P., More, D. D., and Baes, M. I. (1994) J. Biol. Chem. 269, 26754-26758 [Abstract/Free Full Text]
  21. Hertz, R., Nikodem, V., Ben-Ishai, A., Berman, I., and Bar-Tana, J. (1996) Biochem. J. 319, 241-248
  22. Jansen, J. H., Mahfoudi, A., Rambaud, S., Lavau, C., Wahli, W., and Dejean, A. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 7401-7405 [Abstract/Free Full Text]
  23. Kozak, M. (1984) Nature 308, 241-246 [CrossRef][Medline] [Order article via Infotrieve]
  24. Kunkel, T. A., Roberts, J. D., and Zakour, R. A. (1987) Methods Enzymol. 154, 367-382 [Medline] [Order article via Infotrieve]
  25. Morioka, H., Tennyson, G. E., and Nikodem, V. M. (1988) Mol. Cell. Biol. 8, 3542-3545 [Abstract/Free Full Text]
  26. Luckow, B., and Schütz, G. (1987) Nucleic Acids Res. 15, 5490 [Free Full Text]
  27. Desvergne, B., Petty, K. J., and Nikodem, V. M. (1991) J. Biol. Chem. 266, 1008-1013 [Abstract/Free Full Text]
  28. Tontonoz, P., Hu, E., Graves, R. A., Budavari, A. I., and Spiegelman, B. M. (1994) Genes Dev. 8, 1224-1234 [Abstract/Free Full Text]
  29. Braissant, O., Foufelle, F., Scotto, C., Dauça, M., and Wahli, W. (1996) Endocrinology 137, 354-366 [Abstract]
  30. Deleted in proofDeleted in proof
  31. Palmer, C. N. A., Hsu, M.-H., Griffin, K. J., and Johnson, E. F. (1995) J. Biol. Chem. 270, 16114-16121 [Abstract/Free Full Text]
  32. Mader, S., Chen, J. Y., Chen, Z. P., White, J., Chambon, P., and Gronemeyer, H. (1993) EMBO J. 12, 5029-5041 [Medline] [Order article via Infotrieve]
  33. Lee, M. S., Kliewer, S. A., Provencal, J., Wright, P. E., and Evans, R. M. (1993) Science 260, 1117-1121 [Abstract/Free Full Text]
  34. Towers, T. L., Luisi, B. F., Asianov, A., and Freedman, L. P. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 6310-6314 [Abstract/Free Full Text]
  35. Predki, P. F., Zamble, D., Sarkar, B., and Giguère, V. (1994) Mol. Endocrinol. 8, 31-39 [Abstract/Free Full Text]
  36. Zechel, C., Shen, X.-Q., Chambon, P., and Gronemeyer, H. (1994) EMBO J. 13, 1414-1424 [Medline] [Order article via Infotrieve]
  37. Rastinejad, F., Perlmann, T., Evans, R. M., and Sigler, P. B. (1995) Nature 375, 203-211 [CrossRef][Medline] [Order article via Infotrieve]
  38. Mangelsdorf, D. J., Umesosno, K., Kliewer, S. A., Borgmeyer, U., Ong, E. S., and Evans, R. M. (1991) Cell 66, 555-561 [CrossRef][Medline] [Order article via Infotrieve]
  39. Dowhan, D. H., Downes, M., Sturm, R. A., and Muscat, G. E. O. (1994) Endocrinology 135, 2595-2607 [Abstract]
  40. Nakshatri, H., and Chambon, P. (1994) J. Biol. Chem. 269, 890-902 [Abstract/Free Full Text]
  41. Chen, H., and Privalsky, M. L. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 422-426 [Abstract/Free Full Text]
  42. Castelein, H., Janssen, A., Declercq, P. E., and Baes, M. (1996) Mol. Cell. Endocrinol. 119, 11-20 [CrossRef][Medline] [Order article via Infotrieve]
  43. Winrow, C. J., Marcus, S. L., Miyata, K. S., Zhang, B., Capone, J. P., and Rachubinski, R. A. (1994) Gene Expr. 4, 53-62 [Medline] [Order article via Infotrieve]
  44. Hertz, R., Bishara-Shieban, J., and Bar-Tana, J. (1995) J. Biol. Chem. 270, 13470-13475 [Abstract/Free Full Text]
  45. Baes, M., Castelein, H., Desmet, L., and Declercq, P. E. (1995) Biochem. Biophys. Res. Commun. 215, 338-345 [CrossRef][Medline] [Order article via Infotrieve]
  46. Miyata, K. S., Zhang, B., Marcus, S. L., Capone, J. P., and Rachubinski, R. A. (1993) J. Biol. Chem. 268, 19169-19172 [Abstract/Free Full Text]
  47. Ladias, J. A. A., and Karathanasis, S. K. (1991) Science 251, 561-565 [Abstract/Free Full Text]
  48. Glass, K. C. (1994) Endocr. Rev. 15, 391-407 [Abstract/Free Full Text]
  49. Desvergne, B. (1994) Mol. Cell. Endocrinol. 100, 125-131 [CrossRef][Medline] [Order article via Infotrieve]
  50. Wilson, T. E., Paulsen, R. E., Padgett, K. A., and Milbrandt, J. (1992) Science 256, 107-110 [Abstract/Free Full Text]
  51. Ueda, H., Sun, G. C., Murata, T., and Hirose, S. (1992) Mol. Cell. Biol. 12, 5667-5672 [Abstract/Free Full Text]
  52. Katz, R. W., and Koenig, R. J. (1993) J. Biol. Chem. 268, 19392-19397 [Abstract/Free Full Text]
  53. Harding, H. P., and Lazar, M. A. (1993) Mol. Cell. Biol. 13, 3113-3121 [Abstract/Free Full Text]
  54. Giguère, V., Tini, M., Flock, G., Ong, E., Evans, R. M., and Otulakowski, G. (1994) Genes Dev. 8, 538-553 [Abstract/Free Full Text]
  55. Giguère, V., McBroom, L. D. B., and Flock, G. (1995) Mol. Cell. Biol. 15, 2517-2526 [Abstract]
  56. Keller, H., Dreyer, C., Medin, J., Mahfoudi, A., Ozato, K., and Wahli, W. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 2160-2164 [Abstract/Free Full Text]
  57. Kliewer, S. A., Umesono, K., Noonan, D. J., Heyman, R. A., and Evans, R. M. (1992) Nature 358, 771-774 [CrossRef][Medline] [Order article via Infotrieve]
  58. Mukherjee, R., Davies, P. J. A., Cromble, D. L., Bischoff, E. D., Cesario, R. M., Jow, L., Hamann, L. G., Boehm, M. F., Mondon, C. E., Nadzan, A. M., Paterniti, J. R., Jr, and Heyman, R. A. (1997) Nature 386, 407-410 [CrossRef][Medline] [Order article via Infotrieve]
  59. Krey, G., Keller, H., Mahfoudi, A., Medin, J., Ozato, K., Dreyer, C., and Wahli, W. (1993) J. Steroid Biochem. Mol. Biol. 47, 65-73 [CrossRef][Medline] [Order article via Infotrieve]
  60. Osumi, T., Wen, J. K., and Hashimoto, T. (1991) Biochem. Biophys. Res. Commun 175, 866-871 [CrossRef][Medline] [Order article via Infotrieve]
  61. Varanasi, U., Chu, R., Huang, Q., Castellon, R., Yeldani, A. V., and Reddy, J. K. (1996) J. Biol. Chem. 271, 2147-2155 [Abstract/Free Full Text]
  62. Schoonjans, K., Watanabe, M., Suzuki, H., Mahfoudi, A., Krey, G., Wahli, W., Grimaldi, P., Staels, B., Yamamoto, T., and Auwerx, J. (1995) J. Biol. Chem. 270, 19269-19276 [Abstract/Free Full Text]
  63. Vu-Dac, N., Schoonjans, K., Kosykh, V., Dallongeville, J., Fruchart, J. C., Staels, B., and Auwerx, J. (1995) J. Clin. Invest. 96, 741-750
  64. DiRenzo, J., Soderstrom, M., Kurokawa, R., Ogliastro, M. H., Ricote, M., Ingrey, S., Horlein, A., Rosenfeld, M. G., and Glass, C. K. (1997) Mol. Cell. Biol. 17, 2166-2176 [Abstract] 13470-13475
  65. Reue, K., Leff, T., and Breslow, J. L. (1988) J. Biol. Chem. 263, 6857-6864 [Abstract/Free Full Text]
  66. Tontonoz, P., Hu, E., Graves, R. A., Budavari, A. I., and Spiegelman, B. M. (1994) Genes Dev. 8, 1224-1234
  67. Muerhoff, A. S., Griffin, K. J., and Johnson, E. F. (1992) J. Biol. Chem. 267, 19051-19053 [Abstract/Free Full Text]
  68. Aldridge, T. C., Tugwood, J. D., and Green, S. (1995) Biochem. J. 306, 473-479
  69. Zhang, B., Marcus, S. L., Fereydoun, G. S., Alvares, K., Janardan, K. R., Subramani, S., Rachubinski, R. A., and Capone, J. P. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 7541-7545 [Abstract/Free Full Text]
  70. Bardot, O., Aldridge, T. C., Latruffe, N., and Green, S. (1993) Biochem. Biophys. Res. Commun. 192, 37-45 [CrossRef][Medline] [Order article via Infotrieve]
  71. Issemann, I., Prince, R., Tugwood, J., and Green, S. (1992) Biochem. Soc. Trans. 20, 824-827 [Medline] [Order article via Infotrieve]
  72. Schoonjans, K., Peinado-Onsurbe, A. M., Heyman, R. A., Briggs, M., Deeb, S., Staels, B., and Auwerx, J. (1996) EMBO J. 15, 5336-5348 [Medline] [Order article via Infotrieve]
  73. Gulick, T., Cresci, S., Caira, T., Moore, D. D., and Kelly, D. P. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 11012-11016 [Abstract/Free Full Text]
  74. Rodriguez, J. C., Gil-Gomez, G., Hegardt, F. G., and Haro, D. (1994) J. Biol. Chem. 269, 18767-18772 [Abstract/Free Full Text]
  75. Tontonoz, P., Hu, E., Devine, J., Beale, E. G., and Spiegelman, B. M. (1995) Mol. Cell. Biol. 15, 351-357 [Abstract]
  76. Sears, I. B., MacGinnitie, M. A., Kovacs, L. G., and Graves, R. A. (1996) Mol. Cell. Biol. 16, 3410-3419 [Abstract]
  77. Härd, T., Kellenbach, E., Boelens, R., Maler, B. A., Dahlman, K., Freedman, L. P., Carlstedt-Duke, J., Yamamoto, K. R., Gustafsson, J. A., and Kaptein, R. (1990) Science 249, 157-160 [Abstract/Free Full Text]
  78. Schwabe, J. W. R., Neuhaus, D., and Rhodes, D. (1990) Mol. Endocrinol. 348, 458-461

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
P. Dentelli, A. Trombetta, G. Togliatto, A. Zeoli, A. Rosso, B. Uberti, F. Orso, D. Taverna, L. Pegoraro, and M. F. Brizzi
Formation of STAT5/PPAR{gamma} Transcriptional Complex Modulates Angiogenic Cell Bioavailability in Diabetes
Arterioscler. Thromb. Vasc. Biol., January 1, 2009; 29(1): 114 - 120.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
C. F. Zizola, G. J. Schwartz, and S. Vogel
Cellular retinol-binding protein type III is a PPAR{gamma} target gene and plays a role in lipid metabolism
Am J Physiol Endocrinol Metab, December 1, 2008; 295(6): E1358 - E1368.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Gupta, T. L. Jetton, R. M. Mortensen, S. Z. Duan, M. Peshavaria, and J. L. Leahy
In Vivo and in Vitro Studies of a Functional Peroxisome Proliferator-activated Receptor {gamma} Response Element in the Mouse pdx-1 Promoter
J. Biol. Chem., November 21, 2008; 283(47): 32462 - 32470.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
M. I. Lefterova, Y. Zhang, D. J. Steger, M. Schupp, J. Schug, A. Cristancho, D. Feng, D. Zhuo, C. J. Stoeckert Jr., X. S. Liu, et al.
PPAR{gamma} and C/EBP factors orchestrate adipocyte biology via adjacent binding on a genome-wide scale
Genes & Dev., November 1, 2008; 22(21): 2941 - 2952.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
V. T. Todorov, M. Desch, T. Schubert, and A. Kurtz
The Pal3 Promoter Sequence Is Critical for the Regulation of Human Renin Gene Transcription by Peroxisome Proliferator-Activated Receptor-{gamma}
Endocrinology, September 1, 2008; 149(9): 4647 - 4657.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
A. Perra, G. Simbula, M. Simbula, M. Pibiri, M. A. Kowalik, P. Sulas, M. T. Cocco, G. M. Ledda-Columbano, and A. Columbano
Thyroid hormone (T3) and TR{beta} agonist GC-1 inhibit/reverse nonalcoholic fatty liver in rats
FASEB J, August 1, 2008; 22(8): 2981 - 2989.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. M. Mansouri, E. Bauge, B. Staels, and P. Gervois
Systemic and Distal Repercussions of Liver-Specific Peroxisome Proliferator-Activated Receptor-{alpha} Control of the Acute-Phase Response
Endocrinology, June 1, 2008; 149(6): 3215 - 3223.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
D. Li, Q. Kang, and D.-M. Wang
Constitutive Coactivator of Peroxisome Proliferator-Activated Receptor (PPAR{gamma}), a Novel Coactivator of PPAR{gamma} that Promotes Adipogenesis
Mol. Endocrinol., October 1, 2007; 21(10): 2320 - 2333.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. Ludtke, J. Buettner, W. Wu, A. Muchir, A. Schroeter, S. Zinn-Justin, S. Spuler, H. H.-J. Schmidt, and H. J. Worman
Peroxisome Proliferator-Activated Receptor-{gamma} C190S Mutation Causes Partial Lipodystrophy
J. Clin. Endocrinol. Metab., June 1, 2007; 92(6): 2248 - 2255.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Y.-Y. Liu, R. S. Heymann, F. Moatamed, J. J. Schultz, D. Sobel, and G. A. Brent
A Mutant Thyroid Hormone Receptor {alpha} Antagonizes Peroxisome Proliferator-Activated Receptor {alpha} Signaling in Vivo and Impairs Fatty Acid Oxidation
Endocrinology, March 1, 2007; 148(3): 1206 - 1217.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Degenhardt, M. Matilainen, K.-H. Herzig, T. W. Dunlop, and C. Carlberg
The Insulin-like Growth Factor-binding Protein 1 Gene Is a Primary Target of Peroxisome Proliferator-activated Receptors
J. Biol. Chem., December 22, 2006; 281(51): 39607 - 39619.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
L. Michalik, J. Auwerx, J. P. Berger, V. K. Chatterjee, C. K. Glass, F. J. Gonzalez, P. A. Grimaldi, T. Kadowaki, M. A. Lazar, S. O'Rahilly, et al.
International Union of Pharmacology. LXI. Peroxisome Proliferator-Activated Receptors
Pharmacol. Rev., December 1, 2006; 58(4): 726 - 741.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
D. G. Lemay and D. H. Hwang
Genome-wide identification of peroxisome proliferator response elements using integrated computational genomics
J. Lipid Res., July 1, 2006; 47(7): 1583 - 1587.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
S. J. Lee, E. K. Yang, and S. G. Kim
Peroxisome Proliferator-Activated Receptor-{gamma} and Retinoic Acid X Receptor {alpha} Represses the TGFbeta1 Gene via PTEN-Mediated p70 Ribosomal S6 Kinase-1 Inhibition: Role for Zf9 Dephosphorylation
Mol. Pharmacol., July 1, 2006; 70(1): 415 - 425.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
A. Benigni, C. Zoja, S. Tomasoni, M. Campana, D. Corna, C. Zanchi, E. Gagliardini, E. Garofano, D. Rottoli, T. Ito, et al.
Transcriptional Regulation of Nephrin Gene by Peroxisome Proliferator-Activated Receptor-{gamma} Agonist: Molecular Mechanism of the Antiproteinuric Effect of Pioglitazone
J. Am. Soc. Nephrol., June 1, 2006; 17(6): 1624 - 1632.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
K. T. Dalen, S. M. Ulven, B. M. Arntsen, K. Solaas, and H. I. Nebb
PPAR{alpha} activators and fasting induce the expression of adipose differentiation-related protein in liver
J. Lipid Res., May 1, 2006; 47(5): 931 - 943.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
A. Zambon, P. Gervois, P. Pauletto, J.-C. Fruchart, and B. Staels
Modulation of Hepatic Inflammatory Risk Markers of Cardiovascular Diseases by PPAR-{alpha} Activators: Clinical and Experimental Evidence
Arterioscler. Thromb. Vasc. Biol., May 1, 2006; 26(5): 977 - 986.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
O. Araki, H. Ying, F. Furuya, X. Zhu, and S.-y. Cheng
Thyroid hormone receptor {beta} mutants: Dominant negative regulators of peroxisome proliferator-activated receptor {gamma} action
PNAS, November 8, 2005; 102(45): 16251 - 16256.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
E. L. Schiffrin
Peroxisome proliferator-activated receptors and cardiovascular remodeling
Am J Physiol Heart Circ Physiol, March 1, 2005; 288(3): H1037 - H1043.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. A. Temple, R. N. Cohen, S. R. Wondisford, C. Yu, D. Deplewski, and F. E. Wondisford
An Intact DNA-binding Domain Is Not Required for Peroxisome Proliferator-activated Receptor {gamma} (PPAR{gamma}) Binding and Activation on Some PPAR Response Elements
J. Biol. Chem., February 4, 2005; 280(5): 3529 - 3540.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
E. Efrati, J. Arsentiev-Rozenfeld, and I. Zelikovic
The human paracellin-1 gene (hPCLN-1): renal epithelial cell-specific expression and regulation
Am J Physiol Renal Physiol, February 1, 2005; 288(2): F272 - F283.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. A. Vyhlidal, P. K. Rogan, and J. S. Leeder
Development and Refinement of Pregnane X Receptor (PXR) DNA Binding Site Model Using Information Theory: INSIGHTS INTO PXR-MEDIATED GENE REGULATION
J. Biol. Chem., November 5, 2004; 279(45): 46779 - 46786.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. Shimizu, A. Takeshita, T. Tsukamoto, F. J. Gonzalez, and T. Osumi
Tissue-Selective, Bidirectional Regulation of PEX11{alpha} and Perilipin Genes through a Common Peroxisome Proliferator Response Element
Mol. Cell. Biol., February 1, 2004; 24(3): 1313 - 1323.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
M. Ricote, A. F. Valledor, and C. K. Glass
Decoding Transcriptional Programs Regulated by PPARs and LXRs in the Macrophage: Effects on Lipid Homeostasis, Inflammation, and Atherosclerosis
Arterioscler. Thromb. Vasc. Biol., February 1, 2004; 24(2): 230 - 239.
[Abstract] [Full Text]


Home page
HypertensionHome page
E. L. Schiffrin, F. Amiri, K. Benkirane, M. Iglarz, and Q. N. Diep
Peroxisome Proliferator-Activated Receptors: Vascular and Cardiac Effects in Hypertension
Hypertension, October 1, 2003; 42(4): 664 - 668.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Y. James, F. Lin, S. K. Kolluri, M. I. Dawson, and X.-k. Zhang
Regulation of Retinoic Acid Receptor {beta} Expression by Peroxisome Proliferator-activated Receptor {gamma} Ligands in Cancer Cells
Cancer Res., July 1, 2003; 63(13): 3531 - 3538.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
S. L. Ripp, K. C. Falkner, M. L. Pendleton, V. Tamasi, and R. A. Prough
Regulation of CYP2C11 by Dehydroepiandrosterone and Peroxisome Proliferators: Identification of the Negative Regulatory Region of the Gene
Mol. Pharmacol., July 1, 2003; 64(1): 113 - 122.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. C. Jones, X. Ding, T. Y. Zhang, and R. A. Daynes
Peroxisome Proliferator-Activated Receptor {alpha} Negatively Regulates T-bet Transcription Through Suppression of p38 Mitogen-Activated Protein Kinase Activation
J. Immunol., July 1, 2003; 171(1): 196 - 203.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. P. Berger, A. E. Petro, K. L. Macnaul, L. J. Kelly, B. B. Zhang, K. Richards, A. Elbrecht, B. A. Johnson, G. Zhou, T. W. Doebber, et al.
Distinct Properties and Advantages of a Novel Peroxisome Proliferator-Activated Protein {gamma} Selective Modulator
Mol. Endocrinol., April 1, 2003; 17(4): 662 - 676.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Jung, M. Fried, and G. A. Kullak-Ublick
Human Apical Sodium-dependent Bile Salt Transporter Gene (SLC10A2) Is Regulated by the Peroxisome Proliferator-activated Receptor alpha
J. Biol. Chem., August 16, 2002; 277(34): 30559 - 30566.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
P. E. Macchia, P. Jiang, Y.-D. Yuan, R. A. S. Chandarardna, R. E. Weiss, O. Chassande, J. Samarut, S. Refetoff, and C. F. Burant
RXR receptor agonist suppression of thyroid function: central effects in the absence of thyroid hormone receptor
Am J Physiol Endocrinol Metab, August 1, 2002; 283(2): E326 - E331.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
B. K. Jordan, M. Jain, S. Natarajan, S. D. Frasier, and E. Vilain
Familial Mutation in the Testis-Determining Gene SRY Shared by an XY Female and Her Normal Father
J. Clin. Endocrinol. Metab., July 1, 2002; 87(7): 3428 - 3432.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M.-C. Zennaro, A. Souque, S. Viengchareun, E. Poisson, and M. Lombes
A New Human MR Splice Variant Is a Ligand-Independent Transactivator Modulating Corticosteroid Action
Mol. Endocrinol., September 1, 2001; 15(9): 1586 - 1598.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
G. Lazennec, L. Canaple, D. Saugy, and W. Wahli
Activation of Peroxisome Proliferator-Activated Receptors (PPARs) by Their Ligands and Protein Kinase A Activators
Mol. Endocrinol., December 1, 2000; 14(12): 1962 - 1975.
[Abstract] [Full Text]


Home page
Mol. Pharmacol.Home page
C. Rodríguez, V. Noé, A. Cabrero, C. J. Ciudad, and J. C. Laguna
Differences in the Formation of PPARalpha -RXR/acoPPRE Complexes between Responsive and Nonresponsive Species upon Fibrate Administration
Mol. Pharmacol., July 1, 2000; 58(1): 185 - 193.
[Abstract] [Full Text]


Home page
J. Lipid Res.Home page
D. A. Pan, M. K. Mater, A. P. Thelen, J. M. Peters, F. J. Gonzalez, and D. B. Jump
Evidence against the peroxisome proliferator-activated receptor {alpha} (PPAR{alpha}) as the mediator for polyunsaturated fatty acid suppression of hepatic L-pyruvate kinase gene transcription
J. Lipid Res., May 1, 2000; 41(5): 742 - 751.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
R. Hi, S. Osada, N. Yumoto, and T. Osumi
Characterization of the Amino-terminal Activation Domain of Peroxisome Proliferator-activated Receptor alpha . IMPORTANCE OF alpha -HELICAL STRUCTURE IN THE TRANSACTIVATING FUNCTION
J. Biol. Chem., December 3, 1999; 274(49): 35152 - 35158.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
B. Desvergne and W. Wahli
Peroxisome Proliferator-Activated Receptors: Nuclear Control of Metabolism
Endocr. Rev., October 1, 1999; 20(5): 649 - 688.
[Abstract] [Full Text]


Home page
Mol. Endocrinol.Home page
P. Gervois, I. P. Torra, G. Chinetti, T. Grötzinger, G. Dubois, J.-C. Fruchart, J. Fruchart-Najib, E. Leitersdorf, and B. Staels
A Truncated Human Peroxisome Proliferator-Activated Receptor {alpha} Splice Variant with Dominant Negative Activity
Mol. Endocrinol., September 1, 1999; 13(9): 1535 - 1549.
[Abstract] [Full Text]


Home page
Mol. Pharmacol.Home page
P. Bernard, H. Goudonnet, Y. Artur, B. Desvergne, and W. Wahli
Activation of the Mouse TATA-less and Human TATA-Containing UDP-Glucuronosyltransferase 1A1 Promoters by Hepatocyte Nuclear Factor 1
Mol. Pharmacol., September 1, 1999; 56(3): 526 - 536.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
I. Barroso and P. Santisteban
Insulin-induced Early Growth Response Gene (Egr-1) Mediates a Short Term Repression of Rat Malic Enzyme Gene Transcription
J. Biol. Chem., June 18, 1999; 274(25): 17997 - 18004.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C. E. Robinson, X. Wu, Z. Nawaz, S. A. Onãte, and J. M. Gimble
A Corepressor and Chicken Ovalbumin Upstream Promoter Transcriptional Factor Proteins Modulate Peroxisome Proliferator-Activated Receptor-{gamma}2/Retinoid X Receptor {alpha}-Activated Transcription from the Murine Lipoprotein Lipase Promoter
Endocrinology, April 1, 1999; 140(4): 1586 - 1593.
[Abstract] [Full Text]


Home page
Mol. Endocrinol.Home page
P. Gervois, S. Chopin-Delannoy, A. Fadel, G. Dubois, V. Kosykh, J.-C. Fruchart, J. Najïb, V. Laudet, and B. Staels
Fibrates Increase Human REV-ERB{alpha} Expression in Liver via a Novel Peroxisome Proliferator-Activated Receptor Response Element
Mol. Endocrinol., March 1, 1999; 13(3): 400 - 409.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
M.-H. Hsu, C. N. A. Palmer, W. Song, K. J. Griffin, and E. F. Johnson
A Carboxyl-terminal Extension of the Zinc Finger Domain Contributes to the Specificity and Polarity of Peroxisome Proliferator-activated Receptor DNA Binding
J. Biol. Chem., October 23, 1998; 273(43): 27988 - 27997.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Jeannin, D. Robyr, and B. Desvergne
Transcriptional Regulatory Patterns of the Myelin Basic Protein and Malic Enzyme Genes by the Thyroid Hormone Receptors alpha 1 and beta 1
J. Biol. Chem., September 11, 1998; 273(37): 24239 - 24248.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Juge-Aubry, A. Pernin, T. Favez, A. G. Burger, W. Wahli, C. A. Meier, and B. Desvergne
DNA Binding Properties of Peroxisome Proliferator-activated Receptor Subtypes on Various Natural Peroxisome Proliferator Response Elements. IMPORTANCE OF THE 5'-FLANKING REGION
J. Biol. Chem., October 3, 1997; 272(40): 25252 - 25259.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. P. Beigneux, A. H. Moser, J. K. Shigenaga, C. Grunfeld, and K. R. Feingold
The Acute Phase Response Is Associated with Retinoid X Receptor Repression in Rodent Liver
J. Biol. Chem., May 19, 2000; 275(21): 16390 - 16399.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. W. Eubank, E. Duplus, S. C. Williams, C. Forest, and E. G. Beale
Peroxisome Proliferator-activated Receptor gamma and Chicken Ovalbumin Upstream Promoter Transcription Factor II Negatively Regulate the Phosphoenolpyruvate Carboxykinase Promoter via a Common Element*
J. Biol. Chem., August 3, 2001; 276(32): 30561 - 30569.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by IJpenberg, A.
Right arrow Articles by Desvergne, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by IJpenberg, A.
Right arrow Articles by Desvergne, B.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1997 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement