Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Watanabe, M.
Right arrow Articles by Okada, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Watanabe, M.
Right arrow Articles by Okada, N.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 32, Issue of August 8, 1997 pp. 20146-20151
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Biosynthesis of Archaeosine, a Novel Derivative of 7-Deazaguanosine Specific to Archaeal tRNA, Proceeds via a Pathway Involving Base Replacement on the tRNA Polynucleotide Chain*

(Received for publication, April 7, 1997, and in revised form, May 28, 1997)

Masakatsu Watanabe Dagger §, Mami Matsuo Dagger §, Sonoko Tanaka Dagger , Hiroshi Akimoto , Shuichi Asahi par , Susumu Nishimura par , Jon R. Katze **, Takeshi Hashizume Dagger Dagger , Pamela F. Crain Dagger Dagger , James A. McCloskey Dagger Dagger §§¶¶ and Norihiro Okada Dagger ¶¶

From the Dagger  Faculty of Bioscience and Biotechnology, Tokyo Institute of Technology, 4259 Nagatsuta-cho, Midori-ku, Yokohama 226, Japan,  Takeda Chemical Industries Ltd., Juso, Osaka 532, Japan, par  Banyu Tsukuba Research Institute (Merck), Tsukuba 300-26, Japan, ** Department of Microbiology and Immunology, University of Tennessee Memphis, Memphis, Tennessee 38163, and Departments of Dagger Dagger  Medicinal Chemistry and §§ Biochemistry, University of Utah, Salt Lake City, Utah 84112

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES


ABSTRACT

Archaeosine is a novel derivative of 7-deazaguanosine found in transfer RNAs of most organisms exclusively in the archaeal phylogenetic lineage and is present in the D-loop at position 15. We show that this modification is formed by a posttranscriptional base replacement reaction, catalyzed by a new tRNA-guanine transglycosylase (TGT), which has been isolated from Haloferax volcanii and purified nearly to homogeneity. The molecular weight of the enzyme was estimated to be 78 kDa by SDS-gel electrophoresis. The enzyme can insert free 7-cyano-7-deazaguanine (preQ0 base) in vitro at position 15 of an H. volcanii tRNA T7 transcript, replacing the guanine originally located at that position without breakage of the phosphodiester backbone. Since archaeosine base and 7-aminomethyl-7-deazaguanine (preQ1 base) were not incorporated into tRNA by this enzyme, preQ0 base appears to be the actual substrate for the TGT of H. volcanii, a conclusion supported by characterization of preQ0 base in an acid-soluble extract of H. volcanii cells. Thus, this novel TGT in H. volcanii is a key enzyme for the biosynthetic pathway leading to archaeosine in archaeal tRNAs.


INTRODUCTION

A variety of modified nucleosides has been found in tRNA (1, 2), but their functions and, in particular, their biosynthetic pathways are still largely unknown (3). Many modified nucleosides are highly conserved with respect to their sequence locations in tRNA (4), and some are characteristic of the evolutionary origin (2, 5), namely, archaea, bacteria, or eukarya (6). Perhaps the most phylogenetically specific nucleoside in tRNA is archaeosine, which occurs only in archaeal tRNA at position 15, a site that is not modified in tRNAs from the other two primary domains (7). Archaeosine was first discovered by Kilpatrick and Walker (8) during sequencing of tRNA from Thermoplasma acidophilum, and it was subsequently shown to be present in many archaeal species (9); in the most extensively studied archaeal tRNA, from Haloferax volcanii, archaeosine occurs in tRNAs specifying more than 15 amino acids (10). Subsequently, the structure of archaeosine was determined to be the non-purine, non-pyrimidine nucleoside 7-formamidino-7-deazaguanosine (Fig. 1A) (11).


Fig. 1. Structures of derivatives of 7-deazaguanine and 7-deazaguanosine.
[View Larger Version of this Image (21K GIF file)]

The only other known examples of tRNA nucleosides with 7-deazaguanosine structures are the members of the Q1 nucleoside (12) (Fig. 1E) family (13), which includes precursors in its biosynthesis, such as 7-cyano-7-deazaguanine (preQ0; Fig. 1D) (14), 7-aminomethyl-7-deazaguanine (preQ1; Fig. 1C) (15), and oQ (16) from bacterial tRNAs, and mannosyl and galactosyl derivatives of Q (17, 18) from mammalian tRNAs. In contrast to archaeosine, members of the Q nucleoside family are located at the first position of the anticodon (position 34) in bacterial and eukaryotic tRNAs that are specific for only four amino acids (Tyr, His, Asp, and Asn) (19). The key enzyme in the biosynthesis of the Q nucleoside in tRNA is tRNA-guanine transglycosylase (TGT; EC 2.4.2.29), which catalyzes a base-exchange reaction by cleavage of the N-C glycosidic bond at position 34 (20). In bacteria, TGT catalyzes the exchange of guanine at position 34 in tRNA with either guanine base, preQ1 base, or preQ0 base (20, 21). preQ1 base is presumed to be synthesized de novo from GTP (1) and was identified as the physiological substrate of Escherichia coli TGT (21). After incorporation of preQ1 into tRNA, it is further modified to oQ by transfer of the ribosyl moiety from S-adenosylmethionine (22), then finally to yield Q in the polynucleotide chain (23). In contrast, in eukarya, TGT can incorporate fully modified Q base into the first position of the anticodon by a base-replacement reaction (24, 25). Animals cannot synthesize Q-related compounds de novo and must obtain Q base as a nutrient from their diet or gut flora (26, 27).

Here we report the isolation of a new type of TGT from H. volcanii; it catalyzes the incorporation of preQ0 base into position 15 of tRNA, replacing guanine originally located at that site. Further, we have demonstrated that free preQ0 base is present in H. volcanii cells, implying that TGT utilizes preQ0 as a substrate leading to the biosynthesis of archaeosine in archaeal tRNAs.


EXPERIMENTAL PROCEDURES

Cells

H. volcanii (ATCC 29605) was grown aerobically at 37 °C on a 500-liter scale in Gupta's medium (10), until the absorbance at 600 nm reached 0.8-1.0. About 1.0 kg of cells was collected.

Assay of Guanine Exchange Reaction

Exchange between guanine and various 7-deazaguanine analogues, catalyzed by TGT, was assayed as described previously (20) except that the final ionic condition of the reaction mixture was 1.5 M KCl and 1.5 M NaCl. The 7-deazaguanines were synthesized as described previously: preQ0 (28), preQ1 (29), and archaeosine base (30).

Purification of H. volcanii tRNA-Guanine Transglycosylase

Frozen H. volcanii cells (100 g) were suspended in 200 ml of buffer A (50 mM Hepes (pH 7.5), 10% glycerol, 1.0 mM dithiothreitol, and 0.5 mM phenylmethylsulfonyl fluoride) plus DNase I (2.5 µg/ml), and were broken by sonication. The S-100 fraction was obtained by centrifugation at 105,000 × g for 1 h, dialyzed against buffer A, and then adsorbed onto a DEAE-Sepharose FF column (2.5 × 20 cm) (Pharmacia Biotech Inc.), which was eluted by a linear gradient of NaCl from 0.02 to 0.5 M in buffer A. The eluate containing the active fraction was brought to 40% ammonium sulfate and then applied to a Butyl-Sepharose FF column (2.5 × 20 cm) (Pharmacia), which was eluted with a linear gradient of ammonium sulfate from 40 to 0% in buffer A. The active fraction was next applied to a Butyl-Sepharose 4B column (1.5 × 15 cm) (Pharmacia) and eluted as described above for the Butyl-Sepharose FF column. The active fraction was then applied to a Superdex 200 column (1.6 cm × 60 cm) (Pharmacia), and then eluted with buffer A containing 300 mM NaCl. Finally, the TGT fraction was applied to a Mono Q column (0.50 × 5 cm) (Pharmacia) and eluted with a linear gradient of NaCl from 300 mM to 1 M. This TGT fraction was stable for at least 1 month when stored at 4 °C. The activity of the enzyme was monitored by incorporation of [8-14C]guanine into unfractionated E. coli tRNA (20). Amino acid sequences of peptide fragments generated by digestion with lysylpeptidase were determined as described previously (31).

Construction of a Plasmid Clone Containing the Gene for H. volcanii tRNALys(CUU) and Preparation of its T7 Transcript

Two synthetic DNA oligomers, namely Lys-FOR (5'- TAATACGACTCACTATAGGGCCGGTAGCTCAGTTAGGCAGAGCGTCTGACTCTT-3') and Lys-REV (5'-TGGTGGGCCGGACGCGATTTGAACACGCGACCGTCTGATTAAGAGTCAGACGCTCTGCCTA-3') were annealed via the complementary region, and both of the 3' ends were extended by Tth DNA polymerase (Toyobo). After extension, two synthetic DNA primers, namely T7 (5'-TAATACGACTCACTATA-3') and Halo-Lys3' (5'-CCTGGTGGGCCGGACGCGATTT-3') were added, and a polymerase chain reaction was performed to yield the gene for H. volcanii tRNALys(CUU) containing the promoter sequence for T7 RNA polymerase (Takara). We cloned the product of a polymerase chain reaction in pUC19; digestion of plasmid DNA with MvaI generated a CCA end for the tRNA gene, which was transcribed in vitro using T7 RNA polymerase (32).

Sequencing of the T7 Transcript into Which preQ0 Base Was Incorporated

For preparation of the T7 transcript into which preQ0 base was incorporated, 200 µl of a reaction mixture containing 300 pmol of T7 transcript, 20 µl of TGT (15 units) (20), and 5 nmol of preQ0 base (under ionic conditions of the guanine exchange reaction; see above) were incubated at 37 °C for 1.5 h. The sequence of the RNA was determined as described elsewhere (33, 34).

Characterization of Modified Nucleotides by Post-labeling

A reaction mixture containing T7 transcript and TGT in the presence of preQ0 base or an aliquot of acid-soluble extract of H. volcanii was incubated at 37 °C for 1.5 h. After digestion of the T7 transcript by RNase T2, the preQ0 nucleotide was analyzed by post-labeling using T4 polynucleotide kinase and [gamma -32P]ATP (21, 35). The enzymes used (RNase T2, T4 polynucleotide kinase, and yeast hexokinase) were inactivated by phenol extraction instead of boiling. After incubation with nuclease P1, the digestion product was applied to a cellulose thin layer plate (20 × 20 cm) and was subjected to two-dimensional chromatography (15).

Preparation of an Acid Extract of H. volcanii Cells for Detection of preQ0 Base

H. volcanii cells were suspended in a solution of 0.2 M formic acid and shaken for 2 h at 4 °C. After centrifugation, the supernatant was filtered through a Millipore filter. After neutralization with NaOH, soluble substances were extracted with tetrahydrofuran. The organic phase was evaporated, and the material was used for the identification of preQ0 base.


RESULTS

Purification of tRNA-Guanine Transglycosylase from H. volcanii

E. coli TGT can be assayed by its ability to incorporate [8-14C]guanine into Q-unmodified tRNAs (typically unfractionated yeast tRNA, which constitutively lacks Q, is used) by replacing the guanine base located at the first position of the anticodon (20). By analogy with E. coli TGT, we searched for such an enzymatic activity in a crude extract of H. volcanii using E. coli tRNA as a substrate (see below). H. volcanii TGT was purified to near homogeneity following successive column chromatographies. Table I shows the recovery and the purification factor at each step, and Fig. 2 shows the pattern of SDS-polyacrylamide gel electrophoresis at each step. The molecular mass of the enzyme was deduced to be 78 kDa from a profile of the gel (Fig. 2, lane 6). Like E. coli and eukaryotic TGT, H. volcanii TGT does not require ATP for the base replacement reaction. High salt concentration (approximately 2.4 M) is necessary for maximum activity. Magnesium ion is required for activity with the T7 transcript as a substrate, but activity with unfractionated E. coli tRNA does not require magnesium ion. These results suggest that magnesium ion may be responsible for conformational rigidity of the tRNA, but not for the enzymatic activity itself. Optimum activity occurs near pH 7.5. Purified TGT was digested with lysylpeptidase, and the sequences of several resultant peptide fragments were determined (see below).

Table I. Purification of tRNA-guanine transglycosylase from H. volcanii


Fraction Protein Specific activitya Purification factor Recovery

mg ×102 units/mg %
S-100 5500 2.4 1 100
DEAE-Sepharose FF 1100 13.8 6 118
Butyl-Sepharose FF 350 36.9 16 102
Butyl-Sepharose 4B 50 34.8 15 14
Superdex 200 7 321.3 139 18
Mono Q 0.4 975.0 422 3

a 1 unit = 20 pmol/h.


Fig. 2. Purification of H. volcanii tRNA guanine transglycosylase. An aliquot of S-100 (lane 2) or eluate fraction purified by successive use of several column chromatographies, such as DEAE-Sepharose FF (lane 3), Butyl-Sepharose FF (lane 4), Butyl-Sepharose 4B (lane 5), and Mono Q (lane 6), was analyzed by electrophoresis in a 7% SDS-polyacrylamide gel. Marker proteins were loaded in lane 1.
[View Larger Version of this Image (35K GIF file)]

Unfractionated E. coli tRNAs and a T7 Transcript of H. volcanii tRNALys(CUU) Are Substrates for H. volcanii tRNA-Guanine Transglycosylase

To examine the specificity for tRNA substrate, we constructed a plasmid clone containing the sequence of H. volcanii tRNALys(CUU) and that of T7 promoter upstream of the gene. Its T7 transcript (Fig. 3A) was found to be a good substrate for the enzyme (Fig. 3B). The labeled T7 transcript was isolated, and the site at which [8-14C]guanine had been incorporated was determined by RNA sequencing to be position 15,2 the exclusive location of archaeosine nucleotide in archaeal tRNA. This result suggested that the enzymatic activity is involved in the biosynthesis of archaeosine nucleotide in tRNA. Unfractionated tRNA from E. coli was also found to be a good TGT substrate, whereas unfractionated H. volcanii, yeast, and bovine tRNAs were not (Fig. 3B), although we did not quantitatively measure the efficiency of unfractionated E. coli tRNA and of the T7Lys transcript as substrates. These results further suggest that position 15 of H. volcanii tRNAs is fully modified to archaeosine nucleotide.


Fig. 3. Substrate specificity of H. volcanii tRNA-guanine transglycosylase for tRNA. A, clover-leaf structure of the T7 transcript that contains the sequence of H. volcanii tRNALys(CUU). Arrows symbolize the base-replacement reaction at position 15. B, incorporation of [8-14C]guanine into tRNAs from various sources catalyzed by H. volcanii tRNA-guanine transglycosylase. T7 transcript of H. volcanii tRNALys(CUU) (100 pmol) or each of unfractionated tRNAs of E. coli, yeast, bovine, and H. volcanii (1800 pmol) was used as a tRNA substrate for the guanine incorporation reaction in a final volume of 350 µl. An aliquot (100 µl) was taken at the times specified and the radioactivity of its acid-insoluble precipitate was measured. A control experiment was performed without a tRNA substrate.
[View Larger Version of this Image (18K GIF file)]

preQ0 Base May Be the Physiological Substrate for H. volcanii tRNA-Guanine Transglycosylase

The ability of various bases to serve as substrates for incorporation into tRNA by H. volcanii TGT was examined using the procedure of Okada et al. (21). First, the T7 transcript was labeled with [8-14C]guanine by incubation with TGT. To a reaction mixture that contained this 8-14C-labeled tRNA and the TGT enzyme, we added various 7-deazaguanine bases and monitored the decrease in acid-insoluble radioactivity of the tRNA due to release of [8-14C]guanine by replacement with the added base (Fig. 4). Unexpectedly, neither archaeosine base itself (Fig. 1B), nor preQ1 base (Fig. 1C), which is the physiological substrate for E. coli TGT (21), were incorporated into the tRNA transcript. Among 7-deazaguanine derivatives, only preQ0 base (Fig. 1D) was efficiently incorporated. We attribute the small amount of apparent archaeosine base incorporation into tRNA to be due to preQ0 base, and not archaeosine base, since approximately 20% of archaeosine base is chemically converted to preQ0 base after incubation of the reaction mixture under the conditions used. Furthermore, the nucleotide at position 15 of the tRNA product after incubation with archaeosine base was found to be preQ0 nucleotide by RNA sequencing2 (see "Discussion").


Fig. 4. Substrate specificity for bases monitored by release of [8-14C]guanine from labeled tRNALys(CUU) by H. volcanii tRNA-guanine transglycosylase. The reaction mixture that contained 300 pmol of [8-14C]guanine-labeled T7 transcript and the enzyme (15 units) with or without 6 nmol of each base in a final volume of 1,500 µl was prepared. After incubation at 37 °C, an aliquot of 350 µl was taken at the times specified and the radioactivity of the acid-insoluble precipitate was measured. black-square, control; bullet , guanine; triangle , preQ0 base; open circle , preQ1 base; black-triangle, archaeosine base.
[View Larger Version of this Image (20K GIF file)]

preQ0 Base Is Incorporated at Position 15 of tRNA

To investigate whether preQ0 base is directly incorporated into tRNA, as well as whether incorporation occurs at position 15 in the D-loop, the sequence of the D-loop region in the T7 transcript after incubation with preQ0 base was determined by the post-labeling method (33, 34). The RNA was subjected to partial digestion with alkali and the 5' ends of resultant RNA fragments were labeled by using polynucleotide kinase and [gamma -32P]ATP, followed by separation by electrophoresis in a polyacrylamide gel (Fig. 5A). RNA was extracted from each band in the gel and digested with nuclease P1. The resultant 32P-labeled nucleotide 5'-monophosphate was analyzed by thin-layer chromatography. Fig. 5B shows clearly that preQ0 base was incorporated at position 15 of the tRNA, and also shows that more than 90% of the nucleotide at position 15 is a preQ0 nucleotide, indicating that the base-replacement reaction by H. volcanii TGT was efficient under the present conditions.


Fig. 5. preQ0 base was inserted at position 15 of tRNA by H. volcanii tRNA-guanine transglycosylase. A, autoradiogram of RNA ladder. The numbers indicate the position number in the standard tRNA numbering system (7). B, autoradiogram of thin layer plates (from 14 to 18). An arrow indicates the position of preQ0 5'-monophosphate. The sequence was determined by the postlabeling method (33, 34).
[View Larger Version of this Image (34K GIF file)]

Evidence for the Occurrence of Free preQ0 Base in H. volcanii Cells

If preQ0 base is the physiological substrate for H. volcanii TGT, free preQ0 base could be present in H. volcanii cells. To test this hypothesis, we prepared an acid-soluble extract of H. volcanii and incubated an aliquot of the extract with the T7 transcript of H. volcanii tRNALys(CUU) and H. volcanii TGT under the same conditions described in Fig. 4. After the reaction, we analyzed modified nucleotides in the treated tRNA using the post-labeling method (21, 35). As shown in Fig. 6, preQ0 5'-monophosphate was detected in the tRNA transcript following incubation in the presence of the acid-soluble extract (Fig. 6B), but it was not detected following incubation with the enzyme alone (Fig. 6C). Further, similar acid treatment of isolated H. volcanii tRNA did not release preQ0 by the criterion of failure of the T7 transcript to incorporate preQ0 when incubated with the extract and TGT.2 Although archaeosine base is unstable under conditions of high temperature and high salt (see above), archaeosine appears stable when present as a nucleotide in intact tRNA (10). These results suggest that free preQ0 base is present in H. volcanii cells and that it may serve as the physiological substrate for H. volcanii TGT (see "Discussion"; Fig. 7A).


Fig. 6. Detection of preQ0 base in H. volcanii cells. A T7 transcript of tRNALys(CUU) and H. volcanii tRNA-guanine transglycosylase were incubated in the presence of (A) authentic preQ0 base, (B) an aliquot of an acid-soluble extract of H. volcanii, or (C) in the absence of base or acid-soluble cell extract. RNA was isolated, digested with RNase T2, 5' end-labeled, and analyzed as described (21, 35). An arrowhead indicates preQ0 nucleotide.
[View Larger Version of this Image (34K GIF file)]


Fig. 7. Two biosynthetic pathways involving tRNA-guanine transglycosylases. TGT, AdoMet, QueA, and B12 represent tRNA-guanine transglycosylase, S-adenosylmethionine, tRNA ribosyltransferase-isomerase and adenosylcobalamine, respectively.
[View Larger Version of this Image (18K GIF file)]

The normal growth medium for H. volcanii (10) contains Tryptone, which, as a whole meat extract, is a source of Q nucleoside and, therefore, a potential source of preQ0. To rule out the possibility that H. volcanii may not synthesize archaeosine de novo, tRNA was isolated from cells grown in a chemically defined (Q-free) medium (36) and analyzed for archaeosine; archaeosine content in tRNA from cells grown in the normal growth medium and in chemically defined growth medium was identical.2

H. volcanii and E. coli tRNA-Guanine Transglycosylases Are Evolutionarily Related

Recently, the complete genome sequence of the methanogenic archaeon, Methanococcus jannaschii, has been reported (37). Among 1738 protein-coding genes predicted is a putative M. jannaschii TGT gene (MJ#0436) that exhibits 30% identity to E. coli TGT (38). We determined the amino acid sequences of three peptide fragments, generated from purified H. volcanii TGT by digestion with lysylpeptidase, and compared them with the sequence of the putative M. jannaschii TGT. As shown in Fig. 8, fragments 1 and 2 from H. volcanii TGT appear to be closely related to the M. jannaschii sequence, with identities of 53.5 and 38.5%, respectively, although the C-terminal portion of fragment 3 diverges from that in M. jannaschii. These results suggest that the H. volcanii tRNA-guanine transglycosylase characterized here is the counterpart of the putative TGT whose sequence is present in M. jannaschii (37).


Fig. 8. Alignment of a portion of the sequence of M. jannaschii tRNA-guanine transglycosylase with those of fragments of H. volcanii tRNA-guanine transglycosylase.
[View Larger Version of this Image (32K GIF file)]


DISCUSSION

tRNA-Guanine Transglycosylase in H. volcanii Has Different Substrate Specificities from That of E. coli

It is well established that TGT is involved in biosynthesis of Q nucleotide in E. coli (Fig. 1E) by exchange of guanine at position 34 by preQ1 base in tRNAs specific for Tyr, Asp, Asn, and His ((20, 21); see Introduction). The resultant preQ1 nucleotide in tRNA is then modified to the epoxide oQ by the S-adenosylmethionine-requiring enzyme QueA (22), and finally, oQ is converted to Q by an unknown vitamin B12-dependent enzyme (23). These processes are schematically represented in Fig. 7B. In the present study, we provide evidence that, in contrast with the primary substrate of bacterial TGT (preQ1), preQ0 base is the normal substrate for H. volcanii TGT. Presumably, the incorporated preQ0 base then is further converted to archaeosine by (net) addition of ammonia, at the polynucleotide level (Fig. 7A). Therefore, both E. coli and H. volcanii TGTs catalyze a very similar reaction, namely, the exchange of guanine base in a polynucleotide chain with a free 7-deazaguanine derivative; however, their actual substrates (in terms of base, tRNAs, and the site of replacement in tRNA) are different.

Functional Implications of 7-Deazaguanosine Nucleosides

Archaeosine is present at position 15 (D-loop) in most archaeal tRNAs (7), whereas Q and its derivatives are present at position 34 (first position of the anticodon) of four specific tRNAs in bacteria and eukarya (19) (see Introduction). Accordingly, these conserved differences in structure and sequence location suggest differences in function. Q has been proposed to be involved in codon recognition (39) and has been shown to prevent stop codon readthrough in tobacco mosaic virus RNA in a codon context-dependent manner (40). A correlation between the presence of Q-undermodified tRNAs and frameshifts of some retroviruses including human immunodeficiency virus was proposed (41). Other functional implications of Q, such as in virulence of Shigella (42), signal transduction (43), ubiquitin-dependent proteolytic pathway (44), and tumor differentiation (45-48), have also been suggested.

The functional role of archaeosine has not been established, but has been proposed to involve enhanced stabilization of tRNA tertiary structure as a consequence of the unique charged imidino side chain (11). Earlier work has demonstrated that hydrogen bonding interactions between G-15 in the D-loop and C-48 in the T-loop, stabilized by stacking with purine-59, constitute a generally conserved mechanism for stabilization of the universal folded L-shape of tRNA (49, 50). These structural features (G-15, C-48, purine-59) are basically met by nearly all reported archaeosine-containing tRNA sequences (7), to which would be added the strong potential for electrostatic interactions between phosphate and the "arginine fork" imidino side chain of archaeosine.

Interestingly, precursor bases used as substrates for both bacterial and archaeal TGTs participate in analogous biosynthetic pathways. Free preQ1 base has been isolated from E. coli (21), and here we provide evidence for the presence of free preQ0 base in H. volcanii. We believe that this free preQ0 base is likely to be the precursor exchanged into tRNA in the normal biosynthetic pathway leading to archaeosine, although, at present, we cannot strictly exclude the possibility that free preQ0 base detected is instead derived from archaeosine in tRNA. In E. coli, preQ1 base is synthesized from GTP (13), possibly via preQ0 (51), although there is presently no direct evidence for any precursor-product relationship between these two 7-deazaguanine bases. Presumably a similar pathway is present in H. volcanii for biosynthesis of preQ0 base from GTP. The key substrates following base replacement at the tRNA level, then, are preQ1 nucleotide (leading to queuosine in E. coli) and preQ0 nucleotide (leading to archaeosine in H. volcanii). It is noted that preQ0 nucleoside is present in tRNA of certain mutants of E. coli (51), the meaning of which has not yet been rationalized (14, 21). The occurrence of these 7-deazaguanine precursor bases in both primary phylogenetic domains, archaea and bacteria, prompts us to speculate a more general role for them in cellular functions. In this respect, more detailed characterization of free preQ0 base (and possibly free preQ1 base) in H. volcanii cells is required.

Structural Requirements of Bacterial and Archaeal TGT Enzymes for tRNA Substrates and Their Evolutionary Implications

tRNA structural requirements for enzyme recognition remain to be identified. Preliminary experiments2 showed that an 18 nucleotide minihelix containing the D-loop and D-stem of H. volcanii tRNALys(CUU) does not serve as a substrate for H. volcanii TGT, implying the existence of higher order recognition elements for the archaeal TGT. By contrast, bacterial TGT recognizes the anticodon loop sequence U33-G34-U35, which is the minimum requirement for recognition by the enzyme, and minihelices containing this triplet sequence are good substrates for the enzyme (52, 53).

By x-ray crystallography, the tRNA-guanine transglycosylase from Zymomonas mobilis has been determined to be an irregular (alpha /beta )8 barrel with a tightly attached C-terminal zinc-containing subdomain (54). Further, the structure of Z. mobilis TGT in complex with preQ1 suggests a binding mode for tRNA where the phosphate backbone interacts with the zinc subdomain and the U33-G34-U35 sequence is recognized by the barrel. The zinc binding motif (CXCX2CX25H) is highly conserved in prokaryotic TGTs known so far (52), and the homologous region in M. jannaschii is (CXCX2CX22H). These results demonstrate a structural and functional conservation of the archaeal and bacterial/eukaryotic TGT binding mode with tRNA, despite archaeal modification of the D-loop and bacterial/eukaryotic modification of the anticodon loop. The utilization of 7-deazaguanine derivatives for tRNA processing by interrelated TGT enzymes suggests an evolutionarily fundamental role for 7-deazaguanine.

In contrast to bacterial TGT (52, 55), productive recognition of tRNA by eukaryotic TGT requires not only the U33-G34-U35 sequence of the anticodon loop but also a correctly folded tRNA architecture (56). In addition, eukaryotic TGT is believed to be a heterodimer, although this is not conclusive at present (44, 57). More detailed examination of the substrate recognition properties of TGTs from archaea, bacteria, and eukaryotes will elucidate the domain structures of these proteins for the tRNA binding site, as well as further define their evolutionary relationship.


FOOTNOTES

*   This work was supported in part by a grant-in-aid for specially promoted research from the Ministry of Education, Science and Culture of Japan and by National Institutes of Health Grant GM 29812.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§   These authors contributed equally to the present work.
¶¶   To whom reprint requests should be addressed. N. Okada: Tel./ Fax: 81-45-923-1136; E-mail: nokada{at}bio.titech.ac.jp. J. A. McCloskey: Tel.: 801-581-5581; Fax: 801-581-7457; E-email: james.mccloskey{at}rna.pharm.utah.edu.
1   The abbreviations used are: Q or queuosine, 7-{[(4, 5-cis-dihydroxy-2-cyclopenten-1-yl)-amino]methyl}-7-deazaguanosine; oQ or epoxyqueuosine, 7-{[(2, 3-epoxy-4,5-cis-dihydroxycyclopent-1-yl)-amino]methyl}-7-deazaguanosine; preQ1, 7-aminomethyl-7-deazaguanosine; preQ0, 7-cyano-7-deazaguanosine; archaeosine, 2-amino-4,7-dihydro-4-oxo-7-beta -D-ribofuranosyl-1H-pyrrolo[2,3-d]pyrimidine-5-carboximidamide, or 7-formamidino-7-deazaguanosine; TGT, tRNA-guanine transglycosylase.
2   M. Watanabe, M. Matsuo, S. Tanaka, and N. Okada, unpublished observations.

ACKNOWLEDGEMENTS

We thank Dr. Yoshihiro Fukumori and Takemoto Fujiwara of the Tokyo Institute of Technology for help with the culture of H. volcanii and Dr. Kunio Ihara of Nagoya University for useful discussions.


REFERENCES

  1. Nishimura, S. (1979) in Transfer RNA: Structure, Properties and Recognition (Schimmel, P. R., Söll, D., and Abelson, J. N., eds), pp. 59-79, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  2. Limbach, P. A., Crain, P. F., and McCloskey, J. A. (1994) Nucleic Acids Res. 22, 2183-2196 [Abstract/Free Full Text]
  3. Björk, G. J., Ericson, J. U., Gustafsson, C. E. D., Hagervall, T. G., Jönsson, Y. H., and Wikström, P. M. (1987) Annu. Rev. Biochem. 56, 263-287 [CrossRef][Medline] [Order article via Infotrieve]
  4. Grosjean, H., Sprinzl, M., and Steinberg, S. (1995) Biochimie 77, 139-141 [Medline] [Order article via Infotrieve]
  5. Björk, G. R. (1986) Chem. Scr. 26B, 91-95
  6. Woese, C. R., Kandler, O., and Wheelis, M. L. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 4576-4579 [Abstract/Free Full Text]
  7. Sprinzl, M., Steegborn, C., Hübel, F., and Steinberg, S. (1996) Nucleic Acids Res. 24, 68-72 [Free Full Text]
  8. Kilpatrick, M. W., and Walker, R. T. (1982) Zentralbl. Bakteriol. Mikrobiol. Hyg. 1 Abt. Orig. C3, 79-89
  9. Edmonds, C. G., Crain, P. F., Gupta, R., Hashizume, T., Hocart, C. H., Kowalak, J. A., Pomerantz, S. C., Stetter, K. O., and McCloskey, J. A. (1991) J. Bacteriol. 173, 3138-3148 [Abstract/Free Full Text]
  10. Gupta, R. (1984) J. Biol. Chem. 259, 9461-9471 [Abstract/Free Full Text]
  11. Gregson, J. M., Crain, P. F., Edmonds, C. G., Gupta, R., Hashizume, T., Phillipson, D. W., and McCloskey, J. A. (1993) J. Biol. Chem. 268, 10076-10086 [Abstract/Free Full Text]
  12. Kasai, H., Ohashi, Z., Harada, F., Nishimura, S., Oppenheimer, N. J., Crain, P. F., Liehr, J. G., von Minden, D. L., and McCloskey, J. A. (1975) Biochemistry 14, 4198-4208 [CrossRef][Medline] [Order article via Infotrieve]
  13. Nishimura, S. (1983) Prog. Nucleic Acid Res. Mol. Biol. 28, 49-73 [Medline] [Order article via Infotrieve]
  14. Noguchi, S., Yamaizumi, Z., Ohgi, T., Goto, T., Nishimura, Y., Hirota, Y., and Nishimura, S. (1978) Nucleic Acids Res. 5, 4215-4223 [Abstract/Free Full Text]
  15. Okada, N., Noguchi, S., Nishimura, S., Ohgi, T., Goto, T., Crain, P. F., and McCloskey, J. A. (1978) Nucleic Acids Res. 5, 2289-2296 [Abstract/Free Full Text]
  16. Phillipson, D. W., Edmonds, C. G., Crain, P. F., Smith, D. L., Davis, D. R., and McCloskey, J. A. (1987) J. Biol. Chem. 262, 3462-3471 [Abstract/Free Full Text]
  17. Kasai, H., Nakanishi, K., Macfarlane, R. D., Torgerson, D. F., Ohashi, Z., McCloskey, J. A., Gross, H. J., and Nishimura, S. (1976) J. Am. Chem. Soc. 98, 5044-5046 [CrossRef][Medline] [Order article via Infotrieve]
  18. Okada, N., and Nishimura, S. (1977) Nucleic Acids Res. 4, 2931-2937 [Abstract/Free Full Text]
  19. Harada, F., and Nishimura, S. (1972) Biochemistry 11, 301-308 [CrossRef][Medline] [Order article via Infotrieve]
  20. Okada, N., and Nishimura, S. (1979) J. Biol. Chem. 254, 3061-3066 [Abstract/Free Full Text]
  21. Okada, N., Noguchi, S., Kasai, H., Shindo-Okada, N., Ohgi, T., Goto, T., and Nishimura, S. (1979) J. Biol. Chem. 254, 3067-3073 [Abstract/Free Full Text]
  22. Slany, R. K., Bösl, M., Crain, P. F., and Kersten, H. (1993) Biochemistry 32, 7811-7817 [CrossRef][Medline] [Order article via Infotrieve]
  23. Frey, B., McCloskey, J. A., Kersten, W., and Kersten, H. (1988) J. Bacteriol. 170, 2078-2082 [Abstract/Free Full Text]
  24. Shindo-Okada, N., Okada, N., Ohgi, T., Goto, T., and Nishimura, S. (1980) Biochemistry 19, 395-400 [CrossRef][Medline] [Order article via Infotrieve]
  25. Katze, J. R., Gunduz, U., Smith, D. L., Cheng, C. S., and McCloskey, J. A. (1984) Biochemistry 23, 1171-1176 [CrossRef][Medline] [Order article via Infotrieve]
  26. Farkas, W. R. (1980) J. Biol. Chem. 255, 6832-6835 [Abstract/Free Full Text]
  27. Katze, J. R., Basile, B., and McCloskey, J. A. (1982) Science 216, 55-56 [Abstract/Free Full Text]
  28. Kondo, T., Nakatsuka, S., and Goto, T. (1980) Chemistry Lett. 559-562
  29. Ohgi, T., Kondo, T., and Goto, T. (1979) Chemistry Lett. 1283-1286
  30. Hashizume, T., and McCloskey, J. A. (1994) Nucleic Acids Res. Symp. Ser. 31, 137-138
  31. Tsunasawa, S., Masaki, T., Hirose, M., Soejima, M., and Sakiyama, F. (1989) J. Biol. Chem. 264, 3832-3839 [Abstract/Free Full Text]
  32. Himeno, H., Hasegawa, T., Ueda, T., Watanabe, K., Miura, K., and Shimizu, M. (1989) Nucleic Acids Res. 17, 7855-7863 [Abstract/Free Full Text]
  33. Stanley, J., and Vassilenko, S. (1978) Nature 274, 87-88 [CrossRef][Medline] [Order article via Infotrieve]
  34. Kuchino, Y., Hanyu, N., and Nishimura, S. (1987) Methods Enzymol. 155, 379-396 [Medline] [Order article via Infotrieve]
  35. Silberklang, M., Prochiantz, A., Haenni, A.-L., and RajBhandary, U. L. (1977) Eur. J. Biochem. 72, 465-478 [Medline] [Order article via Infotrieve]
  36. Kauri, T., Wallace, R., and Kushner, D. J. (1990) Syst. Appl. Microbiol. 13, 14-18
  37. Bult, C. J., White, O., Olsen, G. J., Zhou, L., Fleischmann, R. D., Sutton, G. G., Blake, J. A., FitzGerald, L. M., Clayton, R. A., Gocayne, J. D., Kerlavage, A. R., Dougherty, B. A., Tomd, J.-F., Adams, M. D., Reich, C. I., Overbeek, R., Kirkness, E. F., Weinstock, K. G., Merrick, J. M., Glodek, A., Scott, J. L., Geoghagen, N. S. M., Weidman, J. F., Fuhrmann, J. L., Nguyen, K., Utterback, T. R., Kelly, J. M., Peterson, J. D., Sadow, P. W., Hanna, M. C., Cotton, M. D., Roberts, K. M., Hurst, M. A., Kaine, B. P., Borodovsky, M., Klenk, H.-P., Fraser, C. M., Smith, H. O., Woese, C. R., and Ventner, J. C. (1996) Science 273, 1058-1073 [Abstract]
  38. Reuter, K., Slany, R., Ullrich, F., and Kersten, H. (1991) J. Bacteriol. 173, 2256-2264 [Abstract/Free Full Text]
  39. Bienz, M., and Kubli, E. (1981) Nature 294, 188-190 [CrossRef]
  40. Beier, H., Barciszewska, M., Krupp, G., Mitnacht, R., and Gross, H. J. (1984) EMBO J. 3, 351-356 [Medline] [Order article via Infotrieve]
  41. Hatfield, D., Feng, Y.-X., Lee, B. J., Rein, A., Levin, J. G., and Oroszlan, S. (1989) Virology 173, 736-742 [CrossRef][Medline] [Order article via Infotrieve]
  42. Durand, J. M., Okada, N., Tobe, T., Watarai, M., Fukuda, I., Suzuki, T., Nakata, N., Komatsu, K., Yoshikawa, M., and Sasakawa, C. (1994) J. Bacteriol. 176, 4627-4634 [Abstract/Free Full Text]
  43. Morris, R. C., Brooks, B. J., Eriotou, P., Kelly, D. F., Sagar, S., Hart, K. L., and Elliott, M. S. (1995) Nucleic Acids Res. 23, 2492-2498 [Abstract/Free Full Text]
  44. Deshpande, K. L., Seubert, P. H., Tillman, D. M., Farkas, W. R., and Katze, J. (1996) Arch. Biochem. Biophys. 326, 1-7 [CrossRef][Medline] [Order article via Infotrieve]
  45. Okada, N., Shindo-Okada, N., Sato, S., Itoh, Y. H., Oda, K.-I., and Nishimura, S. (1978) Proc. Natl. Acad. Sci. U. S. A. 75, 4247-4251 [Abstract/Free Full Text]
  46. Shindo-Okada, N., Terada, M., and Nishimura, S. (1981) Eur. J. Biochem. 115, 423-428 [Medline] [Order article via Infotrieve]
  47. Elliott, M. S., and Katze, J. R. (1986) J. Biol. Chem. 261, 13019-13025 [Abstract/Free Full Text]
  48. Kretz, K. A., Katze, J. R., and Trewyn, R. W. (1987) Mol. Cell. Biol. 7, 3613-3619 [Abstract/Free Full Text]
  49. Rich, A., and RajBhandary, U. L. (1976) Annu. Rev. Biochem. 45, 805-860 [CrossRef][Medline] [Order article via Infotrieve]
  50. Dock-Bregeon, A. C., Westhof, E., Giegé, R., and Moras, D. (1989) J. Mol. Biol. 206, 707-722 [CrossRef][Medline] [Order article via Infotrieve]
  51. Björk, G. R. (1995) Prog. Nucleic Acids Res. Mol. Biol. 50, 263-338 [Medline] [Order article via Infotrieve]
  52. Curnow, A. W., Kung, F.-L., Koch, K. A., and Garcia, G. A. (1993) Biochemistry 32, 5239-5246 [CrossRef][Medline] [Order article via Infotrieve]
  53. Nakanishi, S., Ueda, T., Hori, H., Yamazaki, N., Okada, N., and Watanabe, K. (1994) J. Biol. Chem. 269, 32221-32225 [Abstract/Free Full Text]
  54. Romier, C., Reuter, K., Suck, D., and Ficner, R. (1996) EMBO J. 15, 2850-2857 [Medline] [Order article via Infotrieve]
  55. Curnow, A. W., and Garcia, G. A. (1995) J. Biol. Chem. 270, 17264-17267 [Abstract/Free Full Text]
  56. Grosjean, H., Edqvist, J., Stråby, K. B., and Giegé, R. (1996) J. Mol. Biol. 255, 67-85 [CrossRef][Medline] [Order article via Infotrieve]
  57. Slany, R. K., and Müller, S. O. (1995) Eur. J. Biochem. 230, 221-228 [Medline] [Order article via Infotrieve]

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Bacteriol.Home page
G. Phillips, B. El Yacoubi, B. Lyons, S. Alvarez, D. Iwata-Reuyl, and V. de Crecy-Lagard
Biosynthesis of 7-Deazaguanosine-Modified tRNA Nucleosides: a New Role for GTP Cyclohydrolase I
J. Bacteriol., December 15, 2008; 190(24): 7876 - 7884.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Sabina and D. Soll
The RNA-binding PUA Domain of Archaeal tRNA-Guanine Transglycosylase Is Not Required for Archaeosine Formation
J. Biol. Chem., March 17, 2006; 281(11): 6993 - 7001.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. S. Reader, D. Metzgar, P. Schimmel, and V. de Crecy-Lagard
Identification of Four Genes Necessary for Biosynthesis of the Modified Nucleoside Queuosine
J. Biol. Chem., February 20, 2004; 279(8): 6280 - 6285.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. D. Kittendorf, T. Sgraja, K. Reuter, G. Klebe, and G. A. Garcia
An Essential Role for Aspartate 264 in Catalysis by tRNA-Guanine Transglycosylase from Escherichia coli
J. Biol. Chem., October 24, 2003; 278(43): 42369 - 42376.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
V. Anantharaman, E. V. Koonin, and L. Aravind
Comparative genomics and evolution of proteins involved in RNA metabolism
Nucleic Acids Res., April 1, 2002; 30(7): 1427 - 1464.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Bai, D. T. Fox, J. A. Lacy, S. G. Van Lanen, and D. Iwata-Reuyl
Hypermodification of tRNA in Thermophilic Archaea. CLONING, OVEREXPRESSION, AND CHARACTERIZATION OF tRNA-GUANINE TRANSGLYCOSYLASE FROM METHANOCOCCUS JANNASCHII
J. Biol. Chem., September 8, 2000; 275(37): 28731 - 28738.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Watanabe, N. Nameki, M. Matsuo-Takasaki, S. Nishimura, and N. Okada
tRNA Recognition of tRNA-guanine Transglycosylase from a Hyperthermophilic Archaeon, Pyrococcus horikoshii
J. Biol. Chem., January 19, 2001; 276(4): 2387 - 2394.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Watanabe, M.
Right arrow Articles by Okada, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Watanabe, M.
Right arrow Articles by Okada, N.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1997 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement