|
Volume 272, Number 33,
Issue of August 15, 1997
pp. 20954-20960
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.
Promoter-dependent Synergy between Glucocorticoid
Receptor and Stat5 in the Activation of -Casein Gene
Transcription*
(Received for publication, February 4, 1997, and in revised form, May 15, 1997)
Judith
Lechner
,
Thomas
Welte
,
Jürgen K.
Tomasi
,
Patrick
Bruno
,
Carol
Cairns
§,
Jan-Åke
Gustafsson
§ and
Wolfgang
Doppler
¶
From the Institut für Medizinische Chemie und
Biochemie, Universität Innsbruck, Fritz-Pregl-Straße 3, A-6020
Innsbruck, Austria and the § Department of Medical
Nutrition, Karolinska Institute, Huddinge University Hospital F60,
Novum, S-14186 Huddinge, Sweden
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
ABSTRACT
Steroid hormone receptors and Stat factors
comprise two distinct families of inducible transcription factors.
Activation of a member of each family, namely the glucocorticoid
receptor by glucocorticoids and Stat5 by prolactin, is required for the
efficient induction of the expression of milk protein genes in the
mammary epithelium. We have studied the mode of interaction between
Stat5 and the glucocorticoid receptor in the activation of -casein gene transcription. The functional role of potential half-palindromic glucocorticoid receptor-binding sites mapped previously in the promoter
region was investigated. -Casein gene promoter chloramphenicol acetyltransferase constructs containing mutations and deletions in
these sites were tested for their responsiveness to the synergistic effect of prolactin and dexamethasone employing COS-7 cells or HC11
mammary epithelial cells. Synergism depended on promoter regions
containing intact binding sites for the glucocorticoid receptor and
Stat5. The carboxyl-terminal transactivation domains of Stat5a and
Stat5b were not required for this synergism. Our results suggest that
in lactogenic hormone response elements glucocorticoid receptor
molecules bound to nonclassical half-palindromic sites gain competence
as transcriptional activators by the interaction with Stat5 molecules
binding to vicinal sites.
INTRODUCTION
The stage-specific regulation of milk protein gene expression is
controlled by the lactogenic hormones glucocorticoids and prolactin.
Both hormones have been documented to synergistically induce the
expression of these genes at the level of transcription initiation (1).
Lactogenic hormone response elements have been defined in the promoter
region and upstream enhancer regions of the genes encoding the milk
proteins S1-casein (2), -casein (1, 3, 4), whey acidic protein
(5-7), and -lactoglobulin (8). They all contain binding sites for
the prolactin inducible transcription factor
MGF/Stat51 (2, 8-10). A
mutation introduced into the Stat5-binding site has been shown to
destroy the response of the promoter not only to prolactin but also to
glucocorticoids (11), indicating that Stat5 is necessary for mediating
the effects of prolactin and glucocorticoids. Glucocorticoids do not
significantly change the binding activity of MGF/Stat5 to lactogenic
hormone response elements (12), ruling out the possibility that they
act synergistically with prolactin simply by enhancing the effect of
prolactin on the activation of Stat5 DNA binding.
In vitro binding studies with purified preparations of the
glucocorticoid receptor revealed the presence of multiple GR-binding sites in the lactogenic response elements of the rat -casein gene
promoter (13), the proximal mouse whey acidic protein gene promoter
(13), and the distal rat whey acidic protein gene promoter (14).
Interestingly, only sequence motifs resembling half-palindromic GR-binding sites were contained within the footprinted regions. Transactivation mediated by the glucocorticoid receptor usually requires the binding of dimeric receptor molecules to palindromic DNA-binding sites (15-17), whereas half-sites binding monomeric GR
complexes have been reported to be insufficient by themselves to confer
hormone responsiveness (17). However, monomeric GR molecules binding to
receptor half-palindromic sites were proposed to gain competence as
transcriptional activators by interacting with other transcription
factors (18).
We tested whether GR molecules binding to half-palindromic sites in the
rat -casein gene promoter can functionally interact with MGF/Stat5
in the activation of milk protein gene transcription. COS-7 cells were
employed in transient co-transfection assays using wild-type and
mutated -casein gene promoter CAT constructs. These cells allow the
reconstitution of prolactin-dependent signaling cascades by
transfection of prolactin receptor and Stat5 expression vectors (19).
They also can be used to study the synergy between Stat5 and GR in
cotransfection experiments (20). The results presented here suggest
that GR half-palindromic sites serve to recruit GR molecules to the
-casein gene promoter and are instrumental for mediating the
synergistic effect between glucocorticoids and prolactin. Experiments
with stably transfected HC11 mammary epithelial cells, which do not
overexpress Stat5 and GR molecules, lead to the same conclusion.
Efficient transactivation by GR molecules was dependent on the
activation and binding of Stat5 to its recognition site. Interestingly,
transactivation was also possible with Stat5 molecules devoid of their
carboxyl-terminal transactivation domain.
MATERIALS AND METHODS
Plasmids
-Casein gene promoter constructs with mutations
in the glucocorticoid receptor half-sites were prepared by
site-directed mutagenesis using the protocol of Deng and Nickoloff
(21). The -casein CAT promoter gene p c( 344/ 1)CAT was used as
a template (22). The selection primer for introducing the first
mutation was 5 -CCCCGGGTACAGATCTCGAATTCGT-3 . It destroys the unique
SacI and KpnI cutting sites, replacing them with
a BglII site. For a second round of mutation, the primer
5 -GGATCGATCCTCGAGTACAGATCT-3 was used. It destroys the unique
SmaI site and creates a novel XhoI site. The
primers used for introducing mutations into the GR sites (in
parentheses) were: 5 -CCTTGTTTAAGCTTCCCCAGAATT-3 (mGRc),
5 -TTTCTAATCAAGCTTACTTCTTGGA-3 (mGRd),
5 TTGGAATTAACAGACTTTTGAA3 (mGRe), and
5 -TTTCTAATCAAGCTTACTTCTTGGAATTAACAGACTTTTGAA-3 (mGRd and mGRe). For
mutations in the GR sites of footprints a and b the Quick
ChangeTM site-directed mutagenesis protocol of Stratagene
was used. The upper strands of the oligonucleotides employed were:
5 -GGCTGGGGAGAATTCTGATGACTGTTTACTAGGCTGGAG-3 (mGRa);
5 -GGCTGGAGAGAATTCCAGTTATTTGACAATTTCCTTTCC-3 (mGRa/b); 5 -CAATTTCCTTTCCTTGACGAATTCCTTCACCAGCTTCTG-3 (mGRb). The construct with the mutation of the MGF/Stat5 site and the heterologous -casein gene thymidine kinase (tk) promoter CAT constructs employed have been
described (23). The construct pMMTV-CAT was prepared by inserting a
1.3-kilobase pair PstI/BamHI fragment, spanning
the region from 1187 to +102 of the mouse mammary tumor virus-long terminal repeat, into the 5 polylinker of pBLCAT3 (24). The constitutively active luciferase expression vector pAGLuE5, driven by
the SV40 early promoter, was provided by Dr. T. Schlake. Stat5 expression vectors were constructed by insertion of Stat5a and Stat5b
cDNA cloned from a mouse mammary gland ZAP
library2 into pECE (25). The
carboxylterminally deleted forms of Stat5a and Stat5b were prepared
by introducing a stop codon at amino acid 738 position of Stat5a
and the corresponding position (amino acid 742) of Stat5b. The rat
glucocorticoid expression vector PSTC GR 3-795 (26) contains the
cDNA of the rat glucocorticoid receptor encoding amino acids
3-795.
Cell Culture and Hormone Inductions
COS-7 cells were
propagated in Dulbecco's modified Eagle's medium containing 10%
heat-inactivated fetal calf serum, and 50 µg/ml gentamycin. HC11
cells were grown in RPMI 1640 medium supplemented with 10%
heat-inactivated fetal calf serum, 5 µg/ml insulin, 10 ng/ml
epidermal growth factor, and 50 µg/ml gentamycin. Prior to hormone
treatment, HC11 cells were kept for 2 days in epidermal growth
factor-free medium containing 2% fetal calf serum as described (23).
Hormone inductions were performed with 5 µg/ml ovine prolactin (31 units/mg, Sigma) and 0.1 µM dexamethasone (Sigma), as
indicated.
Electromobility Shift Assays
Experimental procedures were
as described previously (23). Double-stranded oligonucleotides labeled
with [ -32P]ATP (>6000 Ci/mmol) and annealed to the
complementary oligonucleotides as described (23) were used. The
sequence of the upper strand of the oligonucleotides employed was: SIE,
5 -GTGCATTTCCCGTAAATCTTGTCTACAATTC-3 ; PRE,
5 -AGCTTAGAACACAGTGTTCTCTAGAC-3 ; GRc,
5 -GCTGCCTTGTTTAATGTCCCCCAGAATTTCTTGG-3 ; mGRc,
5 -GCTGCCTTGTTTAAGCTTCCCCAGAATTTCTTGG-3 ; GRd+e,
5 -CTAATCATGTGGACTTCTTGGAATTAAGGGACTTTTG-3 . Electromobility
shift assays were performed on a 4% polyacrylamide gel in 0.25 × TBE electrophoresis buffer. Binding reactions were as described (27).
GR-DBD expressed in Escherichia coli was purified as
described (28) and used for binding reactions in a buffer containing 10 mM Hepes, pH 7.5, 2.5 mM MgCl2,
10% glycerol (w/v), 50 mM KCl, 0.1 mM EDTA, 1 mM dithiothreitol, 50 ng of poly(dI-dC).
Cell Transfection and CAT Assay
Transfections with the
calcium phosphate precipitation technique, selection and propagation of
stably transfected HC11 cells, and CAT assays were performed as
described (27). Transient transfection of COS-7 cells were made with
cultures plated on 6-well dishes. The total amount of cotransfected DNA
was 20 µg/6 wells. For preparing extracts to determine CAT and
luciferase activity, COS-7 cells were washed with ice-cold
phosphate-buffered saline, incubated for 5 min with 1 ml of buffer
containing 40 mM Tris-HCl, pH 7.5, 1 mM EDTA,
150 mM NaCl, and harvested by scraping them off the dish
with a rubber policeman. The subsequent steps were performed at
0-4 °C. Two aliquots of 450 µl each of the resuspended cells were
transferred to a microcentrifuge tube, centrifuged for 5 min at
1000 × g, and the supernatants were removed by
aspiration. One of the aliquots was used for determination of CAT
activity (27). A luciferase assay was performed with the other aliquot as described (29).
RESULTS
Reconstitution of Promoter-dependent Synergy between
the Glucocorticoid Receptor and Stat5 in COS-7 Cells
A regulatory
region in the -casein gene promoter required for the synergistic
action of glucocorticoid hormones and prolactin was mapped in HC11
mammary epithelial cells (1, 23). It comprises the MGF/Stat5 site and a
region located 5 to this site. We have investigated the role of this
5 region in mediating the synergy between glucocorticoids and
prolactin in COS-7 cells. These cells were shown to be a suitable
system to study the prolactin-dependent transactivation
activity of Stat5 (19). Cotransfections were performed with expression
plasmids for mouse Stat5a, mouse prolactin receptor, and a -casein
( 344/ 1) promoter CAT reporter gene. Increasing amounts of a
glucocorticoid receptor expression plasmid were included. The
cotransfected cells were stimulated with dexamethasone or prolactin or
a combination of both. In the absence of cotransfected glucocorticoid
receptors (Fig. 1, first 4 columns) dexamethasone did not have a significant effect on
transcription. The synergism between dexamethasone and prolactin
increased in a concentration dependent fashion by cotransfection of GR
expression vector (Fig. 1). Using 40-1000 ng of GR expression vector
the synergistic effect approached the level observed in HC11 cells for
the regulation of a stably transfected -casein ( 344/ 1) gene
promoter CAT construct (23). Further cotransfection studies were
performed with 200 ng of GR expression vector.
Fig. 1.
Effect of glucocorticoids and prolactin on
the induction of the -casein gene promoter in COS-7 cells
transfected with Stat5a and glucocorticoid receptor expression
vectors. The indicated amount (in nanograms) of the rat GR
expression vector PSTC-GR3-795 was cotransfected with 4 µg of the
mouse prolactin receptor expression vector pcDNAI-PRLR, 4 µg of
the mouse Stat5a expression vector pECEStat5a, 8 µg of the -casein
gene promoter CAT reporter p c( 344/ 1)CAT, and 2 µg of the SV40
luciferase construct pAGLu-E5. The total amount of transfected DNA was
adjusted to 20 µg with pUC18. 24 h after transfection, cells
were stimulated with dexamethasone (0.1 µM) and/or
prolactin (5 µg/ml). Extracts were prepared 24 h after hormone
stimulation and analyzed for CAT and luciferase activity as described
under "Materials and Methods." Results are represented as relative
units of CAT activity normalized to luciferase activity. The means ± S.E. of two separate hormone inductions are shown.
Control, not hormone treated; Dex, dexamethasone-treated; PRL, prolactin-treated; Dex + PRL, dexamethasone and prolactin treated COS-7
transfectants.
[View Larger Version of this Image (35K GIF file)]
We next investigated whether the MGF/Stat5 site alone is sufficient to
mediate the synergistic response in COS-7 cells. A 30-base pair region
comprising the MGF/Stat5 site in the -casein gene promoter or a
region extending from 344 to 82 cloned in front of a thymidine
kinase-CAT reporter gene were analyzed. The short fragment with the
MGF/Stat5 site only conferred a transcriptional response upon prolactin
stimulation to the thymidine kinase-CAT reporter (Fig.
2). However, no synergism was observed
with dexamethasone. By contrast, a marked increase in transcriptional
activation was obtained upon stimulation with dexamethasone and
prolactin, when the -casein gene promoter fragment ( 344/ 82) was
used. The synergistic transcriptional activation mediated by prolactin
and dexamethasone is hence dependent on sequences 5 to the MGF/Stat5
site in COS-7 cells as has been found previously in HC11 cells
(23).
Fig. 2.
Dependence of hormonal synergy on 5 -flanking
sequence. COS-7 cells were transfected with 200 ng of
PSTC-GR3-795, 4 µg of pcDNAI-PRLR, 4 µg of pECEStat5a, 2 µg
of pAGLu-E5, and 8 µg of the thymidine kinase-CAT reporter construct
specified at the bottom of the diagram. tk, pBLCAT2 (24);
( 104/ 75)tk, heterologous promoter construct containing
the region between 104 and 75 of the rat -casein gene promoter
in front of the thymidine kinase promoter. ( 344/ 82)tk,
contains the region between 344 and 82 of the rat -casein gene
promoter. Relative CAT activities were measured as described in the
legend to Fig. 1.
[View Larger Version of this Image (31K GIF file)]
Glucocorticoid Receptor Half-palindromic Sites in the -Casein
Gene Promoter
In a previous study GR-binding sites were mapped in
the rat -casein gene promoter by in vitro footprint
analysis using purified rat liver glucocorticoid receptor (13). Five
regions were identified to be protected from digestion by DNase I (Fig.
3, footprints a-e). They
contain sequence motifs related to half-sites of classical glucocorticoid response elements. The functionality of the putative half-site contained in footprint c to bind the GR was investigated by
electromobility shift assays employing the DNA-binding domain of the
glucocorticoid receptor (GR-DBD, Fig.
4A). The oligonucleotide GRc,
spanning the footprinted region c of the -casein gene promoter and a
corresponding oligonucleotide harboring a mutation in the putative
half-site (mGRc, mutation as shown in Fig. 3) were used as DNA probes.
A classical palindromic GR-binding site (PRE) and a sequence devoid of
described GR-binding sites (SIE) served as controls. Very weak binding
was observed with the SIE (Fig. 4A, lanes 1 and
2). With a palindromic GRE (PRE oligo) two retarded bands
were detected (Fig. 4A, lanes 3 and 4). The two
bands represent complexes containing receptor monomers or dimers. This
is in accordance with previous reports (18, 30). With the GRc probe,
formation of a complex migrating at the position of receptor monomers
was observed (Fig. 4A, lanes 5 and 6). Binding
activity of the mutated GRc probe was reduced to the low level observed
with to the SIE probe (Fig. 4A, compare lanes 1 and 2 with 7 and 8). The
experiment confirms the assumption that the integrity of the
half-palindromic site in the GRc probe is required for the binding of
the GR. In electromobility shift assays with a DNA probe comprising the
half-sites in GRd and GRe (GRd+e), formation of complexes with two
receptor molecules was observed at high concentrations of GR-DBD (Fig. 4B, lanes 1 and 2). Electromobility shift assays
performed with oligonucleotides with targeted mutations in either Grd
or GRe palindromic half-sites revealed that the integrity of the
half-sites in GRd and GRe is important for the formation of these
complexes (data not shown). In comparison to the PRE probe with the
palindromic GR site (Fig. 4B, lanes 5-7), formation of
complexes containing two receptor molecules required significantly
higher concentration of the GR-DBD (Fig. 4B, compare
lanes 1 and 2 to lanes 5 and
6), indicating that the configuration of the two binding
sites in GRd+e does not favor co-operative binding of GR molecules to
the same extent as the classical palindromic site in PRE.
Fig. 3.
GR-binding sites in the lactogenic hormone
response element of the rat -casein gene promoter. The sequence
between 300 and 61 of the rat -casein gene promoter together
with the localization of the footprints a-e, mapped
previously by DNase I footprinting with the rat liver GR (13), is
shown. Potential hexameric GR half-sites are represented by
boxes with arrows indicating their orientation
compared with a palindromic site. They all contain a G in the second
position, a T in the third position, and a C in the fifth position
which have been shown to be of crucial importance for binding (52). The
mutations mGRa, mGRa/b, mGRb, mGRc, mGRd, and mGRe introduced into the
half-sites of footprints a-e are shown on top of the
sequence. The position of the major MGF/Stat5-binding site is depicted
by an ellipsis.
[View Larger Version of this Image (37K GIF file)]
Fig. 4.
Electromobility shift assays with the GR
DNA-binding domain (GR-DBD). The activity of -casein gene
promoter derived oligonucleotides to bind the GR-DBD was compared with
a palindromic GR-binding site (PRE). Conditions of the
binding reaction and sequence of the employed oligonucleotides are
specified under "Materials and Methods." The positions of the free
probe (f) and the two GR-DBD complexes are marked on the
left margin. They are interpreted to contain one (mono) or
two (di) GR-DBD molecules. The oligonucleotide probes employed are
indicated on the top of each lane. A,
footprinted region c: SIE, oligonucleotide with no known
binding site for the GR (lanes 1 and 2);
PRE (lanes 3 and 4); GRc,
oligonucleotide spanning footprint c (lanes 5 and 6); mGRC, mutated GRc (lanes 7 and
8, mutation as depicted in Fig. 3). 2 µl (lanes 1, 3, 5, and 7) and 1 µl (lanes 2, 4, 6, and 8) of GR-DBD were used. B, footprinted
regions d and e: GRd+e, oligonucleotide spanning
GR half-sites GRd and GRe (lanes 1-4); PRE (lanes
5-8). 300 ng (lanes 1 and 5), 150 ng
(lanes 2 and 6), 75 ng (lanes 3 and 7), or no GR-DBD (lanes 4 and 8)
were used.
[View Larger Version of this Image (35K GIF file)]
Glucocorticoid Receptor-binding Sites Are Required for Promoter
Function
To determine the importance of the GR sites for promoter
function, mutations affecting the various GR half-site were introduced into the -casein ( 344/ 1)CAT plasmid. The mutations employed are
shown in Fig. 3 on top of the sequence. Cotransfections with the
mutated promoter constructs were performed in COS-7 cells as described
above. The ability of dexamethasone to augment the response of
prolactin was quantified by determining the ratio of the CAT activity
in cells stimulated with dexamethasone and prolactin versus
the activity in cells treated with prolactin only (Fig.
5A). Mutations in GR
half-sites a, b, c, and e led to a reduction of the ratio to 17 (mGRa),
29 (mGRa/b), 30 (mGRb), 34 (mGRc), and 42% (mGRe) of the wild-type
-casein CAT construct. The induction ratio was almost completely
abolished in constructs harboring double mutations of GRc and GRe (Fig.
5A, mutations mGRc+e and mGRc+d+e), indicating a
co-operation of these binding sites for mediating the synergism of GR
with Stat5. The effect of a mutation in GRd was not statistically
significant. This mutation also had no significant additional effect
when combined with mutations of either GRc or GRe or both (Fig.
5A, mutations mGRd, mGRc+d, mGRd+e, and
mGRc+d+e).
Fig. 5.
Effect of mutations introduced into GR and
MGF/Stat5-binding sites of the -casein gene promoter on the
synergism between glucocorticoids and prolactin. A, effect
of GR half-site mutations on the synergistic effect of dexamethasone in
COS-7. Cells were transiently cotransfected with the wild-type
( 344/ 1)CAT reporter construct (w.t.) or mutated versions
as specified at the bottom of the columns together with expression
vectors for Stat5a, prolactin receptor, glucocorticoid receptor, and
luciferase as described in the legend to Fig. 2. The CAT activity was
measured in extracts treated for 24 h either with dexamethasone
and prolactin, or only with prolactin, and normalized to luciferase
activity. The ratio of the activity in dexamethasone and
prolactin-treated cells versus the activity in
prolactin-treated cells was calculated. Bars show the mean
ratio ± S.E. of three experiments, each performed with at least
duplicate inductions. B, effect of the triple GR site mutation and the MGF/Stat5 mutation on transactivation in COS-7 (top panel) and HC11 cells (bottom panel).
Transient co-transfection experiments and hormone inductions of COS-7
cells were performed as described in the legend to Fig. 2. HC11 cells
were stably transfected with the specified constructs and CAT activity
was determined in extracts of confluent HC11 cells treated with
dexamethasone (0.1 µM) and prolactin (5 µg/ml) for 4 days (+ Dex/PRL), or of cells without hormones ( Dex/PRL). CAT
activity is shown relative to hormone treated wild-type promoter
constructs. Results are expressed as mean ± S.E. of at least
three independent determinations. C, role of the -casein
gene promoter region between 344 and 170 on mediating the synergy
between glucocorticoid and prolactin. The indicated constructs were
transiently cotransfected into COS-7 cells and lactogenic hormone
regulated expression was analyzed as described in the legend to Fig. 2.
Results are expressed as mean ± S.E. of three independent
determinations.
[View Larger Version of this Image (38K GIF file)]
As shown in the upper panel of Fig. 5B for COS-7
cells, the activation of transcription by prolactin alone was not
altered by the triple GR mutation, indicating that the effect is
selective on the action of glucocorticoids. Mutation of the MGF/Stat5
site, however, strongly interfered with the prolactin response. In this mutant the synergistic effect of dexamethasone was also reduced. The
weak but significant induction observed is most probably explained by
an incomplete inhibition of Stat5 binding by the mutation. The data
presented document the functional importance of the GR half-sites in
GRa, GRb, GRc, and GRe for GR action. Furthermore, they show the
dependence of GR on co-operation with Stat5, which also has to bind to
the promoter.
To examine whether the findings obtained in Stat5 and GR overexpressing
COS-7 cells are also relevant for the situation in mouse mammary
epithelial cells expressing physiological levels of these two
transcription factors, HC11 cells were stably transfected with the same
mutated reporter constructs (Fig. 5B, lower panel). The
results obtained in HC11 cells supported the conclusions drawn from the
experiments with the COS-7 cell system. The triple mutation affecting
the three GR-binding sites c, d, and e strongly reduced the synergistic
activation of the -casein promoter by dexamethasone and prolactin.
Destroying the Stat5-binding site also inhibited prolactin- and
dexamethasone-induced transactivation.
To determine whether the GR sites in GRc and GRe are sufficient for
mediating the synergism with Stat5, constructs were prepared with 5
deletions of the -casein promoter placed in front of a minimal
thymidine kinase promoter and analyzed in COS-7 cotransfection experiments (Fig. 5C). A ( 176/ 82) -casein thymidine
kinase promoter which harbors the GRc- and GRe-binding sites failed to
confer the prolactin and dexamethasonedependent synergistic
transactivation. The responsiveness to dexamethasone and prolactin was
restored in the constructs which contain the regions GRa and GRb (Fig. 5C, p c( 344/ 82)thymidine kinase-CAT and
p c( 282/ 82)thymidine kinase-CAT)). Thus, the distal -casein
gene promoter region with the GR-binding sites for GRa and GRb is
necessary for mediating the synergism between GR and Stat5. As shown
above (Fig. 5A), the functionality of this region is
dependent on the integrity of the proximal GR-binding sites in GRc and
GRe, implying that the synergism depends on a co-operation of distal
and proximal sites.
The Carboxyl-terminal Transactivation Domain of Stat5 Is Not
Required for the Synergism with the Glucocorticoid Receptor
The
two highly related Stat5 molecules Stat5a and Stat5b are expressed in
the mammary epithelium. We wanted to examine whether they behave
similarly in synergizing with the GR. Cotransfection experiments in
COS-7 cells were performed as above. As shown in Fig.
6, no significant differences were
observed in transactivation of the -casein gene promoter upon
induction with dexamethasone and prolactin. We also tested
carboxyl-terminally deleted forms of Stat5a and Stat5b, lacking the
region with the major transcriptional activation domain (31).
Surprisingly, the deleted forms were as efficient as the full-length
Stat5 isoforms in their synergy with the GR. Thus, the transactivation
domain in the carboxyl-terminal region of Stat5 is not required for the
establishment of the synergism with the glucocorticoid receptor.
Fig. 6.
Synergy of the GR with different forms of
Stat5. The specified Stat5 forms were cotransfected into COS-7
cells and determination of CAT activity was performed as described in
the legend to Fig. 2. The structure of the expression vectors with the
carboxyl-terminally deleted form of Stat5a and Stat5b is described under "Materials and Methods." Results are shown as means ± S.E. of two hormone inductions.
[View Larger Version of this Image (47K GIF file)]
DISCUSSION
The steroid receptor superfamily and Stat molecules represent two
archetypal families of signaling molecules which evolved to meet the
requirement of cells to respond differentially to diverse extracellular
stimuli. The specificity of the response is controlled at two levels
(15, 32): At the first level, there is a selective activation of
steroid receptors or Stat factors by different extracellular signals.
This is achieved by the specific binding of the steroid receptors to
their ligands and the selective recruitment of Stat factors by their
activating receptors. The second level of specificity is brought about
by the recognition of distinct DNA-binding sites by the activated
steroid receptors and Stat factors.
Integration of different signaling pathways is a further means to
increase the versatility of the response to extracellular stimuli
(33-35). In this study we have investigated how integration of the
signaling pathways triggered by the two pleiotropic hormones prolactin
and glucocorticoids leads to the specific activation of milk
protein gene transcription.
When this article was in preparation, Stöcklin et al.
(20) reported a direct interaction between Stat5 and the GR
overexpressed in COS-7 cells. A model was proposed where the GR acts as
a co-activator of Stat5 in a mode which is independent of a GRE. The
results presented in our study do not support this model, since they
provide clear evidence that GR and Stat5 molecules, activated by the
two hormones, interact in a lactogenic hormone response element
dependent fashion. DNA-binding sites for both the GR and Stat5 were
demonstrated to be essential in mediating their synergism on -casein
gene induction. However, protein-protein interactions between GR and Stat5, as the one observed by Stöcklin et al. (20),
might also be important for a productive functional interaction of GR
and Stat5 molecules, recruited to the lactogenic hormone response elements of milk protein gene promoters. In fact, a role for both DNA-template dependent and independent interactions of the GR or Stat5
with other transcription factors has been demonstrated frequently. GR
homodimers bound to palindromic GR consensus sites were described to
interact with several unrelated transcription factors bound to vicinal
sites (15, 33, 36). In addition, direct DNA-template independent
interactions of the GR with the transcription factors NF B (37),
NF-IL6 (38), and AP-1 (reviewed in Ref. 39) have been reported.
Protein-protein interactions of GR monomers and AP-1 were suggested to
be involved in the repression of transcription factor AP-1 activity
(40). Interactions involving both DNA binding and protein-protein
contacts are the hallmark of composite glucocorticoid response elements
(41), which mediate a positive or negative effect of glucocorticoids on
transcription depending on the type of the cooperating transcription
factor.
For Stat factors, DNA template-dependent synergy with
members of the Ets family and C/EBP has been described. In the
c-fos gene promoter, Stat1 and Stat3 cooperate with ternary
complex factors (42); in the Fc receptor gene, Stat1 cooperates with PU.1 (43); for the induction of the interleukin-4 gene vicinal sites of
Stat6 and C/EBP have been found to be important (44); activation of the
lipopolysaccharide-binding protein required Stat3, C/EBP, and AP-1
sites (45). Examples of direct binding of Stats to other proteins
involved in transcription are the interaction of the Stat3 splice
variant with c-jun (46); the cooperative interactions of dimeric Stat
molecules with themselves, mediated by the NH2-terminal
domain of Stats (47); and the binding of the carboxyl-terminal domain
of Stat2 to the p300/CBP transcriptional adaptor (48).
GR molecules usually utilize palindromic sites for high affinity DNA
binding. They are composed of hexameric half-sites with the consensus
5 -TGTTCT-3 spaced by 3 nucleotides (15). The GR-binding sites
characterized in the lactogenic hormone response elements were
non-classical sites. They represent half-palindromic sites (13, 14).
Half-sites binding monomeric GR molecules have been found to be unable
to confer glucocorticoid-inducible transcription on a heterologous
promoter by themselves (17). However, in complex glucocorticoid
response elements, half-palindromic sites have been mapped which are
essential in mediating the effect of glucocorticoid hormones (17, 18).
Functional half-palindromic binding sites were also described for the
estrogen receptor in the far upstream estrogen response element of the
ovalbumin gene (49). Mutational analysis of the three proximal GR
half-sites in the -casein gene promoter (Fig. 5A)
revealed the functional importance of the half-palindromic sites in
GRa, GRb, GRc, and GRe. In the lactogenic hormone response element the
utilization of half-sites by the GR appears to be one important means
for ensuring the stage-specific activation of milk protein expression: here, glucocorticoids are unable to induce transcription via the GR
half-sites alone, but require the synergy with Stat5 activated by
prolactin. Although the unusual spacing and orientation of GR
half-sites in lactogenic hormone response elements would not allow a
favorable steric alignment of GRs like the one observed with classical
GREs, direct interactions between receptors bound to several sites
might be important. In addition, or alternatively, interactions of the
GR with other factors binding to neighboring sites could stabilize the
binding of the GR to half-palindromes. For the -casein gene a
cooperative binding between C/EBP and GR could be important, since
several binding sites for C/EBP were mapped vicinal to GR
half-palindromic sites (23). In the case of the whey acidic protein
gene promoter, CTF/NF-1 could be involved (10, 14).
Two cellular systems were employed in the present study. COS-7 cells
allowed to assess directly the role of Stat5 in transient cotransfection experiments. However, a drawback of this system is that
the cells are not of mammary epithelial origin and the expression
levels of Stat5 and GR are very high, giving rise to the question
whether the results obtained are relevant for the in vivo
regulation of milk protein genes by lactogenic hormones. We thus also
used HC11 mammary epithelial cells which can be induced by
glucocorticoids and prolactin to express the endogenous -casein gene. It was possible to demonstrate a functional role of GR half-sites in mediating the response of lactogenic hormones in this cell line
(Fig. 5B), suggesting that the mechanism of interaction
between GR and Stat5 is the same in HC11 and COS-7 cells and thus of
general relevance for the regulation of milk protein gene
expression.
In HC11 cells the action of lactogenic hormones on milk protein
expression is slow (50). An indirect effect of glucocorticoids on
transcription, mediated by the activation or repression of a gene
regulated by the GR has been described to account for the slow response
(22). Our data presented here implicate that, in addition, the GR
exerts a direct effect on the lactogenic hormone response element.
Regulation of gene expression by direct and indirect mechanisms has
also been reported to account for the action of glucocorticoids on the
2-uteroglobulin (51) and the -amylase 2 (18) genes, which both
contain functional GR half-sites similar as the lactogenic hormone
response elements.
Stat5a and Stat5b, which differ significantly in their carboxyl
terminus, were equally potent in their cooperativity with the GR (Fig.
6). Interestingly, Stat5 devoid of the carboxyl terminus was as
efficient in mediating the synergism with the GR as full-length Stat5.
The deleted region contains the major transactivation domain of Stat5
important for the response to prolactin alone (31). Thus, the finding
implies that either the transcriptional activation in the synergistic
response is predominantly mediated by the GR, or that a cryptic
transactivation domain of Stat5 is unmasked by the interaction with the
GR. Stat5 molecules lacking the carboxyl-terminal transactivation
domain have been described as dominant negative (31). They efficiently
inhibited the activation of prolactin-dependent genes,
presumably because they retained the ability to bind DNA and thereby
were able to compete with transcriptionally active, full-length Stat5
molecules. Since, as shown in Fig. 6, carboxyl-terminally deleted
Stat5s are not impaired in their ability to synergize with the GR to
activate transcription, these molecules should allow the specific
repression of genes regulated by prolactin only, without affecting
genes synergistically regulated by both dexamethasone and prolactin.
Further mutation and deletion experiments will reveal the domains of
Stat5 required for a functional interaction with GR. It will be
interesting to see whether other steroid receptors can also interact
with Stat5 and whether other members of the Stat family are able to
cooperate with the glucocorticoid receptor.
FOOTNOTES
*
This work was supported by the Fonds zur Förderung der
Wissenschaftlichen Forschung, Project F209.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
To whom correspondence should be addressed. Tel.:
43-512-507-3505; Fax: 43-512-507-2872.
1
The abbreviations used are: MGF/Stat5, mammary
gland specific factor/signal transducer and activator of transcription
5; GR, glucocorticoid receptor; CAT, chloramphenicol acetyltransferase; GR-DBD, glucocorticoid receptor DNA-binding domain.
2
T. Welte, unpublished data.
ACKNOWLEDGEMENTS
We thank S. Philipp, N. Greier, and C. Soratroi for excellent technical assistance, Dr. R. K. Ball for
the mouse prolactin receptor expression vector, Dr. T. Schlake for the
luciferase expression vector, Dr. S. Rusconi for providing the rat
glucocorticoid receptor expression vector, and Dr. H. Klocker and Dr.
A. Helmberg for critical reading of the manuscript.
REFERENCES
-
Doppler, W., Groner, B., and Ball, R. K.
(1989)
Proc. Natl. Acad. Sci. U. S. A.
86,
104-108
[Abstract/Free Full Text]
-
Pierre, S., Jolivet, G., Devinoy, E., and Houdebine, L. M.
(1994)
Mol. Endocrinol.
8,
1720-1730
[Abstract/Free Full Text]
-
Yoshimura, M., and Oka, T.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
3670-3674
[Abstract/Free Full Text]
-
Schmidhauser, C., Casperson, G. F., Myers, C. A., Sanzo, K. T., Bolten, S., and Bissell, M. J.
(1992)
Mol. Biol. Cell
3,
699-709
[Abstract]
-
Doppler, W., Villunger, A., Jennewein, P., Brduscha, A., Groner, B., and Ball, R. K.
(1991)
Mol. Endocrinol.
5,
1624-1632
[Abstract/Free Full Text]
-
Goldberg, Y., Treier, M., Ghysdael, J., and Bohmann, D.
(1994)
J. Biol. Chem.
269,
16566-16573
[Abstract/Free Full Text]
-
Devinoy, E., Maliénou-N
Gassa, R., Thépot, D., Puissant, C., and Houdebine, L. M.
(1991)
Mol. Cell. Endocrinol.
81,
185-193
[CrossRef][Medline]
[Order article via Infotrieve]
-
Burdon, T. G., Maitland, K. A., Clark, A. J., Wallace, R., and Watson, C. J.
(1994)
Mol. Endocrinol.
8,
1528-1536
[Abstract/Free Full Text]
-
Schmitt-Ney, M., Doppler, W., Ball, R. K., and Groner, B.
(1991)
Mol. Cell. Biol.
11,
3745-3755
[Abstract/Free Full Text]
-
Li, S., and Rosen, J. M.
(1995)
Mol. Cell. Biol.
15,
2063-2070
[Abstract]
-
Schmitt-Ney, M., Happ, B., Ball, R. K., and Groner, B.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
3130-3134
[Abstract/Free Full Text]
-
Welte, T., Garimorth, K., Philipp, S., and Doppler, W.
(1994)
Mol. Endocrinol.
8,
1091-1102
[Abstract/Free Full Text]
-
Welte, T., Philipp, S., Cairns, C., Gustafsson, J.-Å., and Doppler, W.
(1993)
J. Steroid Biochem. Mol. Biol.
47,
75-81
[CrossRef][Medline]
[Order article via Infotrieve]
-
Li, S., and Rosen, J. M.
(1994)
Mol. Endocrinol.
8,
1328-1335
[Abstract/Free Full Text]
-
Beato, M.
(1989)
Cell
56,
335-344
[CrossRef][Medline]
[Order article via Infotrieve]
-
Truss, M., Chalepakis, G., Slater, E. P., Mader, S., and Beato, M.
(1991)
Mol. Cell. Biol.
11,
3247-3258
[Abstract/Free Full Text]
-
Drouin, J., Sun, Y. L., Tremblay, S., Lavender, P., Schmidt, T. J., de Léan, A., and Nemer, M.
(1992)
Mol. Endocrinol.
6,
1299-1309
[Abstract/Free Full Text]
-
Slater, E. P., Hesse, H., Müller, J. M., and Beato, M.
(1993)
Mol. Endocrinol.
7,
907-914
[Abstract/Free Full Text]
-
Wakao, H., Gouilleux, F., and Groner, B.
(1994)
EMBO J.
13,
2182-2191
[Medline]
[Order article via Infotrieve]
-
Stöcklin, E., Wissler, M., Gouilleux, F., and Groner, B.
(1996)
Nature
383,
726-728
[CrossRef][Medline]
[Order article via Infotrieve]
-
Deng, W. P., and Nickoloff, J. A.
(1992)
Anal. Biochem.
200,
81-88
[CrossRef][Medline]
[Order article via Infotrieve]
-
Doppler, W., Höck, W., Hofer, P., Groner, B., and Ball, R. K.
(1990)
Mol. Endocrinol.
4,
912-919
[Abstract/Free Full Text]
-
Doppler, W., Welte, T., and Philipp, S.
(1995)
J. Biol. Chem.
270,
17962-17969
[Abstract/Free Full Text]
-
Luckow, B., and Schütz, G.
(1987)
Nucleic Acids Res.
15,
5490
[Free Full Text]
-
Ellis, L., Clauser, E., Morgan, D. O., Edery, M., Roth, R. A., and Rutter, W. J.
(1986)
Cell
45,
721-732
[CrossRef][Medline]
[Order article via Infotrieve]
-
Severne, Y., Wieland, S., Schaffner, W., and Rusconi, S.
(1988)
EMBO J.
7,
2503-2508
[Medline]
[Order article via Infotrieve]
-
Welte, T., Garimorth, K., Philipp, S., Jennewein, P., Huck, C., Cato, A. C. B., and Doppler, W.
(1994)
Eur. J. Biochem.
223,
997-1006
[Medline]
[Order article via Infotrieve]
-
Dahlman, K., Strömstedt, P.-E., Rae, C., Jörnvall, H., Flock, J.-I., Carlstedt-Duke, J., and Gustafsson, J.-Å.
(1989)
J. Biol. Chem.
264,
804-809
[Abstract/Free Full Text]
-
Brasier, A. R., Tate, J. E., and Habener, J. F.
(1989)
Biotechniques
7,
1116-1122
[Medline]
[Order article via Infotrieve]
-
Cairns, W., Cairns, C., Pongratz, I., Poellinger, L., and Okret, S.
(1991)
J. Biol. Chem.
266,
11221-11226
[Abstract/Free Full Text]
-
Moriggl, R., Gouilleux-Gruart, V., Jähne, R., Berchtold, S., Gartmann, C., Liu, X., Henninghausen, L., Sotiropoulos, A., Groner, B., and Gouilleux, F.
(1996)
Mol. Cell. Biol.
16,
5691-5700
[Abstract]
-
Schindler, U., Wu, P., Rothe, M., Brasseur, M., and McKnight, S. L.
(1995)
Immunity
2,
689-697
[CrossRef][Medline]
[Order article via Infotrieve]
-
Lucas, P. C., and Granner, D. K.
(1992)
Annu. Rev. Biochem.
61,
1131-1173
[CrossRef][Medline]
[Order article via Infotrieve]
-
Doppler, W.
(1994)
Rev. Physiol. Biochem. Pharmacol.
124,
93-130
[Medline]
[Order article via Infotrieve]
-
Bamberger, C. M., Schulte, H. M., and Chrousos, G. P.
(1996)
Endocr. Rev.
17,
245-261
[Abstract/Free Full Text]
-
Schüle, R., Muller, M., Kaltschmidt, C., and Renkawitz, R.
(1988)
Science
242,
1418-1420
[Abstract/Free Full Text]
-
Ray, A., and Prefontaine, K. E.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
752-756
[Abstract/Free Full Text]
-
Nishio, Y., Isshiki, H., Kishimoto, T., and Akira, S.
(1993)
Mol. Cell. Biol.
13,
1854-1862
[Abstract/Free Full Text]
-
Ponta, H., Cato, A. C., and Herrlich, P.
(1992)
Biochim. Biophys. Acta
1129,
255-261
[Medline]
[Order article via Infotrieve]
-
Heck, S., Kullmann, M., Gast, A., Ponta, H., Rahmsdorf, H. J., Herrlich, P., and Cato, A. C.
(1994)
EMBO J.
13,
4087-4095
[Medline]
[Order article via Infotrieve]
-
Diamond, M. I., Miner, J. N., Yoshinaga, S. K., and Yamamoto, K. R.
(1990)
Science
249,
1266-1272
[Abstract/Free Full Text]
-
Hill, C. S., and Treisman, R.
(1995)
EMBO J.
14,
5037-5047
[Medline]
[Order article via Infotrieve]
-
Perez, C., Coeffier, E., Moreau-Gachelin, F., Wietzerbin, J., and Benech, P. D.
(1994)
Mol. Cell. Biol.
14,
5023-5031
[Abstract/Free Full Text]
-
Mikita, T., Campbell, D., Wu, P., Williamson, K., and Schindler, U.
(1996)
Mol. Cell Biol.
16,
5811-5820
[Abstract]
-
Schumann, R. R., Kirschning, C. J., Unbehaun, A., Aberle, H., Knopf, H. P., Lamping, N., Ulevitch, R. J., and Herrmann, F.
(1996)
Mol. Cell. Biol.
16,
3490-3503
[Abstract]
-
Schaefer, T. S., Sanders, L. K., and Nathans, D.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
9097-9101
[Abstract/Free Full Text]
-
Xu, X. A., Sun, Y. L., and Hoey, T.
(1996)
Science
273,
794-797
[Abstract]
-
Bhattacharya, S., Eckner, R., Grossman, S., Oldread, E., Arany, Z., D'Andrea, A., and Livingston, D. M.
(1996)
Nature
383,
344-347
[CrossRef][Medline]
[Order article via Infotrieve]
-
Kato, S., Tora, L., Yamauchi, J., Masushige, S., Bellard, M., and Chambon, P.
(1992)
Cell
68,
731-742
[CrossRef][Medline]
[Order article via Infotrieve]
-
Ball, R. K., Friis, R. R., Schoenenberger, C. A., Doppler, W., and Groner, B.
(1988)
EMBO J.
7,
2089-2095
[Medline]
[Order article via Infotrieve]
-
Chan, G. C.-K., Hess, P., Meenakshi, T., Carlstedt-Duke, J., Gustafsson, J.-Å., and Payvar, F.
(1991)
J. Biol. Chem.
266,
22634-22644
[Abstract/Free Full Text]
-
La Baer, J., and Yamamoto, K. R.
(1994)
J. Mol. Biol.
239,
664-688
[CrossRef][Medline]
[Order article via Infotrieve]
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
G. F Anhe, T. C A Nogueira, J. E Nicoletti-Carvalho, C. Lellis-Santos, H. C Barbosa, J. Cipolla-Neto, J. R Bosqueiro, A. C Boschero, and S. Bordin
Signal transducer and activator of transcription 3-regulated sarcoendoplasmic reticulum Ca2+-ATPase 2 expression by prolactin and glucocorticoids is involved in the adaptation of insulin secretory response during the peripartum period
J. Endocrinol.,
October 1, 2007;
195(1):
17 - 27.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Xu, V. A. Spencer, and M. J. Bissell
Extracellular Matrix-regulated Gene Expression Requires Cooperation of SWI/SNF and Transcription Factors
J. Biol. Chem.,
May 18, 2007;
282(20):
14992 - 14999.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. C. Buser, E. K. Gass-Handel, S. L. Wyszomierski, W. Doppler, S. A. Leonhardt, J. Schaack, J. M. Rosen, H. Watkin, S. M. Anderson, and D. P. Edwards
Progesterone Receptor Repression of Prolactin/Signal Transducer and Activator of Transcription 5-Mediated Transcription of the {beta}-Casein Gene in Mammary Epithelial Cells
Mol. Endocrinol.,
January 1, 2007;
21(1):
106 - 125.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Vanselow, W. Yang, J. Herrmann, H. Zerbe, H.-J. Schuberth, W. Petzl, W. Tomek, and H.-M. Seyfert
DNA-remethylation around a STAT5-binding enhancer in the {alpha}S1-casein promoter is associated with abrupt shutdown of {alpha}S1-casein synthesis during acute mastitis
J. Mol. Endocrinol.,
December 1, 2006;
37(3):
463 - 477.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. B. Kabotyanski, M. Huetter, W. Xian, M. Rijnkels, and J. M. Rosen
Integration of Prolactin and Glucocorticoid Signaling at the {beta}-Casein Promoter and Enhancer by Ordered Recruitment of Specific Transcription Factors and Chromatin Modifiers
Mol. Endocrinol.,
October 1, 2006;
20(10):
2355 - 2368.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. M. Necela and J. A. Cidlowski
Mechanisms of Glucocorticoid Receptor Action in Noninflammatory and Inflammatory Cells
Proceedings of the ATS,
November 1, 2004;
1(3):
239 - 246.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. B. Smith, R. Gasa, H. Watada, J. Wang, S. C. Griffen, and M. S. German
Neurogenin3 and Hepatic Nuclear Factor 1 Cooperate in Activating Pancreatic Expression of Pax4
J. Biol. Chem.,
October 3, 2003;
278(40):
38254 - 38259.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Paukku, J. Yang, and O. Silvennoinen
Tudor and Nuclease-Like Domains Containing Protein p100 Function as Coactivators for Signal Transducer and Activator of Transcription 5
Mol. Endocrinol.,
September 1, 2003;
17(9):
1805 - 1814.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. R. Kappeler, Z. Farah, and Z. Puhan
5'-Flanking Regions of Camel Milk Genes Are Highly Similar to Homologue Regions of Other Species and Can be Divided into Two Distinct Groups
J Dairy Sci,
February 1, 2003;
86(2):
498 - 508.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. E. Timsit and D. S. Riddick
Stimulation of Hepatic Signal Transducer and Activator of Transcription 5b by GH Is Not Altered by 3-Methylcholanthrene
Endocrinology,
September 1, 2002;
143(9):
3284 - 3294.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Tonko-Geymayer, O. Goupille, M. Tonko, C. Soratroi, A. Yoshimura, C. Streuli, A. Ziemiecki, R. Kofler, and W. Doppler
Regulation and Function of the Cytokine-Inducible SH-2 Domain Proteins, CIS and SOCS3, in Mammary Epithelial Cells
Mol. Endocrinol.,
July 1, 2002;
16(7):
1680 - 1695.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-L. Carsol, S. Gingras, and J. Simard
Synergistic Action of Prolactin (PRL) and Androgen on PRL-Inducible Protein Gene Expression in Human Breast Cancer Cells: A Unique Model for Functional Cooperation between Signal Transducer and Activator of Transcription-5 and Androgen Receptor
Mol. Endocrinol.,
July 1, 2002;
16(7):
1696 - 1710.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Rycyzyn and C. V. Clevenger
The intranuclear prolactin/cyclophilin B complex as a transcriptional inducer
PNAS,
May 14, 2002;
99(10):
6790 - 6795.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. H. Faulds, K. Pettersson, J.-A. Gustafsson, and L.-A. Haldosen
Cross-Talk Between ERs and Signal Transducer and Activator of Transcription 5 Is E2 Dependent and Involves Two Functionally Separate Mechanisms
Mol. Endocrinol.,
November 1, 2001;
15(11):
1929 - 1940.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Biola, P. Lefebvre, M. Perrin-Wolff, M. Sturm, J. Bertoglio, and M. Pallardy
Interleukin-2 Inhibits Glucocorticoid Receptor Transcriptional Activity through a Mechanism Involving STAT5 (Signal Transducer and Activator of Transcription 5) but Not AP-1
Mol. Endocrinol.,
July 1, 2001;
15(7):
1062 - 1076.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Doppler, M. Windegger, C. Soratroi, J. Tomasi, J. Lechner, S. Rusconi, A. C. B. Cato, T. Almlöf, J. Liden, S. Okret, et al.
Expression Level-Dependent Contribution of Glucocorticoid Receptor Domains for Functional Interaction with STAT5
Mol. Cell. Biol.,
May 1, 2001;
21(9):
3266 - 3279.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
S. L. Wyszomierski and J. M. Rosen
Cooperative Effects of STAT5 (Signal Transducer and Activator of Transcription 5) and C/EBP {beta} (CCAAT/Enhancer-Binding Protein-{beta}) on {beta}-Casein Gene Transcription Are Mediated by the Glucocorticoid Receptor
Mol. Endocrinol.,
February 1, 2001;
15(2):
228 - 240.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
S. GEYMAYER and W. DOPPLER
Activation of NF-{kappa}B p50/p65 is regulated in the developing mammary gland and inhibits STAT5-mediated {beta}-casein gene expression
FASEB J,
June 1, 2000;
14(9):
1159 - 1170.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
S. Aittomaki, M. Pesu, B. Groner, O. A. Janne, J. J. Palvimo, and O. Silvennoinen
Cooperation Among Stat1, Glucocorticoid Receptor, and PU.1 in Transcriptional Activation of the High-Affinity Fc{gamma} Receptor I in Monocytes
J. Immunol.,
June 1, 2000;
164(11):
5689 - 5697.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Olazabal, J. Muñoz, S. Ogueta, E. Obregón, and J. P. García-Ruiz
Prolactin (PRL)-PRL Receptor System Increases Cell Proliferation Involving JNK (c-Jun Amino Terminal Kinase) and AP-1 Activation: Inhibition by Glucocorticoids
Mol. Endocrinol.,
April 1, 2000;
14(4):
564 - 575.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
J. D. Lord, B. C. McIntosh, P. D. Greenberg, and B. H. Nelson
The IL-2 Receptor Promotes Lymphocyte Proliferation and Induction of the c-myc, bcl-2, and bcl-x Genes Through the trans-Activation Domain of Stat5
J. Immunol.,
March 1, 2000;
164(5):
2533 - 2541.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K Thiele, A Bierhaus, F Autschbach, M Hofmann, W Stremmel, H Thiele, R Ziegler, and P P Nawroth
Cell specific effects of glucocorticoid treatment on the NF-kappa Bp65/Ikappa Balpha system in patients with Crohn's disease
Gut,
November 1, 1999;
45(5):
693 - 704.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. E. Benton, K.-S. Chen, J. D. Haag, C. A. Sattler, and M. N. Gould
Precocious Differentiation of the Virgin Wistar-Kyoto Rat Mammary Gland
Endocrinology,
June 1, 1999;
140(6):
2659 - 2671.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
S. L. Wyszomierski, J. Yeh, and J. M. Rosen
Glucocorticoid Receptor/Signal Transducer and Activator of Transcription 5 (STAT5) Interactions Enhance STAT5 Activation by Prolonging STAT5 DNA Binding and Tyrosine Phosphorylation
Mol. Endocrinol.,
February 1, 1999;
13(2):
330 - 343.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
Y.-C. Zhou and D. J. Waxman
Cross-talk between Janus Kinase-Signal Transducer and Activator of Transcription (JAK-STAT) and Peroxisome Proliferator-activated Receptor-alpha (PPARalpha ) Signaling Pathways. GROWTH HORMONE INHIBITION OF PPARalpha TRANSCRIPTIONAL ACTIVITY MEDIATED BY STAT5b
J. Biol. Chem.,
January 29, 1999;
274(5):
2672 - 2681.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Chida, H. Wakao, A. Yoshimura, and A. Miyajima
Transcriptional Regulation of the {beta}-Casein Gene by Cytokines: Cross-Talk between STAT5 and Other Signaling Molecules
Mol. Endocrinol.,
November 1, 1998;
12(11):
1792 - 1806.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
P. B. Brake, L. Zhang, and C. R. Jefcoate
Aryl Hydrocarbon Receptor Regulation of Cytochrome P4501B1 in Rat Mammary Fibroblasts: Evidence for Transcriptional Repression by Glucocorticoids
Mol. Pharmacol.,
November 1, 1998;
54(5):
825 - 833.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
E. Pfitzner, R. Jähne, M. Wissler, E. Stoecklin, and B. Groner
p300/CREB-Binding Protein Enhances the Prolactin-Mediated Transcriptional Induction through Direct Interaction with the Transactivation Domain of Stat5, but Does Not Participate in the Stat5-Mediated Suppression of the Glucocorticoid Response
Mol. Endocrinol.,
October 1, 1998;
12(10):
1582 - 1593.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
C. Bole-Feysot, V. Goffin, M. Edery, N. Binart, and P. A. Kelly
Prolactin (PRL) and Its Receptor: Actions, Signal Transduction Pathways and Phenotypes Observed in PRL Receptor Knockout Mice
Endocr. Rev.,
June 1, 1998;
19(3):
225 - 268.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
N. Cella, B. Groner, and N. E. Hynes
Characterization of Stat5a and Stat5b Homodimers and Heterodimers and Their Association with the Glucocortiocoid Receptor in Mammary Cells
Mol. Cell. Biol.,
April 1, 1998;
18(4):
1783 - 1792.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
M. Kanzaki and P. L. Morris
Lactogenic Hormone-Inducible Phosphorylation and Gamma-Activated Site-Binding Activities of Stat5b in Primary Rat Leydig Cells and MA-10 Mouse Leydig Tumor Cells
Endocrinology,
April 1, 1998;
139(4):
1872 - 1882.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. J. Lukiw, R. P. Pelaez, J. Martinez, and N. G. Bazan
Budesonide epimer R or dexamethasone selectively inhibit platelet-activating factor-induced or interleukin 1beta -induced DNA binding activity of cis-acting transcription factors and cyclooxygenase-2 gene expression in human epidermal keratinocytes
PNAS,
March 31, 1998;
95(7):
3914 - 3919.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. L. Sadowski, T.-S. Choi, M. Le, T. T. Wheeler, L.-H. Wang, and H. B. Sadowski
Insulin Induction of SOCS-2 and SOCS-3 mRNA Expression in C2C12 Skeletal Muscle Cells Is Mediated by Stat5*
J. Biol. Chem.,
June 1, 2001;
276(23):
20703 - 20710.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1997 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|