Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lechner, J.
Right arrow Articles by Doppler, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lechner, J.
Right arrow Articles by Doppler, W.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 33, Issue of August 15, 1997 pp. 20954-20960
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Promoter-dependent Synergy between Glucocorticoid Receptor and Stat5 in the Activation of beta -Casein Gene Transcription*

(Received for publication, February 4, 1997, and in revised form, May 15, 1997)

Judith Lechner Dagger , Thomas Welte Dagger , Jürgen K. Tomasi Dagger , Patrick Bruno Dagger , Carol Cairns §, Jan-Åke Gustafsson § and Wolfgang Doppler Dagger

From the Dagger  Institut für Medizinische Chemie und Biochemie, Universität Innsbruck, Fritz-Pregl-Straße 3, A-6020 Innsbruck, Austria and the § Department of Medical Nutrition, Karolinska Institute, Huddinge University Hospital F60, Novum, S-14186 Huddinge, Sweden

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES


ABSTRACT

Steroid hormone receptors and Stat factors comprise two distinct families of inducible transcription factors. Activation of a member of each family, namely the glucocorticoid receptor by glucocorticoids and Stat5 by prolactin, is required for the efficient induction of the expression of milk protein genes in the mammary epithelium. We have studied the mode of interaction between Stat5 and the glucocorticoid receptor in the activation of beta -casein gene transcription. The functional role of potential half-palindromic glucocorticoid receptor-binding sites mapped previously in the promoter region was investigated. beta -Casein gene promoter chloramphenicol acetyltransferase constructs containing mutations and deletions in these sites were tested for their responsiveness to the synergistic effect of prolactin and dexamethasone employing COS-7 cells or HC11 mammary epithelial cells. Synergism depended on promoter regions containing intact binding sites for the glucocorticoid receptor and Stat5. The carboxyl-terminal transactivation domains of Stat5a and Stat5b were not required for this synergism. Our results suggest that in lactogenic hormone response elements glucocorticoid receptor molecules bound to nonclassical half-palindromic sites gain competence as transcriptional activators by the interaction with Stat5 molecules binding to vicinal sites.


INTRODUCTION

The stage-specific regulation of milk protein gene expression is controlled by the lactogenic hormones glucocorticoids and prolactin. Both hormones have been documented to synergistically induce the expression of these genes at the level of transcription initiation (1). Lactogenic hormone response elements have been defined in the promoter region and upstream enhancer regions of the genes encoding the milk proteins alpha S1-casein (2), beta -casein (1, 3, 4), whey acidic protein (5-7), and beta -lactoglobulin (8). They all contain binding sites for the prolactin inducible transcription factor MGF/Stat51 (2, 8-10). A mutation introduced into the Stat5-binding site has been shown to destroy the response of the promoter not only to prolactin but also to glucocorticoids (11), indicating that Stat5 is necessary for mediating the effects of prolactin and glucocorticoids. Glucocorticoids do not significantly change the binding activity of MGF/Stat5 to lactogenic hormone response elements (12), ruling out the possibility that they act synergistically with prolactin simply by enhancing the effect of prolactin on the activation of Stat5 DNA binding.

In vitro binding studies with purified preparations of the glucocorticoid receptor revealed the presence of multiple GR-binding sites in the lactogenic response elements of the rat beta -casein gene promoter (13), the proximal mouse whey acidic protein gene promoter (13), and the distal rat whey acidic protein gene promoter (14). Interestingly, only sequence motifs resembling half-palindromic GR-binding sites were contained within the footprinted regions. Transactivation mediated by the glucocorticoid receptor usually requires the binding of dimeric receptor molecules to palindromic DNA-binding sites (15-17), whereas half-sites binding monomeric GR complexes have been reported to be insufficient by themselves to confer hormone responsiveness (17). However, monomeric GR molecules binding to receptor half-palindromic sites were proposed to gain competence as transcriptional activators by interacting with other transcription factors (18).

We tested whether GR molecules binding to half-palindromic sites in the rat beta -casein gene promoter can functionally interact with MGF/Stat5 in the activation of milk protein gene transcription. COS-7 cells were employed in transient co-transfection assays using wild-type and mutated beta -casein gene promoter CAT constructs. These cells allow the reconstitution of prolactin-dependent signaling cascades by transfection of prolactin receptor and Stat5 expression vectors (19). They also can be used to study the synergy between Stat5 and GR in cotransfection experiments (20). The results presented here suggest that GR half-palindromic sites serve to recruit GR molecules to the beta -casein gene promoter and are instrumental for mediating the synergistic effect between glucocorticoids and prolactin. Experiments with stably transfected HC11 mammary epithelial cells, which do not overexpress Stat5 and GR molecules, lead to the same conclusion. Efficient transactivation by GR molecules was dependent on the activation and binding of Stat5 to its recognition site. Interestingly, transactivation was also possible with Stat5 molecules devoid of their carboxyl-terminal transactivation domain.


MATERIALS AND METHODS

Plasmids

beta -Casein gene promoter constructs with mutations in the glucocorticoid receptor half-sites were prepared by site-directed mutagenesis using the protocol of Deng and Nickoloff (21). The beta -casein CAT promoter gene pbeta c(-344/-1)CAT was used as a template (22). The selection primer for introducing the first mutation was 5'-CCCCGGGTACAGATCTCGAATTCGT-3'. It destroys the unique SacI and KpnI cutting sites, replacing them with a BglII site. For a second round of mutation, the primer 5'-GGATCGATCCTCGAGTACAGATCT-3' was used. It destroys the unique SmaI site and creates a novel XhoI site. The primers used for introducing mutations into the GR sites (in parentheses) were: 5'-CCTTGTTTAAGCTTCCCCAGAATT-3' (mGRc), 5'-TTTCTAATCAAGCTTACTTCTTGGA-3' (mGRd), 5'TTGGAATTAACAGACTTTTGAA3' (mGRe), and 5'-TTTCTAATCAAGCTTACTTCTTGGAATTAACAGACTTTTGAA-3' (mGRd and mGRe). For mutations in the GR sites of footprints a and b the Quick ChangeTM site-directed mutagenesis protocol of Stratagene was used. The upper strands of the oligonucleotides employed were: 5'-GGCTGGGGAGAATTCTGATGACTGTTTACTAGGCTGGAG-3' (mGRa); 5'-GGCTGGAGAGAATTCCAGTTATTTGACAATTTCCTTTCC-3' (mGRa/b); 5'-CAATTTCCTTTCCTTGACGAATTCCTTCACCAGCTTCTG-3' (mGRb). The construct with the mutation of the MGF/Stat5 site and the heterologous beta -casein gene thymidine kinase (tk) promoter CAT constructs employed have been described (23). The construct pMMTV-CAT was prepared by inserting a 1.3-kilobase pair PstI/BamHI fragment, spanning the region from -1187 to +102 of the mouse mammary tumor virus-long terminal repeat, into the 5' polylinker of pBLCAT3 (24). The constitutively active luciferase expression vector pAGLuE5, driven by the SV40 early promoter, was provided by Dr. T. Schlake. Stat5 expression vectors were constructed by insertion of Stat5a and Stat5b cDNA cloned from a mouse mammary gland lambda  ZAP library2 into pECE (25). The carboxylterminally deleted forms of Stat5a and Stat5b were prepared by introducing a stop codon at amino acid 738 position of Stat5a and the corresponding position (amino acid 742) of Stat5b. The rat glucocorticoid expression vector PSTC GR 3-795 (26) contains the cDNA of the rat glucocorticoid receptor encoding amino acids 3-795.

Cell Culture and Hormone Inductions

COS-7 cells were propagated in Dulbecco's modified Eagle's medium containing 10% heat-inactivated fetal calf serum, and 50 µg/ml gentamycin. HC11 cells were grown in RPMI 1640 medium supplemented with 10% heat-inactivated fetal calf serum, 5 µg/ml insulin, 10 ng/ml epidermal growth factor, and 50 µg/ml gentamycin. Prior to hormone treatment, HC11 cells were kept for 2 days in epidermal growth factor-free medium containing 2% fetal calf serum as described (23). Hormone inductions were performed with 5 µg/ml ovine prolactin (31 units/mg, Sigma) and 0.1 µM dexamethasone (Sigma), as indicated.

Electromobility Shift Assays

Experimental procedures were as described previously (23). Double-stranded oligonucleotides labeled with [gamma -32P]ATP (>6000 Ci/mmol) and annealed to the complementary oligonucleotides as described (23) were used. The sequence of the upper strand of the oligonucleotides employed was: SIE, 5'-GTGCATTTCCCGTAAATCTTGTCTACAATTC-3'; PRE, 5'-AGCTTAGAACACAGTGTTCTCTAGAC-3'; GRc, 5'-GCTGCCTTGTTTAATGTCCCCCAGAATTTCTTGG-3'; mGRc, 5'-GCTGCCTTGTTTAAGCTTCCCCAGAATTTCTTGG-3'; GRd+e, 5'-CTAATCATGTGGACTTCTTGGAATTAAGGGACTTTTG-3'. Electromobility shift assays were performed on a 4% polyacrylamide gel in 0.25 × TBE electrophoresis buffer. Binding reactions were as described (27). GR-DBD expressed in Escherichia coli was purified as described (28) and used for binding reactions in a buffer containing 10 mM Hepes, pH 7.5, 2.5 mM MgCl2, 10% glycerol (w/v), 50 mM KCl, 0.1 mM EDTA, 1 mM dithiothreitol, 50 ng of poly(dI-dC).

Cell Transfection and CAT Assay

Transfections with the calcium phosphate precipitation technique, selection and propagation of stably transfected HC11 cells, and CAT assays were performed as described (27). Transient transfection of COS-7 cells were made with cultures plated on 6-well dishes. The total amount of cotransfected DNA was 20 µg/6 wells. For preparing extracts to determine CAT and luciferase activity, COS-7 cells were washed with ice-cold phosphate-buffered saline, incubated for 5 min with 1 ml of buffer containing 40 mM Tris-HCl, pH 7.5, 1 mM EDTA, 150 mM NaCl, and harvested by scraping them off the dish with a rubber policeman. The subsequent steps were performed at 0-4 °C. Two aliquots of 450 µl each of the resuspended cells were transferred to a microcentrifuge tube, centrifuged for 5 min at 1000 × g, and the supernatants were removed by aspiration. One of the aliquots was used for determination of CAT activity (27). A luciferase assay was performed with the other aliquot as described (29).


RESULTS

Reconstitution of Promoter-dependent Synergy between the Glucocorticoid Receptor and Stat5 in COS-7 Cells

A regulatory region in the beta -casein gene promoter required for the synergistic action of glucocorticoid hormones and prolactin was mapped in HC11 mammary epithelial cells (1, 23). It comprises the MGF/Stat5 site and a region located 5' to this site. We have investigated the role of this 5' region in mediating the synergy between glucocorticoids and prolactin in COS-7 cells. These cells were shown to be a suitable system to study the prolactin-dependent transactivation activity of Stat5 (19). Cotransfections were performed with expression plasmids for mouse Stat5a, mouse prolactin receptor, and a beta -casein (-344/-1) promoter CAT reporter gene. Increasing amounts of a glucocorticoid receptor expression plasmid were included. The cotransfected cells were stimulated with dexamethasone or prolactin or a combination of both. In the absence of cotransfected glucocorticoid receptors (Fig. 1, first 4 columns) dexamethasone did not have a significant effect on transcription. The synergism between dexamethasone and prolactin increased in a concentration dependent fashion by cotransfection of GR expression vector (Fig. 1). Using 40-1000 ng of GR expression vector the synergistic effect approached the level observed in HC11 cells for the regulation of a stably transfected beta -casein (-344/-1) gene promoter CAT construct (23). Further cotransfection studies were performed with 200 ng of GR expression vector.


Fig. 1. Effect of glucocorticoids and prolactin on the induction of the beta -casein gene promoter in COS-7 cells transfected with Stat5a and glucocorticoid receptor expression vectors. The indicated amount (in nanograms) of the rat GR expression vector PSTC-GR3-795 was cotransfected with 4 µg of the mouse prolactin receptor expression vector pcDNAI-PRLR, 4 µg of the mouse Stat5a expression vector pECEStat5a, 8 µg of the beta -casein gene promoter CAT reporter pbeta c(-344/-1)CAT, and 2 µg of the SV40 luciferase construct pAGLu-E5. The total amount of transfected DNA was adjusted to 20 µg with pUC18. 24 h after transfection, cells were stimulated with dexamethasone (0.1 µM) and/or prolactin (5 µg/ml). Extracts were prepared 24 h after hormone stimulation and analyzed for CAT and luciferase activity as described under "Materials and Methods." Results are represented as relative units of CAT activity normalized to luciferase activity. The means ± S.E. of two separate hormone inductions are shown. Control, not hormone treated; Dex, dexamethasone-treated; PRL, prolactin-treated; Dex + PRL, dexamethasone and prolactin treated COS-7 transfectants.
[View Larger Version of this Image (35K GIF file)]

We next investigated whether the MGF/Stat5 site alone is sufficient to mediate the synergistic response in COS-7 cells. A 30-base pair region comprising the MGF/Stat5 site in the beta -casein gene promoter or a region extending from -344 to -82 cloned in front of a thymidine kinase-CAT reporter gene were analyzed. The short fragment with the MGF/Stat5 site only conferred a transcriptional response upon prolactin stimulation to the thymidine kinase-CAT reporter (Fig. 2). However, no synergism was observed with dexamethasone. By contrast, a marked increase in transcriptional activation was obtained upon stimulation with dexamethasone and prolactin, when the beta -casein gene promoter fragment (-344/-82) was used. The synergistic transcriptional activation mediated by prolactin and dexamethasone is hence dependent on sequences 5' to the MGF/Stat5 site in COS-7 cells as has been found previously in HC11 cells (23).


Fig. 2. Dependence of hormonal synergy on 5'-flanking sequence. COS-7 cells were transfected with 200 ng of PSTC-GR3-795, 4 µg of pcDNAI-PRLR, 4 µg of pECEStat5a, 2 µg of pAGLu-E5, and 8 µg of the thymidine kinase-CAT reporter construct specified at the bottom of the diagram. tk, pBLCAT2 (24); (-104/-75)tk, heterologous promoter construct containing the region between -104 and -75 of the rat beta -casein gene promoter in front of the thymidine kinase promoter. (-344/-82)tk, contains the region between -344 and -82 of the rat beta -casein gene promoter. Relative CAT activities were measured as described in the legend to Fig. 1.
[View Larger Version of this Image (31K GIF file)]

Glucocorticoid Receptor Half-palindromic Sites in the beta -Casein Gene Promoter

In a previous study GR-binding sites were mapped in the rat beta -casein gene promoter by in vitro footprint analysis using purified rat liver glucocorticoid receptor (13). Five regions were identified to be protected from digestion by DNase I (Fig. 3, footprints a-e). They contain sequence motifs related to half-sites of classical glucocorticoid response elements. The functionality of the putative half-site contained in footprint c to bind the GR was investigated by electromobility shift assays employing the DNA-binding domain of the glucocorticoid receptor (GR-DBD, Fig. 4A). The oligonucleotide GRc, spanning the footprinted region c of the beta -casein gene promoter and a corresponding oligonucleotide harboring a mutation in the putative half-site (mGRc, mutation as shown in Fig. 3) were used as DNA probes. A classical palindromic GR-binding site (PRE) and a sequence devoid of described GR-binding sites (SIE) served as controls. Very weak binding was observed with the SIE (Fig. 4A, lanes 1 and 2). With a palindromic GRE (PRE oligo) two retarded bands were detected (Fig. 4A, lanes 3 and 4). The two bands represent complexes containing receptor monomers or dimers. This is in accordance with previous reports (18, 30). With the GRc probe, formation of a complex migrating at the position of receptor monomers was observed (Fig. 4A, lanes 5 and 6). Binding activity of the mutated GRc probe was reduced to the low level observed with to the SIE probe (Fig. 4A, compare lanes 1 and 2 with 7 and 8). The experiment confirms the assumption that the integrity of the half-palindromic site in the GRc probe is required for the binding of the GR. In electromobility shift assays with a DNA probe comprising the half-sites in GRd and GRe (GRd+e), formation of complexes with two receptor molecules was observed at high concentrations of GR-DBD (Fig. 4B, lanes 1 and 2). Electromobility shift assays performed with oligonucleotides with targeted mutations in either Grd or GRe palindromic half-sites revealed that the integrity of the half-sites in GRd and GRe is important for the formation of these complexes (data not shown). In comparison to the PRE probe with the palindromic GR site (Fig. 4B, lanes 5-7), formation of complexes containing two receptor molecules required significantly higher concentration of the GR-DBD (Fig. 4B, compare lanes 1 and 2 to lanes 5 and 6), indicating that the configuration of the two binding sites in GRd+e does not favor co-operative binding of GR molecules to the same extent as the classical palindromic site in PRE.


Fig. 3. GR-binding sites in the lactogenic hormone response element of the rat beta -casein gene promoter. The sequence between -300 and -61 of the rat beta -casein gene promoter together with the localization of the footprints a-e, mapped previously by DNase I footprinting with the rat liver GR (13), is shown. Potential hexameric GR half-sites are represented by boxes with arrows indicating their orientation compared with a palindromic site. They all contain a G in the second position, a T in the third position, and a C in the fifth position which have been shown to be of crucial importance for binding (52). The mutations mGRa, mGRa/b, mGRb, mGRc, mGRd, and mGRe introduced into the half-sites of footprints a-e are shown on top of the sequence. The position of the major MGF/Stat5-binding site is depicted by an ellipsis.
[View Larger Version of this Image (37K GIF file)]


Fig. 4. Electromobility shift assays with the GR DNA-binding domain (GR-DBD). The activity of beta -casein gene promoter derived oligonucleotides to bind the GR-DBD was compared with a palindromic GR-binding site (PRE). Conditions of the binding reaction and sequence of the employed oligonucleotides are specified under "Materials and Methods." The positions of the free probe (f) and the two GR-DBD complexes are marked on the left margin. They are interpreted to contain one (mono) or two (di) GR-DBD molecules. The oligonucleotide probes employed are indicated on the top of each lane. A, footprinted region c: SIE, oligonucleotide with no known binding site for the GR (lanes 1 and 2); PRE (lanes 3 and 4); GRc, oligonucleotide spanning footprint c (lanes 5 and 6); mGRC, mutated GRc (lanes 7 and 8, mutation as depicted in Fig. 3). 2 µl (lanes 1, 3, 5, and 7) and 1 µl (lanes 2, 4, 6, and 8) of GR-DBD were used. B, footprinted regions d and e: GRd+e, oligonucleotide spanning GR half-sites GRd and GRe (lanes 1-4); PRE (lanes 5-8). 300 ng (lanes 1 and 5), 150 ng (lanes 2 and 6), 75 ng (lanes 3 and 7), or no GR-DBD (lanes 4 and 8) were used.
[View Larger Version of this Image (35K GIF file)]

Glucocorticoid Receptor-binding Sites Are Required for Promoter Function

To determine the importance of the GR sites for promoter function, mutations affecting the various GR half-site were introduced into the beta -casein (-344/-1)CAT plasmid. The mutations employed are shown in Fig. 3 on top of the sequence. Cotransfections with the mutated promoter constructs were performed in COS-7 cells as described above. The ability of dexamethasone to augment the response of prolactin was quantified by determining the ratio of the CAT activity in cells stimulated with dexamethasone and prolactin versus the activity in cells treated with prolactin only (Fig. 5A). Mutations in GR half-sites a, b, c, and e led to a reduction of the ratio to 17 (mGRa), 29 (mGRa/b), 30 (mGRb), 34 (mGRc), and 42% (mGRe) of the wild-type beta -casein CAT construct. The induction ratio was almost completely abolished in constructs harboring double mutations of GRc and GRe (Fig. 5A, mutations mGRc+e and mGRc+d+e), indicating a co-operation of these binding sites for mediating the synergism of GR with Stat5. The effect of a mutation in GRd was not statistically significant. This mutation also had no significant additional effect when combined with mutations of either GRc or GRe or both (Fig. 5A, mutations mGRd, mGRc+d, mGRd+e, and mGRc+d+e).


Fig. 5. Effect of mutations introduced into GR and MGF/Stat5-binding sites of the beta -casein gene promoter on the synergism between glucocorticoids and prolactin. A, effect of GR half-site mutations on the synergistic effect of dexamethasone in COS-7. Cells were transiently cotransfected with the wild-type (-344/-1)CAT reporter construct (w.t.) or mutated versions as specified at the bottom of the columns together with expression vectors for Stat5a, prolactin receptor, glucocorticoid receptor, and luciferase as described in the legend to Fig. 2. The CAT activity was measured in extracts treated for 24 h either with dexamethasone and prolactin, or only with prolactin, and normalized to luciferase activity. The ratio of the activity in dexamethasone and prolactin-treated cells versus the activity in prolactin-treated cells was calculated. Bars show the mean ratio ± S.E. of three experiments, each performed with at least duplicate inductions. B, effect of the triple GR site mutation and the MGF/Stat5 mutation on transactivation in COS-7 (top panel) and HC11 cells (bottom panel). Transient co-transfection experiments and hormone inductions of COS-7 cells were performed as described in the legend to Fig. 2. HC11 cells were stably transfected with the specified constructs and CAT activity was determined in extracts of confluent HC11 cells treated with dexamethasone (0.1 µM) and prolactin (5 µg/ml) for 4 days (+ Dex/PRL), or of cells without hormones (-Dex/PRL). CAT activity is shown relative to hormone treated wild-type promoter constructs. Results are expressed as mean ± S.E. of at least three independent determinations. C, role of the beta -casein gene promoter region between -344 and -170 on mediating the synergy between glucocorticoid and prolactin. The indicated constructs were transiently cotransfected into COS-7 cells and lactogenic hormone regulated expression was analyzed as described in the legend to Fig. 2. Results are expressed as mean ± S.E. of three independent determinations.
[View Larger Version of this Image (38K GIF file)]

As shown in the upper panel of Fig. 5B for COS-7 cells, the activation of transcription by prolactin alone was not altered by the triple GR mutation, indicating that the effect is selective on the action of glucocorticoids. Mutation of the MGF/Stat5 site, however, strongly interfered with the prolactin response. In this mutant the synergistic effect of dexamethasone was also reduced. The weak but significant induction observed is most probably explained by an incomplete inhibition of Stat5 binding by the mutation. The data presented document the functional importance of the GR half-sites in GRa, GRb, GRc, and GRe for GR action. Furthermore, they show the dependence of GR on co-operation with Stat5, which also has to bind to the promoter.

To examine whether the findings obtained in Stat5 and GR overexpressing COS-7 cells are also relevant for the situation in mouse mammary epithelial cells expressing physiological levels of these two transcription factors, HC11 cells were stably transfected with the same mutated reporter constructs (Fig. 5B, lower panel). The results obtained in HC11 cells supported the conclusions drawn from the experiments with the COS-7 cell system. The triple mutation affecting the three GR-binding sites c, d, and e strongly reduced the synergistic activation of the beta -casein promoter by dexamethasone and prolactin. Destroying the Stat5-binding site also inhibited prolactin- and dexamethasone-induced transactivation.

To determine whether the GR sites in GRc and GRe are sufficient for mediating the synergism with Stat5, constructs were prepared with 5' deletions of the beta -casein promoter placed in front of a minimal thymidine kinase promoter and analyzed in COS-7 cotransfection experiments (Fig. 5C). A (-176/-82)beta -casein thymidine kinase promoter which harbors the GRc- and GRe-binding sites failed to confer the prolactin and dexamethasonedependent synergistic transactivation. The responsiveness to dexamethasone and prolactin was restored in the constructs which contain the regions GRa and GRb (Fig. 5C, pbeta c(-344/-82)thymidine kinase-CAT and pbeta c(-282/-82)thymidine kinase-CAT)). Thus, the distal beta -casein gene promoter region with the GR-binding sites for GRa and GRb is necessary for mediating the synergism between GR and Stat5. As shown above (Fig. 5A), the functionality of this region is dependent on the integrity of the proximal GR-binding sites in GRc and GRe, implying that the synergism depends on a co-operation of distal and proximal sites.

The Carboxyl-terminal Transactivation Domain of Stat5 Is Not Required for the Synergism with the Glucocorticoid Receptor

The two highly related Stat5 molecules Stat5a and Stat5b are expressed in the mammary epithelium. We wanted to examine whether they behave similarly in synergizing with the GR. Cotransfection experiments in COS-7 cells were performed as above. As shown in Fig. 6, no significant differences were observed in transactivation of the beta -casein gene promoter upon induction with dexamethasone and prolactin. We also tested carboxyl-terminally deleted forms of Stat5a and Stat5b, lacking the region with the major transcriptional activation domain (31). Surprisingly, the deleted forms were as efficient as the full-length Stat5 isoforms in their synergy with the GR. Thus, the transactivation domain in the carboxyl-terminal region of Stat5 is not required for the establishment of the synergism with the glucocorticoid receptor.


Fig. 6. Synergy of the GR with different forms of Stat5. The specified Stat5 forms were cotransfected into COS-7 cells and determination of CAT activity was performed as described in the legend to Fig. 2. The structure of the expression vectors with the carboxyl-terminally deleted form of Stat5a and Stat5b is described under "Materials and Methods." Results are shown as means ± S.E. of two hormone inductions.
[View Larger Version of this Image (47K GIF file)]


DISCUSSION

The steroid receptor superfamily and Stat molecules represent two archetypal families of signaling molecules which evolved to meet the requirement of cells to respond differentially to diverse extracellular stimuli. The specificity of the response is controlled at two levels (15, 32): At the first level, there is a selective activation of steroid receptors or Stat factors by different extracellular signals. This is achieved by the specific binding of the steroid receptors to their ligands and the selective recruitment of Stat factors by their activating receptors. The second level of specificity is brought about by the recognition of distinct DNA-binding sites by the activated steroid receptors and Stat factors.

Integration of different signaling pathways is a further means to increase the versatility of the response to extracellular stimuli (33-35). In this study we have investigated how integration of the signaling pathways triggered by the two pleiotropic hormones prolactin and glucocorticoids leads to the specific activation of milk protein gene transcription.

When this article was in preparation, Stöcklin et al. (20) reported a direct interaction between Stat5 and the GR overexpressed in COS-7 cells. A model was proposed where the GR acts as a co-activator of Stat5 in a mode which is independent of a GRE. The results presented in our study do not support this model, since they provide clear evidence that GR and Stat5 molecules, activated by the two hormones, interact in a lactogenic hormone response element dependent fashion. DNA-binding sites for both the GR and Stat5 were demonstrated to be essential in mediating their synergism on beta -casein gene induction. However, protein-protein interactions between GR and Stat5, as the one observed by Stöcklin et al. (20), might also be important for a productive functional interaction of GR and Stat5 molecules, recruited to the lactogenic hormone response elements of milk protein gene promoters. In fact, a role for both DNA-template dependent and independent interactions of the GR or Stat5 with other transcription factors has been demonstrated frequently. GR homodimers bound to palindromic GR consensus sites were described to interact with several unrelated transcription factors bound to vicinal sites (15, 33, 36). In addition, direct DNA-template independent interactions of the GR with the transcription factors NFkappa B (37), NF-IL6 (38), and AP-1 (reviewed in Ref. 39) have been reported. Protein-protein interactions of GR monomers and AP-1 were suggested to be involved in the repression of transcription factor AP-1 activity (40). Interactions involving both DNA binding and protein-protein contacts are the hallmark of composite glucocorticoid response elements (41), which mediate a positive or negative effect of glucocorticoids on transcription depending on the type of the cooperating transcription factor.

For Stat factors, DNA template-dependent synergy with members of the Ets family and C/EBP has been described. In the c-fos gene promoter, Stat1 and Stat3 cooperate with ternary complex factors (42); in the Fcgamma receptor gene, Stat1 cooperates with PU.1 (43); for the induction of the interleukin-4 gene vicinal sites of Stat6 and C/EBP have been found to be important (44); activation of the lipopolysaccharide-binding protein required Stat3, C/EBP, and AP-1 sites (45). Examples of direct binding of Stats to other proteins involved in transcription are the interaction of the Stat3beta splice variant with c-jun (46); the cooperative interactions of dimeric Stat molecules with themselves, mediated by the NH2-terminal domain of Stats (47); and the binding of the carboxyl-terminal domain of Stat2 to the p300/CBP transcriptional adaptor (48).

GR molecules usually utilize palindromic sites for high affinity DNA binding. They are composed of hexameric half-sites with the consensus 5'-TGTTCT-3' spaced by 3 nucleotides (15). The GR-binding sites characterized in the lactogenic hormone response elements were non-classical sites. They represent half-palindromic sites (13, 14). Half-sites binding monomeric GR molecules have been found to be unable to confer glucocorticoid-inducible transcription on a heterologous promoter by themselves (17). However, in complex glucocorticoid response elements, half-palindromic sites have been mapped which are essential in mediating the effect of glucocorticoid hormones (17, 18). Functional half-palindromic binding sites were also described for the estrogen receptor in the far upstream estrogen response element of the ovalbumin gene (49). Mutational analysis of the three proximal GR half-sites in the beta -casein gene promoter (Fig. 5A) revealed the functional importance of the half-palindromic sites in GRa, GRb, GRc, and GRe. In the lactogenic hormone response element the utilization of half-sites by the GR appears to be one important means for ensuring the stage-specific activation of milk protein expression: here, glucocorticoids are unable to induce transcription via the GR half-sites alone, but require the synergy with Stat5 activated by prolactin. Although the unusual spacing and orientation of GR half-sites in lactogenic hormone response elements would not allow a favorable steric alignment of GRs like the one observed with classical GREs, direct interactions between receptors bound to several sites might be important. In addition, or alternatively, interactions of the GR with other factors binding to neighboring sites could stabilize the binding of the GR to half-palindromes. For the beta -casein gene a cooperative binding between C/EBP and GR could be important, since several binding sites for C/EBP were mapped vicinal to GR half-palindromic sites (23). In the case of the whey acidic protein gene promoter, CTF/NF-1 could be involved (10, 14).

Two cellular systems were employed in the present study. COS-7 cells allowed to assess directly the role of Stat5 in transient cotransfection experiments. However, a drawback of this system is that the cells are not of mammary epithelial origin and the expression levels of Stat5 and GR are very high, giving rise to the question whether the results obtained are relevant for the in vivo regulation of milk protein genes by lactogenic hormones. We thus also used HC11 mammary epithelial cells which can be induced by glucocorticoids and prolactin to express the endogenous beta -casein gene. It was possible to demonstrate a functional role of GR half-sites in mediating the response of lactogenic hormones in this cell line (Fig. 5B), suggesting that the mechanism of interaction between GR and Stat5 is the same in HC11 and COS-7 cells and thus of general relevance for the regulation of milk protein gene expression.

In HC11 cells the action of lactogenic hormones on milk protein expression is slow (50). An indirect effect of glucocorticoids on transcription, mediated by the activation or repression of a gene regulated by the GR has been described to account for the slow response (22). Our data presented here implicate that, in addition, the GR exerts a direct effect on the lactogenic hormone response element. Regulation of gene expression by direct and indirect mechanisms has also been reported to account for the action of glucocorticoids on the alpha 2-uteroglobulin (51) and the alpha -amylase 2 (18) genes, which both contain functional GR half-sites similar as the lactogenic hormone response elements.

Stat5a and Stat5b, which differ significantly in their carboxyl terminus, were equally potent in their cooperativity with the GR (Fig. 6). Interestingly, Stat5 devoid of the carboxyl terminus was as efficient in mediating the synergism with the GR as full-length Stat5. The deleted region contains the major transactivation domain of Stat5 important for the response to prolactin alone (31). Thus, the finding implies that either the transcriptional activation in the synergistic response is predominantly mediated by the GR, or that a cryptic transactivation domain of Stat5 is unmasked by the interaction with the GR. Stat5 molecules lacking the carboxyl-terminal transactivation domain have been described as dominant negative (31). They efficiently inhibited the activation of prolactin-dependent genes, presumably because they retained the ability to bind DNA and thereby were able to compete with transcriptionally active, full-length Stat5 molecules. Since, as shown in Fig. 6, carboxyl-terminally deleted Stat5s are not impaired in their ability to synergize with the GR to activate transcription, these molecules should allow the specific repression of genes regulated by prolactin only, without affecting genes synergistically regulated by both dexamethasone and prolactin. Further mutation and deletion experiments will reveal the domains of Stat5 required for a functional interaction with GR. It will be interesting to see whether other steroid receptors can also interact with Stat5 and whether other members of the Stat family are able to cooperate with the glucocorticoid receptor.


FOOTNOTES

*   This work was supported by the Fonds zur Förderung der Wissenschaftlichen Forschung, Project F209.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
   To whom correspondence should be addressed. Tel.: 43-512-507-3505; Fax: 43-512-507-2872.
1   The abbreviations used are: MGF/Stat5, mammary gland specific factor/signal transducer and activator of transcription 5; GR, glucocorticoid receptor; CAT, chloramphenicol acetyltransferase; GR-DBD, glucocorticoid receptor DNA-binding domain.
2   T. Welte, unpublished data.

ACKNOWLEDGEMENTS

We thank S. Philipp, N. Greier, and C. Soratroi for excellent technical assistance, Dr. R. K. Ball for the mouse prolactin receptor expression vector, Dr. T. Schlake for the luciferase expression vector, Dr. S. Rusconi for providing the rat glucocorticoid receptor expression vector, and Dr. H. Klocker and Dr. A. Helmberg for critical reading of the manuscript.


REFERENCES

  1. Doppler, W., Groner, B., and Ball, R. K. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 104-108 [Abstract/Free Full Text]
  2. Pierre, S., Jolivet, G., Devinoy, E., and Houdebine, L. M. (1994) Mol. Endocrinol. 8, 1720-1730 [Abstract/Free Full Text]
  3. Yoshimura, M., and Oka, T. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 3670-3674 [Abstract/Free Full Text]
  4. Schmidhauser, C., Casperson, G. F., Myers, C. A., Sanzo, K. T., Bolten, S., and Bissell, M. J. (1992) Mol. Biol. Cell 3, 699-709 [Abstract]
  5. Doppler, W., Villunger, A., Jennewein, P., Brduscha, A., Groner, B., and Ball, R. K. (1991) Mol. Endocrinol. 5, 1624-1632 [Abstract/Free Full Text]
  6. Goldberg, Y., Treier, M., Ghysdael, J., and Bohmann, D. (1994) J. Biol. Chem. 269, 16566-16573 [Abstract/Free Full Text]
  7. Devinoy, E., Maliénou-N'Gassa, R., Thépot, D., Puissant, C., and Houdebine, L. M. (1991) Mol. Cell. Endocrinol. 81, 185-193 [CrossRef][Medline] [Order article via Infotrieve]
  8. Burdon, T. G., Maitland, K. A., Clark, A. J., Wallace, R., and Watson, C. J. (1994) Mol. Endocrinol. 8, 1528-1536 [Abstract/Free Full Text]
  9. Schmitt-Ney, M., Doppler, W., Ball, R. K., and Groner, B. (1991) Mol. Cell. Biol. 11, 3745-3755 [Abstract/Free Full Text]
  10. Li, S., and Rosen, J. M. (1995) Mol. Cell. Biol. 15, 2063-2070 [Abstract]
  11. Schmitt-Ney, M., Happ, B., Ball, R. K., and Groner, B. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 3130-3134 [Abstract/Free Full Text]
  12. Welte, T., Garimorth, K., Philipp, S., and Doppler, W. (1994) Mol. Endocrinol. 8, 1091-1102 [Abstract/Free Full Text]
  13. Welte, T., Philipp, S., Cairns, C., Gustafsson, J.-Å., and Doppler, W. (1993) J. Steroid Biochem. Mol. Biol. 47, 75-81 [CrossRef][Medline] [Order article via Infotrieve]
  14. Li, S., and Rosen, J. M. (1994) Mol. Endocrinol. 8, 1328-1335 [Abstract/Free Full Text]
  15. Beato, M. (1989) Cell 56, 335-344 [CrossRef][Medline] [Order article via Infotrieve]
  16. Truss, M., Chalepakis, G., Slater, E. P., Mader, S., and Beato, M. (1991) Mol. Cell. Biol. 11, 3247-3258 [Abstract/Free Full Text]
  17. Drouin, J., Sun, Y. L., Tremblay, S., Lavender, P., Schmidt, T. J., de Léan, A., and Nemer, M. (1992) Mol. Endocrinol. 6, 1299-1309 [Abstract/Free Full Text]
  18. Slater, E. P., Hesse, H., Müller, J. M., and Beato, M. (1993) Mol. Endocrinol. 7, 907-914 [Abstract/Free Full Text]
  19. Wakao, H., Gouilleux, F., and Groner, B. (1994) EMBO J. 13, 2182-2191 [Medline] [Order article via Infotrieve]
  20. Stöcklin, E., Wissler, M., Gouilleux, F., and Groner, B. (1996) Nature 383, 726-728 [CrossRef][Medline] [Order article via Infotrieve]
  21. Deng, W. P., and Nickoloff, J. A. (1992) Anal. Biochem. 200, 81-88 [CrossRef][Medline] [Order article via Infotrieve]
  22. Doppler, W., Höck, W., Hofer, P., Groner, B., and Ball, R. K. (1990) Mol. Endocrinol. 4, 912-919 [Abstract/Free Full Text]
  23. Doppler, W., Welte, T., and Philipp, S. (1995) J. Biol. Chem. 270, 17962-17969 [Abstract/Free Full Text]
  24. Luckow, B., and Schütz, G. (1987) Nucleic Acids Res. 15, 5490 [Free Full Text]
  25. Ellis, L., Clauser, E., Morgan, D. O., Edery, M., Roth, R. A., and Rutter, W. J. (1986) Cell 45, 721-732 [CrossRef][Medline] [Order article via Infotrieve]
  26. Severne, Y., Wieland, S., Schaffner, W., and Rusconi, S. (1988) EMBO J. 7, 2503-2508 [Medline] [Order article via Infotrieve]
  27. Welte, T., Garimorth, K., Philipp, S., Jennewein, P., Huck, C., Cato, A. C. B., and Doppler, W. (1994) Eur. J. Biochem. 223, 997-1006 [Medline] [Order article via Infotrieve]
  28. Dahlman, K., Strömstedt, P.-E., Rae, C., Jörnvall, H., Flock, J.-I., Carlstedt-Duke, J., and Gustafsson, J.-Å. (1989) J. Biol. Chem. 264, 804-809 [Abstract/Free Full Text]
  29. Brasier, A. R., Tate, J. E., and Habener, J. F. (1989) Biotechniques 7, 1116-1122 [Medline] [Order article via Infotrieve]
  30. Cairns, W., Cairns, C., Pongratz, I., Poellinger, L., and Okret, S. (1991) J. Biol. Chem. 266, 11221-11226 [Abstract/Free Full Text]
  31. Moriggl, R., Gouilleux-Gruart, V., Jähne, R., Berchtold, S., Gartmann, C., Liu, X., Henninghausen, L., Sotiropoulos, A., Groner, B., and Gouilleux, F. (1996) Mol. Cell. Biol. 16, 5691-5700 [Abstract]
  32. Schindler, U., Wu, P., Rothe, M., Brasseur, M., and McKnight, S. L. (1995) Immunity 2, 689-697 [CrossRef][Medline] [Order article via Infotrieve]
  33. Lucas, P. C., and Granner, D. K. (1992) Annu. Rev. Biochem. 61, 1131-1173 [CrossRef][Medline] [Order article via Infotrieve]
  34. Doppler, W. (1994) Rev. Physiol. Biochem. Pharmacol. 124, 93-130 [Medline] [Order article via Infotrieve]
  35. Bamberger, C. M., Schulte, H. M., and Chrousos, G. P. (1996) Endocr. Rev. 17, 245-261 [Abstract/Free Full Text]
  36. Schüle, R., Muller, M., Kaltschmidt, C., and Renkawitz, R. (1988) Science 242, 1418-1420 [Abstract/Free Full Text]
  37. Ray, A., and Prefontaine, K. E. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 752-756 [Abstract/Free Full Text]
  38. Nishio, Y., Isshiki, H., Kishimoto, T., and Akira, S. (1993) Mol. Cell. Biol. 13, 1854-1862 [Abstract/Free Full Text]
  39. Ponta, H., Cato, A. C., and Herrlich, P. (1992) Biochim. Biophys. Acta 1129, 255-261 [Medline] [Order article via Infotrieve]
  40. Heck, S., Kullmann, M., Gast, A., Ponta, H., Rahmsdorf, H. J., Herrlich, P., and Cato, A. C. (1994) EMBO J. 13, 4087-4095 [Medline] [Order article via Infotrieve]
  41. Diamond, M. I., Miner, J. N., Yoshinaga, S. K., and Yamamoto, K. R. (1990) Science 249, 1266-1272 [Abstract/Free Full Text]
  42. Hill, C. S., and Treisman, R. (1995) EMBO J. 14, 5037-5047 [Medline] [Order article via Infotrieve]
  43. Perez, C., Coeffier, E., Moreau-Gachelin, F., Wietzerbin, J., and Benech, P. D. (1994) Mol. Cell. Biol. 14, 5023-5031 [Abstract/Free Full Text]
  44. Mikita, T., Campbell, D., Wu, P., Williamson, K., and Schindler, U. (1996) Mol. Cell Biol. 16, 5811-5820 [Abstract]
  45. Schumann, R. R., Kirschning, C. J., Unbehaun, A., Aberle, H., Knopf, H. P., Lamping, N., Ulevitch, R. J., and Herrmann, F. (1996) Mol. Cell. Biol. 16, 3490-3503 [Abstract]
  46. Schaefer, T. S., Sanders, L. K., and Nathans, D. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 9097-9101 [Abstract/Free Full Text]
  47. Xu, X. A., Sun, Y. L., and Hoey, T. (1996) Science 273, 794-797 [Abstract]
  48. Bhattacharya, S., Eckner, R., Grossman, S., Oldread, E., Arany, Z., D'Andrea, A., and Livingston, D. M. (1996) Nature 383, 344-347 [CrossRef][Medline] [Order article via Infotrieve]
  49. Kato, S., Tora, L., Yamauchi, J., Masushige, S., Bellard, M., and Chambon, P. (1992) Cell 68, 731-742 [CrossRef][Medline] [Order article via Infotrieve]
  50. Ball, R. K., Friis, R. R., Schoenenberger, C. A., Doppler, W., and Groner, B. (1988) EMBO J. 7, 2089-2095 [Medline] [Order article via Infotrieve]
  51. Chan, G. C.-K., Hess, P., Meenakshi, T., Carlstedt-Duke, J., Gustafsson, J.-Å., and Payvar, F. (1991) J. Biol. Chem. 266, 22634-22644 [Abstract/Free Full Text]
  52. La Baer, J., and Yamamoto, K. R. (1994) J. Mol. Biol. 239, 664-688 [CrossRef][Medline] [Order article via Infotrieve]

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J EndocrinolHome page
G. F Anhe, T. C A Nogueira, J. E Nicoletti-Carvalho, C. Lellis-Santos, H. C Barbosa, J. Cipolla-Neto, J. R Bosqueiro, A. C Boschero, and S. Bordin
Signal transducer and activator of transcription 3-regulated sarcoendoplasmic reticulum Ca2+-ATPase 2 expression by prolactin and glucocorticoids is involved in the adaptation of insulin secretory response during the peripartum period
J. Endocrinol., October 1, 2007; 195(1): 17 - 27.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Xu, V. A. Spencer, and M. J. Bissell
Extracellular Matrix-regulated Gene Expression Requires Cooperation of SWI/SNF and Transcription Factors
J. Biol. Chem., May 18, 2007; 282(20): 14992 - 14999.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
A. C. Buser, E. K. Gass-Handel, S. L. Wyszomierski, W. Doppler, S. A. Leonhardt, J. Schaack, J. M. Rosen, H. Watkin, S. M. Anderson, and D. P. Edwards
Progesterone Receptor Repression of Prolactin/Signal Transducer and Activator of Transcription 5-Mediated Transcription of the {beta}-Casein Gene in Mammary Epithelial Cells
Mol. Endocrinol., January 1, 2007; 21(1): 106 - 125.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
J. Vanselow, W. Yang, J. Herrmann, H. Zerbe, H.-J. Schuberth, W. Petzl, W. Tomek, and H.-M. Seyfert
DNA-remethylation around a STAT5-binding enhancer in the {alpha}S1-casein promoter is associated with abrupt shutdown of {alpha}S1-casein synthesis during acute mastitis
J. Mol. Endocrinol., December 1, 2006; 37(3): 463 - 477.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
E. B. Kabotyanski, M. Huetter, W. Xian, M. Rijnkels, and J. M. Rosen
Integration of Prolactin and Glucocorticoid Signaling at the {beta}-Casein Promoter and Enhancer by Ordered Recruitment of Specific Transcription Factors and Chromatin Modifiers
Mol. Endocrinol., October 1, 2006; 20(10): 2355 - 2368.
[Abstract] [Full Text] [PDF]


Home page
Proc Am Thorac SocHome page
B. M. Necela and J. A. Cidlowski
Mechanisms of Glucocorticoid Receptor Action in Noninflammatory and Inflammatory Cells
Proceedings of the ATS, November 1, 2004; 1(3): 239 - 246.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. B. Smith, R. Gasa, H. Watada, J. Wang, S. C. Griffen, and M. S. German
Neurogenin3 and Hepatic Nuclear Factor 1 Cooperate in Activating Pancreatic Expression of Pax4
J. Biol. Chem., October 3, 2003; 278(40): 38254 - 38259.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
K. Paukku, J. Yang, and O. Silvennoinen
Tudor and Nuclease-Like Domains Containing Protein p100 Function as Coactivators for Signal Transducer and Activator of Transcription 5
Mol. Endocrinol., September 1, 2003; 17(9): 1805 - 1814.
[Abstract] [Full Text] [PDF]


Home page
J DAIRY SCIHome page
S. R. Kappeler, Z. Farah, and Z. Puhan
5'-Flanking Regions of Camel Milk Genes Are Highly Similar to Homologue Regions of Other Species and Can be Divided into Two Distinct Groups
J Dairy Sci, February 1, 2003; 86(2): 498 - 508.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Y. E. Timsit and D. S. Riddick
Stimulation of Hepatic Signal Transducer and Activator of Transcription 5b by GH Is Not Altered by 3-Methylcholanthrene
Endocrinology, September 1, 2002; 143(9): 3284 - 3294.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. Tonko-Geymayer, O. Goupille, M. Tonko, C. Soratroi, A. Yoshimura, C. Streuli, A. Ziemiecki, R. Kofler, and W. Doppler
Regulation and Function of the Cytokine-Inducible SH-2 Domain Proteins, CIS and SOCS3, in Mammary Epithelial Cells
Mol. Endocrinol., July 1, 2002; 16(7): 1680 - 1695.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J.-L. Carsol, S. Gingras, and J. Simard
Synergistic Action of Prolactin (PRL) and Androgen on PRL-Inducible Protein Gene Expression in Human Breast Cancer Cells: A Unique Model for Functional Cooperation between Signal Transducer and Activator of Transcription-5 and Androgen Receptor
Mol. Endocrinol., July 1, 2002; 16(7): 1696 - 1710.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. A. Rycyzyn and C. V. Clevenger
The intranuclear prolactin/cyclophilin B complex as a transcriptional inducer
PNAS, May 14, 2002; 99(10): 6790 - 6795.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. H. Faulds, K. Pettersson, J.-A. Gustafsson, and L.-A. Haldosen
Cross-Talk Between ERs and Signal Transducer and Activator of Transcription 5 Is E2 Dependent and Involves Two Functionally Separate Mechanisms
Mol. Endocrinol., November 1, 2001; 15(11): 1929 - 1940.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
A. Biola, P. Lefebvre, M. Perrin-Wolff, M. Sturm, J. Bertoglio, and M. Pallardy
Interleukin-2 Inhibits Glucocorticoid Receptor Transcriptional Activity through a Mechanism Involving STAT5 (Signal Transducer and Activator of Transcription 5) but Not AP-1
Mol. Endocrinol., July 1, 2001; 15(7): 1062 - 1076.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
W. Doppler, M. Windegger, C. Soratroi, J. Tomasi, J. Lechner, S. Rusconi, A. C. B. Cato, T. Almlöf, J. Liden, S. Okret, et al.
Expression Level-Dependent Contribution of Glucocorticoid Receptor Domains for Functional Interaction with STAT5
Mol. Cell. Biol., May 1, 2001; 21(9): 3266 - 3279.
[Abstract] [Full Text]


Home page
Mol. Endocrinol.Home page
S. L. Wyszomierski and J. M. Rosen
Cooperative Effects of STAT5 (Signal Transducer and Activator of Transcription 5) and C/EBP {beta} (CCAAT/Enhancer-Binding Protein-{beta}) on {beta}-Casein Gene Transcription Are Mediated by the Glucocorticoid Receptor
Mol. Endocrinol., February 1, 2001; 15(2): 228 - 240.
[Abstract] [Full Text]


Home page
FASEB J.Home page
S. GEYMAYER and W. DOPPLER
Activation of NF-{kappa}B p50/p65 is regulated in the developing mammary gland and inhibits STAT5-mediated {beta}-casein gene expression
FASEB J, June 1, 2000; 14(9): 1159 - 1170.
[Abstract] [Full Text]


Home page
J. Immunol.Home page
S. Aittomaki, M. Pesu, B. Groner, O. A. Janne, J. J. Palvimo, and O. Silvennoinen
Cooperation Among Stat1, Glucocorticoid Receptor, and PU.1 in Transcriptional Activation of the High-Affinity Fc{gamma} Receptor I in Monocytes
J. Immunol., June 1, 2000; 164(11): 5689 - 5697.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
I. Olazabal, J. Muñoz, S. Ogueta, E. Obregón, and J. P. García-Ruiz
Prolactin (PRL)-PRL Receptor System Increases Cell Proliferation Involving JNK (c-Jun Amino Terminal Kinase) and AP-1 Activation: Inhibition by Glucocorticoids
Mol. Endocrinol., April 1, 2000; 14(4): 564 - 575.
[Abstract] [Full Text]


Home page
J. Immunol.Home page
J. D. Lord, B. C. McIntosh, P. D. Greenberg, and B. H. Nelson
The IL-2 Receptor Promotes Lymphocyte Proliferation and Induction of the c-myc, bcl-2, and bcl-x Genes Through the trans-Activation Domain of Stat5
J. Immunol., March 1, 2000; 164(5): 2533 - 2541.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
K Thiele, A Bierhaus, F Autschbach, M Hofmann, W Stremmel, H Thiele, R Ziegler, and P P Nawroth
Cell specific effects of glucocorticoid treatment on the NF-kappa Bp65/Ikappa Balpha system in patients with Crohn's disease
Gut, November 1, 1999; 45(5): 693 - 704.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. E. Benton, K.-S. Chen, J. D. Haag, C. A. Sattler, and M. N. Gould
Precocious Differentiation of the Virgin Wistar-Kyoto Rat Mammary Gland
Endocrinology, June 1, 1999; 140(6): 2659 - 2671.
[Abstract] [Full Text]


Home page
Mol. Endocrinol.Home page
S. L. Wyszomierski, J. Yeh, and J. M. Rosen
Glucocorticoid Receptor/Signal Transducer and Activator of Transcription 5 (STAT5) Interactions Enhance STAT5 Activation by Prolonging STAT5 DNA Binding and Tyrosine Phosphorylation
Mol. Endocrinol., February 1, 1999; 13(2): 330 - 343.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
Y.-C. Zhou and D. J. Waxman
Cross-talk between Janus Kinase-Signal Transducer and Activator of Transcription (JAK-STAT) and Peroxisome Proliferator-activated Receptor-alpha (PPARalpha ) Signaling Pathways. GROWTH HORMONE INHIBITION OF PPARalpha TRANSCRIPTIONAL ACTIVITY MEDIATED BY STAT5b
J. Biol. Chem., January 29, 1999; 274(5): 2672 - 2681.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
D. Chida, H. Wakao, A. Yoshimura, and A. Miyajima
Transcriptional Regulation of the {beta}-Casein Gene by Cytokines: Cross-Talk between STAT5 and Other Signaling Molecules
Mol. Endocrinol., November 1, 1998; 12(11): 1792 - 1806.
[Abstract] [Full Text]


Home page
Mol. Pharmacol.Home page
P. B. Brake, L. Zhang, and C. R. Jefcoate
Aryl Hydrocarbon Receptor Regulation of Cytochrome P4501B1 in Rat Mammary Fibroblasts: Evidence for Transcriptional Repression by Glucocorticoids
Mol. Pharmacol., November 1, 1998; 54(5): 825 - 833.
[Abstract] [Full Text]


Home page
Mol. Endocrinol.Home page
E. Pfitzner, R. Jähne, M. Wissler, E. Stoecklin, and B. Groner
p300/CREB-Binding Protein Enhances the Prolactin-Mediated Transcriptional Induction through Direct Interaction with the Transactivation Domain of Stat5, but Does Not Participate in the Stat5-Mediated Suppression of the Glucocorticoid Response
Mol. Endocrinol., October 1, 1998; 12(10): 1582 - 1593.
[Abstract] [Full Text]


Home page
Endocr. Rev.Home page
C. Bole-Feysot, V. Goffin, M. Edery, N. Binart, and P. A. Kelly
Prolactin (PRL) and Its Receptor: Actions, Signal Transduction Pathways and Phenotypes Observed in PRL Receptor Knockout Mice
Endocr. Rev., June 1, 1998; 19(3): 225 - 268.
[Abstract] [Full Text]


Home page
Mol. Cell. Biol.Home page
N. Cella, B. Groner, and N. E. Hynes
Characterization of Stat5a and Stat5b Homodimers and Heterodimers and Their Association with the Glucocortiocoid Receptor in Mammary Cells
Mol. Cell. Biol., April 1, 1998; 18(4): 1783 - 1792.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
M. Kanzaki and P. L. Morris
Lactogenic Hormone-Inducible Phosphorylation and Gamma-Activated Site-Binding Activities of Stat5b in Primary Rat Leydig Cells and MA-10 Mouse Leydig Tumor Cells
Endocrinology, April 1, 1998; 139(4): 1872 - 1882.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
W. J. Lukiw, R. P. Pelaez, J. Martinez, and N. G. Bazan
Budesonide epimer R or dexamethasone selectively inhibit platelet-activating factor-induced or interleukin 1beta -induced DNA binding activity of cis-acting transcription factors and cyclooxygenase-2 gene expression in human epidermal keratinocytes
PNAS, March 31, 1998; 95(7): 3914 - 3919.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. L. Sadowski, T.-S. Choi, M. Le, T. T. Wheeler, L.-H. Wang, and H. B. Sadowski
Insulin Induction of SOCS-2 and SOCS-3 mRNA Expression in C2C12 Skeletal Muscle Cells Is Mediated by Stat5*
J. Biol. Chem., June 1, 2001; 276(23): 20703 - 20710.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lechner, J.
Right arrow Articles by Doppler, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lechner, J.
Right arrow Articles by Doppler, W.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1997 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement