JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Waldmann, R.
Right arrow Articles by Lazdunski, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Waldmann, R.
Right arrow Articles by Lazdunski, M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 34, Issue of August 22, 1997 pp. 20975-20978
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

COMMUNICATION:
Molecular Cloning of a Non-inactivating Proton-gated Na+ Channel Specific for Sensory Neurons*

(Received for publication, May 2, 1997, and in revised form, June 6, 1997)

Rainer Waldmann Dagger , Frédéric Bassilana Dagger , Jan de Weille Dagger , Guy Champigny , Catherine Heurteaux and Michel Lazdunski §

From the Institut de Pharmacologie Moléculaire et Cellulaire, CNRS, 660 route des Lucioles, Sophia Antipolis, 06560 Valbonne, France

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES


ABSTRACT

We have cloned and expressed a novel proton-gated Na+ channel subunit that is specific for sensory neurons. In COS cells, it forms a Na+ channel that responds to a drop of the extracellular pH with both a rapidly inactivating and a sustained Na+ current. This biphasic kinetic closely resembles that of the H+-gated current described in sensory neurons of dorsal root ganglia (1). Both the abundance of this novel H+-gated Na+ channel subunit in sensory neurons and the kinetics of the channel suggest that it is part of the channel complex responsible for the sustained H+-activated cation current in sensory neurons that is thought to be important for the prolonged perception of pain that accompanies tissue acidosis (1, 2).


INTRODUCTION

Many painful inflammatory and ischemic conditions are accompanied by a decrease of the extracellular pH (2, 3). H+-gated cation channels are present in sensory neurons (1, 4-6), and it is likely that those acid-sensing ion channels are the link between tissue acidosis and pain. We recently cloned a rapidly inactivating H+-gated cation channel ASIC1 (7) (acid-sensing ion channel). Fast inactivating H+-gated cation currents were described in neurons of the central nervous system (6, 8, 9) and in sensory neurons (4-6), tissues where ASIC is well expressed (7). However, rapidly inactivating H+-gated cation channels cannot account solely for the prolonged sensation of pain that accompanies tissue acidosis. Sensory neurons respond to a drop in pH with a rapidly inactivating followed by a sustained current, which is thought to mediate the non-adaptive pain caused by acids (1). Here we describe the cloning of a H+-gated cation channel specific for sensory neurons that has both a rapidly inactivating and a sustained component.


MATERIALS AND METHODS

Cloning of DRASIC

We used an anchored PCR approach to identify the sequences upstream and downstream of the expressed sequence tag (W62694). An double stranded adapter (anchor) was prepared by annealing the oligonucleotides GATTTAGGTGACACTATAGAATCGAGGTCGACGGTATCCAGTCGACGAATTC and PO4-GAATTCGTCGACTG-NH2. The shorter oligonucleotide was protected with a 3' NH2 group to avoid extension during the PCR reaction. This adapter was ligated to double stranded rat brain cDNA resulting in a cDNA with known sequences (the anchor) on both extremities. The so prepared anchored cDNA was used to amplify the 5' and the 3' end of the coding sequence by PCR. This was done using either the primer GATTTAGGTGACACTATAGAA or TAGAATCGAGGTCGACGGTATC, which are identical to parts of the longer of the two adapter oligonucleotides together with either the sense primer (CACTACACGCTATGCCAAGG, for amplification of the 3' end) or the antisense primer (CCCAGCAACTCCGACACTTC, for amplification of the 5' end) complementary to the expressed sequence tag (W62694). The PCR products were subcloned into Bluescript, and five clones each for the 5' PCR and for the 3' PCR were sequenced. The anchored PCR allowed us to identify the sequences upstream of the first ATG codon and downstream of the stop codon. However all clones isolated from brain contained introns with in frame stop codons and code for truncated proteins lacking the second transmembrane domain that was found to be essential for channel function (10). Analysis of the tissue distribution showed that high levels of the mRNA are only found in DRG. Primers flanking the coding sequence (sense: ACGAATTCTCCCTGGTCCAGCCATGAAAC, antisense: CCTCGAGCTAGAGCCTTGTGACGAGGTAA) that contained an EcoRI site (sense) or an XhoI site (antisense) were used to amplify the full-length coding sequence from DRG cDNA. The PCR product was digested with EcoRI and XhoI and subcloned into the EcoRI/SalI-digested PCI expression vector. One clone was sequenced on both strands, and two independent clones were sequenced on one strand using an Applied Biosystems sequencer. Unlike in brain, the three clones isolated from DRG code for full-length proteins.

Expression of the ASIC Subunits and Electrophysiology

COS7 cells were co-transfected with DRASIC cDNA in the PCI expression vector and an expression vector containing the CD8 receptor cDNA using DEAE-dextran. 3 days later, cells binding CD8 antibody-coated beads (11) were used for experiments. Ion currents were recorded using either the whole cell or the patch-clamp technique. The pipette solution contained (in mM): KCl 120, NaCl 30, MgCl2 2, EGTA 5, HEPES 10 (pH 7.2). For the "0 sodium" solution NaCl was replaced by KCl. The bath solution contained in mM: NaCl 140, KCl 5, MgCl2 2, CaCl2 2, HEPES 10 (pH 7.3). Rapid changes in extracellular pH were induced by opening an outlet of a microperfusion system at a distance of ~50 µm from the cell. Test solutions having a pH of less then 6 were buffered with 10 mM MES rather than HEPES. Experiments were carried out at room temperature (20-24 °C).

Northern Blot and in Situ Hybridization

4 µg of total RNA from dorsal root ganglia of 7-day-old rats and 4 µg of poly(A+) RNA from adult rat brain were separated on a 1% formaldehyde-agarose gel and subsequently transferred to nylon membranes. The blots were hybridized with a random prime 32P-labeled fragment of the DRASIC cDNA corresponding to nucleotide 141-1145 in 6 × SSC, 10 × Denhardt's solution, 0.1% SDS, 100 µg/ml herring sperm DNA, washed with 0.1 × SSC, 0.1% SDS at 70 °C, and subsequently exposed to a Fuji phosphoimager screen. For the in situ hybridizations on frozen fixed 10-µm brain sections from adult Wistar rats, we used a 33P-random prime-labeled fragment of DRASIC corresponding to nucleotide 141-1145. Brain sections from adult rats were hybridized with the 33P-end-labeled probes overnight at 37 °C in 50% formamide, 2 × SSC, and subsequently washed at room temperature in 1 × SSC. Sections (6 µm) and primary cultures of rat dorsal root ganglia were hybridized with double-stranded DNA fragments labeled by PCR with DIG-dUTP (sections), or fluorescein-12-dUTP (primary cultures). The probes used correspond to nucleotide 141-1145. Probe labeling, sample preparation, hybridization, and visualization of DIG nucleic acids with alkaline phosphatase-conjugated anti-DIG antibodies was carried out following the protocols from Boehringer Mannheim. Primary cultures of DRG neurons from 4-day-old rats were prepared essentially as described (1) and used for in situ hybridization after 7 days in culture. The in situ hybridization results shown were confirmed with one additional probe. Sequence positions given refer to the sequence submitted to GenBankTM.

Computer Analysis

The sequence alignment was computed with the GCG (Genetics Computer Group, Madison, WI) software package. All comparisons of sequences with data bases were done using the Blast network server at the National Center for Biotechnology Information (NCBI).


RESULTS AND DISCUSSION

Comparison of the ASIC protein sequence with the data base of expressed sequence tags identified one novel member of this family of ion channels. We used anchored PCR to clone the complete coding sequence from rat DRG. The DRASIC cDNA has an open reading frame of 1599 base pairs preceded by stop codons and codes for a protein of 533 amino acids. DRASIC belongs to the amiloride-sensitive Na+ channel (12-18)/degenerin (19-21) family of ion channels and shares 53% sequence identity with its closest relative ASIC (Fig. 1). A DRASIC transcript of approx 2.6 kilobases was detected in total RNA of DRG (Fig. 2a). In brain poly(A+) RNA where ASIC mRNA is abundant (7), no DRASIC transcript was detectable. Furthermore a mouse multitissue Northern blot (CLONTECH) with poly(A+) RNA from brain, heart, spleen, lung, liver, skeletal muscle kidney, and testis did not give any signal (not shown) with the probe that labeled the DRASIC mRNA in total RNA from DRG, indicating that DRASIC is specific for sensory neurons. In situ hybridization confirmed those results (Fig. 2, b-d). DRASIC is expressed in DRG neurons and absent in brain. The small sensory neurons are thought to carry the nociceptive signals from polymodal sensory nerve endings and interestingly small neurons are intensely labeled. The specific expression in sensory neurons suggests that the DRASIC channel has properties required for a specific function of this type of neuron. Expression of DRASIC in COS cells induced a H+-gated cation channel with properties clearly distinct from those of ASIC (7). A rapid decrease of the extracellular pH from pH 7.4 to pH 4 induces a fast rising, rapidly inactivating current followed by a much slower activating sustained inward current (Fig. 3a). Surprisingly, expression of DRASIC can induce both a rapidly and a slowly activating current. The kinetics of the DRASIC current very closely resemble the biphasic H+-gated cation current described in sensory neurons (1). Both the transient and the sustained DRASIC current reverse at +32 ± 3 mV (n = 5), which is close to the Na+ equilibrium potential of +40 mV in the experimental conditions concerned (Fig. 3b). This indicates that the two components are highly selective for Na+ (gNa+/gK+ = 13.5). Unitary currents were recorded from outside-out patches in the absence of Na+ in the pipette (Fig. 3, c and d). The slope conductance of DRASIC is with 12.6 ± 0.2 picosiemens (n = 3) (Fig. 3d), close to that reported for ASIC (14.3 picosiemens) (7). The unitary current has a reversal potential of +62 mV (Fig. 3d), indicating an 11.5-fold higher selectivity of the channel for Na+ over K+. Amiloride inhibits the transient current with a K0.5 of 63 ± 2 µM (Fig. 3, e and f). The effect of amiloride on the sustained DRASIC current is complex. In the presence of 200 µM amiloride where the transient current is inhibited by 68 ± 5% (Fig. 3, e and f), the sustained current is higher than in the absence of amiloride (Fig. 3e). A closer examination of the pH dependence of the DRASIC current shows that the transient and the sustained phase can be clearly separated (Fig. 3, g-i). The transient current is activated when the pH drops only slightly (half-maximal activation at pH 6.5 when stepping from pH 7.3; Fig. 3h) but requires an initial pH above 7 for full activation (Fig. 3i). On the contrary, the sustained current needs more important acidification (below pH 4) for activity (Fig. 3h) but may still be activated if the resting pH is far below pH 7 (Fig. 3i). The situation is similar in sensory neurons (1) where a slight acidification activates only the transient current, while both the transient and the sustained current are activated after more important drops of the extracellular pH. A H+-gated cation channel capable of mediating a prolonged sensation of pain during tissue acidosis should not only be activated when the pH drops rapidly but also when the pH decreases slowly, since this is likely to happen during the onset of a tissue acidosis. Unlike ASIC, that requires a rapid (<< 1 s) drop of the pH (not shown), DRASIC responds to slow decreases of the pH (Fig. 3j). If the extracellular pH is decreased gradually by approaching the cell slowly with the perfusion outlet, the first transient current disappears, while the sustained component still develops to its full size (Fig. 3j). The kinetics of the DRASIC channel and the fact that DRASIC mRNA is only present in sensory neurons, where it is abundant, suggest that DRASIC is part of the channel complex responsible for the sustained H+-gated current in sensory neurons. However, there are important differences between the non-inactivating DRASIC current and the sustained current described in sensory neurons (1). To activate the sustained DRASIC current, the pH has to become very acidic (pH 4; Fig. 3h), while a tonic response in sensory neurons is already obtained at pH 6 (1). Furthermore, both the rapidly inactivating and the sustained phase of the DRASIC current are highly selective for Na+, while in sensory neurons a transient Na+-selective current is followed by a sustained current that discriminates only poorly between Na+ and K+ (1). Those differences between the DRASIC current and the native current indicate that more than just DRASIC is required to form the non-inactivating H+-gated cation channel in sensory neurons. H+-gated sustained Na+-selective currents were never reported in sensory neurons, where DRASIC is well expressed, suggesting that DRASIC in sensory neurons has indeed properties distinct from the DRASIC channel expressed in COS cells. This might be due either to a specific posttranslational modification, such as phosphorylation, or to an association with other subunits. Heteromultimeric association of homologous subunits is commonly found with ion channels (22, 23) and might be the link between the DRASIC subunit and the sustained non-selective current recorded in sensory neurons. Furthermore, relatives of DRASIC, the amiloride-sensitive Na+ channel (13, 15, 16, 18) and the degenerins of Caenorhabditis elegans (19), even require several homologous subunits for correct function, and it would be surprising if this would not be the case for the H+-gated cation channels. ASIC, that is also expressed in sensory neurons (7), is not the missing partner of DRASIC since co-expression of both subunits yields currents that can be explained by two independent channels (not shown).


Fig. 1. Comparison of DRASIC with other members of this ion channel family. Residues identical or similar to the corresponding amino acid in DRASIC are printed white on black or black on gray background, respectively. The putative transmembrane regions (MI, MII) of DRASIC are labeled with black bars. MEC4 (24) is a degenerin of C. elegans, FaNaC is a peptide (FMRFamide)-gated Na+ channel (25) from Helix aspersa, and alpha ENaC is the epithelial amiloride-sensitive Na+ channel alpha  subunit (14).
[View Larger Version of this Image (82K GIF file)]


Fig. 2. Northern blot and in situ hybridization. a, Northern blot with 4 µg of total RNA of rat DRGs and 4 µg of poly(A+) RNA from rat brain. b-d, in situ hybridization. b, distribution of DRASIC mRNA in parasagittal sections of adult rat brain. Colors indicate the abundance (red, high expression; blue, non-detectable) of the transcript. Expression of the DRASIC transcript in 6-µm sections of dorsal root ganglia (DRG) from 3-week-old rats detected with digoxigenin-labeled probes. Dark brown tones indicate abundance of the transcript. d, DRASIC transcript in primary cultures of DRG neurons detected with a fluorescein labeled probe. Note the intense labeling of small diameter neurons.
[View Larger Version of this Image (32K GIF file)]


Fig. 3. Expression of DRASIC in COS cells. a, whole-cell current in response to a rapid drop in pH from 7.3 to 4 recorded at -60 mV. b, current-voltage relations of the peak and the sustained current recorded in the whole-cell configuration. Reversal potentials of both components are +32 ± 3 mV (n = 5). Na+ equilibrium potential at 40.1 mV. c, unitary currents recorded from an outside-out patch held at -50 mV and exposed to a drop in pH from 7.3 to 4. d, current-voltage relation of the unitary sustained current. The slope conductance is 12.6 ± 0.2 picosiemens, the current reverses at +62 ± 2 mV. Data are means from three patches. e, whole-cell currents in response to a drop in pH from 7.3 to 4, in the presence and absence of 200 µM amiloride. f, peak whole-cell current amplitude as a function of the amiloride concentration. pH steps were from pH 7.3 to pH 4. g, whole-cell currents recorded after a drop of the pH from different resting pH values to pH 4. h, peak and sustained whole-cell current amplitude as a function of test pH. Ordinate is expressed as a fraction of the saturation level of the Bolzmann fit. Peak current pH0.5 = 6.5, sustained current pH0.5 = 3.5. i, peak and sustained whole-cell current amplitude as a function of resting pH. Steps were to pH 4. Peak current pH0.5 = 6.9, sustained current pH0.5 = 4.9. The points in f, h, and i represent the mean ± S.E. from at least four cells. j, comparison between the responses to a slow or a rapid shift in pH. The slow shift, indicated by the dotted ramp, was obtained by slowly approaching the cell with the outlet of the perfusion tube from a distance of ~0.5 cm, while the rapid shift was induced by suddenly opening the perfusion tube at a distance of ~50 µm from the cell. Currents were recorded from DRASIC-transfected COS cells using either the whole-cell suction pipette technique with 140 mM extracellular Na+ and 30 mM intracellular Na+ or the outside-out patch-clamp technique with 140 mM Na+ in the bath solution 0 mM Na+ in the pipette.
[View Larger Version of this Image (24K GIF file)]

A diversity of H+-gated cation channels is described in both sensory neurons (1, 4-6) and in neurons of the central nervous system (6-9). It is therefore likely that new members of this ion channel family will be discovered in the near future. The localization of their mRNAs and proteins should allow studies about the interaction of different H+-gated cation channel subunits expressed in the same type of neuron and might lead to the identification of subunit combinations with properties identical to the native H+-gated channels. The identification of subunits that associate with DRASIC is of particular interest because of the potential importance of sustained H+-gated cation currents for the prolonged sensation of pain caused by acids. The development of blockers that are selective for a H+-gated cation channel specific for sensory neurons, such as DRASIC, might lead to the discovery of new non-addictive analgesics.


FOOTNOTES

*   This work was supported by the Centre National de la Recherche Scientifique (CNRS) and the Association Française contre les Myopathies (AFM).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Dagger    These authors contributed equally to this work.
§   To whom correspondence and reprint requests should be addressed: Institut de Pharmacologie Moléculaire et Cellulaire, CNRS, 660 route des Lucioles, Sophia Antipolis, 06560 Valbonne, France. Tel: 33-4-93-95-77-02 or 03; Fax: 33-4-93-95-77-04; E-mail: ipmc{at}unice.fr.
1   The abbreviations used are: ASIC, acid-sensing ion channel; DRASIC, dorsal root ganglia acid sensing ion channel; PCR, polymerase chain reaction; DRG, dorsal root ganglia; MES, 4-morpholineethanesulfonic acid; DIG, digoxigenin.

ACKNOWLEDGEMENTS

We are very grateful to Dr. Eric Lingueglia for helpful discussions and to Catherine Widmann, Gisèle Jarretou, Catherine Le Calvez, Martine Jodar, and Nathalie Leroudier for their skilful technical assistance, Dahvya Doume for secretarial assistance, and Frank Aguila for help with the artwork.


REFERENCES

  1. Bevan, S., and Yeats, J. (1991) J. Physiol. (Lond.) 433, 145-161 [Abstract/Free Full Text]
  2. Steen, K. H., Reeh, P. W., Anton, F., and Handwerker, H. O. (1992) J. Neurosci. 12, 86-95 [Abstract]
  3. Rang, H. P., Bevan, S., and Dray, A. (1991) Br. Med. Bull. 47, 534-548 [Abstract/Free Full Text]
  4. Krishtal, O. A., and Pidoplichko, V. I. (1981) Neuroscience 6, 2599-2601 [CrossRef][Medline] [Order article via Infotrieve]
  5. Konnerth, A., Lux, H. D., and Morad, M. (1987) J. Physiol. (Lond.) 386, 603-633 [Abstract/Free Full Text]
  6. Akaike, N., and Ueno, S. (1994) Prog. Neurobiol. 43, 73-83 [CrossRef][Medline] [Order article via Infotrieve]
  7. Waldmann, R., Champigny, G., Bassilana, F., Heurteaux, C., and Lazdunski, M. (1997) Nature 386, 173-177 [CrossRef][Medline] [Order article via Infotrieve]
  8. Grantyn, R., Perouansky, M., Rodriguez-Tebar, A., and Lux, H. D. (1989) Dev. Brain Res. 49, 150-155 [CrossRef][Medline] [Order article via Infotrieve]
  9. Ueno, S., Nakaye, T., and Akaike, N. (1992) J. Physiol. (Lond.) 447, 309-327 [Abstract/Free Full Text]
  10. Waldmann, R., Champigny, G., and Lazdunski, M. (1995) J. Biol. Chem. 270, 11735-11737 [Abstract/Free Full Text]
  11. Jurman, M. E., Boland, L. M., and Yellen, G. (1994) BioTechniques 17, 876-881 [Medline] [Order article via Infotrieve]
  12. Canessa, C. M., Horisberger, J. D., and Rossier, B. C. (1993) Nature 361, 467-470 [CrossRef][Medline] [Order article via Infotrieve]
  13. Canessa, C., Schild, L., Buell, G., Thorens, B., Gautschi, I., Horisberger, J. D., and Rossier, B. C. (1994) Nature 367, 463-467 [CrossRef][Medline] [Order article via Infotrieve]
  14. Lingueglia, E., Voilley, N., Waldmann, R., Lazdunski, M., and Barbry, P. (1993) FEBS Lett. 318, 95-99 [CrossRef][Medline] [Order article via Infotrieve]
  15. Lingueglia, E., Renard, S., Waldmann, R., Voilley, N., Champigny, G., Plass, H., Lazdunski, M., and Barbry, P. (1994) J. Biol. Chem. 269, 13736-13739 [Abstract/Free Full Text]
  16. Waldmann, R., Champigny, G., Bassilana, F., Voilley, N., and Lazdunski, M. (1995) J. Biol. Chem. 270, 27411-27414 [Abstract/Free Full Text]
  17. Voilley, N., Lingueglia, E., Champigny, G., Mattei, M. G., Waldmann, R., Lazdunski, M., and Barbry, P. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 247-251 [Abstract/Free Full Text]
  18. Voilley, N., Bassilana, F., Mignon, C., Merscher, S., Mattei, M. G., Carle, G. F., Lazdunski, M., and Barbry, P. (1995) Genomics 28, 560-565 [CrossRef][Medline] [Order article via Infotrieve]
  19. Huang, M., and Chalfie, M. (1994) Nature 367, 467-470 [CrossRef][Medline] [Order article via Infotrieve]
  20. Chalfie, M., and Wolinsky, E. (1990) Nature 345, 410-416 [CrossRef][Medline] [Order article via Infotrieve]
  21. Waldmann, R., Champigny, G., Voilley, N., Lauritzen, I., and Lazdunski, M. (1996) J. Biol. Chem. 271, 10433-10434 [Abstract/Free Full Text]
  22. Hollmann, M., and Heinemann, S. (1994) Annu. Rev. Neurosci. 17, 31-108 [CrossRef][Medline] [Order article via Infotrieve]
  23. Lewis, C., Neidhart, S., Holy, C., North, R. A., Buell, G., and Surprenant, A. (1995) Nature 377, 432-435 [CrossRef][Medline] [Order article via Infotrieve]
  24. Driscoll, M., and Chalfie, M. (1991) Nature 349, 588-593 [CrossRef][Medline] [Order article via Infotrieve]
  25. Lingueglia, E., Champigny, G., Lazdunski, M., and Barbry, P. (1995) Nature 378, 730-733 [CrossRef][Medline] [Order article via Infotrieve]

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Neurosci.Home page
H. Cadiou, M. Studer, N. G. Jones, E. St. J. Smith, A. Ballard, S. B. McMahon, and P. A. McNaughton
Modulation of Acid-Sensing Ion Channel Activity by Nitric Oxide
J. Neurosci., November 28, 2007; 27(48): 13251 - 13260.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Chen, G. Polleichtner, I. Kadurin, and S. Grunder
Zebrafish Acid-sensing Ion Channel (ASIC) 4, Characterization of Homo- and Heteromeric Channels, and Identification of Regions Important for Activation by H+
J. Biol. Chem., October 19, 2007; 282(42): 30406 - 30413.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
S. G. Hayes, A. E. Kindig, and M. P. Kaufman
Blockade of acid sensing ion channels attenuates the exercise pressor reflex in cats
J. Physiol., June 15, 2007; 581(3): 1271 - 1282.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
X. Chen and S. Grunder
Permeating protons contribute to tachyphylaxis of the acid-sensing ion channel (ASIC) 1a
J. Physiol., March 15, 2007; 579(3): 657 - 670.
[Abstract] [Full Text] [PDF]


Home page
Chem SensesHome page
Y. Bobkov and B. Ache
Block by Amiloride Derivatives of Odor-Evoked Discharge in Lobster Olfactory Receptor Neurons through Action on a Presumptive TRP Channel
Chem Senses, February 1, 2007; 32(2): 149 - 159.
[Abstract] [Full Text] [PDF]


Home page
BrainHome page
G. Pignataro, R. P. Simon, and Z.-G. Xiong
Prolonged activation of ASIC1a and the time window for neuroprotection in cerebral ischaemia
Brain, January 1, 2007; 130(1): 151 - 158.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Su, Q. Li, K. Shrestha, E. Cormet-Boyaka, L. Chen, P. R. Smith, E. J. Sorscher, D. J. Benos, S. Matalon, and H.-L. Ji
Interregulation of Proton-gated Na+ Channel 3 and Cystic Fibrosis Transmembrane Conductance Regulator
J. Biol. Chem., December 1, 2006; 281(48): 36960 - 36968.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
O. Poirot, T. Berta, I. Decosterd, and S. Kellenberger
Distinct ASIC currents are expressed in rat putative nociceptors and are modulated by nerve injury
J. Physiol., October 1, 2006; 576(1): 215 - 234.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
F. Mercado, I. A. Lopez, D. Acuna, R. Vega, and E. Soto
Acid-Sensing Ionic Channels in the Rat Vestibular Endorgans and Ganglia
J Neurophysiol, September 1, 2006; 96(3): 1615 - 1624.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
J. Yagi, H. N. Wenk, L. A. Naves, and E. W. McCleskey
Sustained Currents Through ASIC3 Ion Channels at the Modest pH Changes That Occur During Myocardial Ischemia
Circ. Res., September 1, 2006; 99(5): 501 - 509.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
V. I. Pidoplichko and J. A. Dani
Acid-sensitive ionic channels in midbrain dopamine neurons are sensitive to ammonium, which may contribute to hyperammonemia damage
PNAS, July 25, 2006; 103(30): 11376 - 11380.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
Q. Gu and L.-Y. Lee
Characterization of acid signaling in rat vagal pulmonary sensory neurons
Am J Physiol Lung Cell Mol Physiol, July 1, 2006; 291(1): L58 - L65.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
M. Ettaiche, E. Deval, M. Cougnon, M. Lazdunski, and N. Voilley
Silencing Acid-Sensing Ion Channel 1a Alters Cone-Mediated Retinal Function
J. Neurosci., May 24, 2006; 26(21): 5800 - 5809.
[Abstract] [Full Text] [PDF]


Home page
J. Neurophysiol.Home page
N. Jiang, K. K. Rau, R. D. Johnson, and B. Y. Cooper
Proton Sensitivity Ca2+ Permeability and Molecular Basis of Acid-Sensing Ion Channels Expressed in Glabrous and Hairy Skin Afferents
J Neurophysiol, April 1, 2006; 95(4): 2466 - 2478.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Physiol.Home page
X. Chen, H. Kalbacher, and S. Grunder
Interaction of Acid-sensing Ion Channel (ASIC) 1 with the Tarantula Toxin Psalmotoxin 1 is State Dependent
J. Gen. Physiol., February 27, 2006; 127(3): 267 - 276.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Wang, B. Duan, H. Xu, L. Xu, and T.-L. Xu
Calcium-permeable Acid-sensing Ion Channel Is a Molecular Target of the Neurotoxic Metal Ion Lead
J. Biol. Chem., February 3, 2006; 281(5): 2497 - 2505.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Deval, V. Friend, C. Thirant, M. Salinas, M. Jodar, M. Lazdunski, and E. Lingueglia
Regulation of Sensory Neuron-specific Acid-sensing Ion Channel 3 by the Adaptor Protein Na+/H+ Exchanger Regulatory Factor-1
J. Biol. Chem., January 20, 2006; 281(3): 1796 - 1807.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
M. Salinas, L. D. Rash, A. Baron, G. Lambeau, P. Escoubas, and M. Lazdunski
The receptor site of the spider toxin PcTx1 on the proton-gated cation channel ASIC1a
J. Physiol., January 15, 2006; 570(2): 339 - 354.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Vukicevic, G. Weder, A. Boillat, A. Boesch, and S. Kellenberger
Trypsin Cleaves Acid-sensing Ion Channel 1a in a Domain That Is Critical for Channel Gating
J. Biol. Chem., January 13, 2006; 281(2): 714 - 722.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
R. C. W. Jones III, L. Xu, and G. F. Gebhart
The Mechanosensitivity of Mouse Colon Afferent Fibers and Their Sensitization by Inflammatory Mediators Require Transient Receptor Potential Vanilloid 1 and Acid-Sensing Ion Channel 3
J. Neurosci., November 23, 2005; 25(47): 10981 - 10989.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
R.-L. Lin, Q. Gu, Y.-S. Lin, and L.-Y. Lee
Stimulatory effect of CO2 on vagal bronchopulmonary C-fiber afferents during airway inflammation
J Appl Physiol, November 1, 2005; 99(5): 1704 - 1711.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
A J Page, S M Brierley, C M Martin, M P Price, E Symonds, R Butler, J A Wemmie, and L A Blackshaw
Different contributions of ASIC channels 1a, 2, and 3 in gastrointestinal mechanosensory function
Gut, October 1, 2005; 54(10): 1408 - 1415.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
S. Lambert and J. Oberwinkler
Characterization of a proton-activated, outwardly rectifying anion channel
J. Physiol., August 15, 2005; 567(1): 191 - 213.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
L. I. Sinoway and J. Li
A perspective on the muscle reflex: implications for congestive heart failure
J Appl Physiol, July 1, 2005; 99(1): 5 - 22.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
T. Sugiura, K. Dang, K. Lamb, K. Bielefeldt, and G. F. Gebhart
Acid-Sensing Properties in Rat Gastric Sensory Neurons from Normal and Ulcerated Stomach
J. Neurosci., March 9, 2005; 25(10): 2617 - 2627.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. P. Price, R. J. Thompson, J. O. Eshcol, J. A. Wemmie, and C. J. Benson
Stomatin Modulates Gating of Acid-sensing Ion Channels
J. Biol. Chem., December 17, 2004; 279(51): 53886 - 53891.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
N. G. Jones, R. Slater, H. Cadiou, P. McNaughton, and S. B. McMahon
Acid-Induced Pain and Its Modulation in Humans
J. Neurosci., December 1, 2004; 24(48): 10974 - 10979.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
R. W. Putnam, J. A. Filosa, and N. A. Ritucci
Cellular mechanisms involved in CO2 and acid signaling in chemosensitive neurons
Am J Physiol Cell Physiol, December 1, 2004; 287(6): C1493 - C1526.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. M. Hruska-Hageman, C. J. Benson, A. S. Leonard, M. P. Price, and M. J. Welsh
PSD-95 and Lin-7b Interact with Acid-sensing Ion Channel-3 and Have Opposite Effects on H+-gated Current
J. Biol. Chem., November 5, 2004; 279(45): 46962 - 46968.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L.-J. Wu, B. Duan, Y.-D. Mei, J. Gao, J.-G. Chen, M. Zhuo, L. Xu, M. Wu, and T.-L. Xu
Characterization of Acid-sensing Ion Channels in Dorsal Horn Neurons of Rat Spinal Cord
J. Biol. Chem., October 15, 2004; 279(42): 43716 - 43724.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
X.-P. Chu, J. A. Wemmie, W.-Z. Wang, X.-M. Zhu, J. A. Saugstad, M. P. Price, R. P. Simon, and Z.-G. Xiong
Subunit-Dependent High-Affinity Zinc Inhibition of Acid-Sensing Ion Channels
J. Neurosci., October 6, 2004; 24(40): 8678 - 8689.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
P. Syntichaki and N. Tavernarakis
Genetic Models of Mechanotransduction: The Nematode Caenorhabditis elegans
Physiol Rev, October 1, 2004; 84(4): 1097 - 1153.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Physiol.Home page
M. Paukert, E. Babini, M. Pusch, and S. Grunder
Identification of the Ca2+ Blocking Site of Acid-sensing Ion Channel (ASIC) 1: Implications for Channel Gating
J. Gen. Physiol., September 27, 2004; 124(4): 383 - 394.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
M. Jospin and B. Allard
An amiloride-sensitive H+-gated Na+ channel in Caenorhabditis elegans body wall