JBC Avanti Polar Lipids

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ryan, D. G.
Right arrow Articles by Wolodko, W. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ryan, D. G.
Right arrow Articles by Wolodko, W. T.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 34, Issue of August 22, 1997 pp. 21151-21159
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Mutually Exclusive Splicing Generates Two Distinct Isoforms of Pig Heart Succinyl-CoA Synthetase*

(Received for publication, March 10, 1997, and in revised form, May 19, 1997)

David G. Ryan Dagger , Tianwei Lin §, Edward Brownie , William A. Bridger and William T. Wolodko par

From the Department of Biochemistry, University of Alberta, Edmonton, Alberta T6G 2H7, Canada

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES


ABSTRACT

We have identified two distinct cDNAs encoding the alpha -subunit of pig heart succinyl-CoA synthetase. The derived amino acid sequence of one of these, PHalpha 57, is highly similar to the alpha -subunit of the rat liver precursor enzyme. The second cDNA, PHalpha 108, was identical throughout its sequence with PHalpha 57 except for a stretch of 108 nucleotides which replaced a 57 nucleotide sequence in PHalpha 57. Coexpression of either alpha -subunit cDNA with a common pig heart beta -subunit cDNA produced isozymes with GTP-specific enzyme activity. The enzyme produced by the combination of PHalpha 57 and the beta -subunit cDNA resembled the "native" enzyme purified from pig heart tissue. In contrast, the expressed enzyme from the combination with PHalpha 108 was clearly distinguishable from the native enzyme by, for example, hydroxyapatite chromatography. Moreover, it was now apparent that this isoform had been observed in previous preparations of the native enzyme, but always in very low amounts and, thus, disregarded. We have shown further that the two mRNA transcripts arise from a single gene and are generated by mutually exclusive splicing. The production of the PHalpha 108 message involves the use of a non-canonical splice site pair, AT-AA. Finally, we provide evidence for tissue specific regulation in the splicing of the PHalpha 108 message.


INTRODUCTION

Succinyl-CoA synthetase (SCS)1 catalyzes the substrate-level phosphorylation step of the citric acid cycle according to the following reaction (Reaction 1).
<UP>Succinyl-CoA</UP>+<UP>NDP</UP>+<UP>P</UP><SUB><UP>i</UP></SUB> ⇌ <UP>succinate</UP>+<UP>CoA</UP>+<UP>NTP</UP>
<UP>R<SC>eaction</SC></UP> 1
(where N denotes adenosine or guanosine). SCS has a heterologous quaternary structure consisting of two subunits designated alpha  and beta  with approximate molecular weights (Mr) of 30-32 × 103 and 42 × 103, respectively (see Ref. 1 for review). Catalysis proceeds via the intermediate transfer of a phosphoryl group to and from a conserved histidine residue within the alpha -subunit (2, 3). The three-dimensional structure of the Escherichia coli enzyme has been determined (4) and provides a solid framework for the interpretation of many studies.

Apart from the primary role of succinyl-CoA within the citric acid cycle, high levels of this intermediate must be maintained for continued utilization of ketone bodies (5). In mammals, ketone bodies such as acetoacetate and beta -hydroxybutyrate are produced by the liver, and tissues such as heart muscle routinely derive much of their metabolic energy from oxidation of these compounds (6). Although within the citric acid cycle SCS catalyzes the conversion of succinyl-CoA to succinate, ketone body activation requires the reverse, the conversion of succinate to succinyl-CoA. Ottaway and co-workers (5, 6) have suggested that such opposing functional demands could best be accommodated by distinct forms of the enzyme. It is worth noting that succinyl-CoA also serves as an anabolic precursor in the synthesis of porphyrins and hemes (7).

Historically, there is evidence that diverse isoforms of the mammalian enzyme exist. Baccanari and Cha (8) showed that the GTP-specific enzyme from pig heart tissue separated into several species differing in charge. These multiple forms were found to be interconvertible indicating a common protein source (9). In a different study, two GTP-specific forms of pig heart SCS were separated upon purification using hydroxyapatite chromatography (10). A similar observation has been reported of the enzyme isolated from pigeon pectoral muscle (11). Two distinct GTP-specific forms of succinyl-CoA synthetase were detected in mouse liver, one of which was induced as a result of increased porphyrin synthesis (12). More recently, Weitzman et al. (13) demonstrated the existence of isoforms differing in their nucleotide specificity in mammalian tissues. Separable GTP- and ATP-specific forms were present in ratios that varied depending on the tissue source. Marked increases in the GTP-specific form in brain tissue occur following treatment of rats with streptozotocin, a drug used to induce diabetes (14). Diabetes invariably leads to elevated levels of ketone bodies. These and other observations have led to the suggestion that a GTP-specific form is involved exclusively in ketone body metabolism (14, 15).

The focus of the studies described herein was to gain a better understanding of one source of the heterogeneity present with the pig heart enzymes. Here we report on the identification and characterization of two isoforms of the alpha -subunit of the pig heart enzyme. The two forms are generated by alternative splicing of a single transcript. Furthermore, we provide evidence for tissue-specific regulation of the splicing event.


MATERIALS AND METHODS

Bacterial Strains

The following E. coli strains were used: JM109 (16) for construction and propagation of M13 and plasmid derivatives, BL21(DE3) (17) for expression studies, and Y1089 (18) and LE392 (19) for screening of cDNA and genomic libraries, respectively.

Enzymes and Reagents

The polynucleotide kinase, ligase, Klenow DNA polymerase, and restriction enzymes were obtained from Life Technologies (as Gibco BRL products) and New England Biolabs Inc. The Taq DNA polymerase was purchased from Cetus Corp. Reagents used for sequencing nucleic acids were ordered from U. S. Biochemical Corp. The dNTPs were purchased as 100 mM solutions from Pharmacia Biotech Inc. Unless otherwise specified, all other chemicals were supplied by Sigma and BDH Chemicals Ltd.

cDNA and Genomic Libraries

The generation of the pig heart cDNA library used in this study has been reported elsewhere (20). The unamplified library was screened with a biotin-labeled probe prepared from a cDNA encoding the precursor alpha -subunit of rat liver SCS (21). Potential clones were identified with streptavidin-conjugated alkaline phosphatase (22, 23). The cDNA fragments were subcloned into M13 vectors (16), and their sequences were determined by the dideoxynucleotide chain termination method (24).

High molecular mass DNA was prepared from the liver of a mature pig (25), and used to construct a genomic library in lambda GEM11 following standard procedures (26). The lambda GEM11 arms and packaging extracts were bought from Promega Corp. A second genomic library, constructed in lambda EMBL-3, was purchased from CLONTECH Laboratories. Both genomic libraries (1 × 106 plaques each) were screened under conditions of high stringency (26) with the cDNA clone, PHalpha 57. This probe was radioactively labeled with [alpha 35S]dATP (Amersham Canada Ltd.) by random priming (27). Southern blot analyses were carried out using standard methods with GeneScreen membranes (DuPont NEN) and oligonucleotide probes end-labeled with 32P.

Reverse Transcribed PCR and 5'-RACE Analyses

Total RNA was purified from fresh tissues of newborn piglets (generously provided by Dr. G. Foxcroft, Faculty of Agriculture, Forestry, and Home Economics). Trizol reagent (Life Technologies) was used to purify the RNA. An aliquot of RNA (1 µg) was reverse transcribed with SuperScript II (Life Technologies) and oligo(dT). Reverse transcribed PCR for each isoform was carried out pairing oligonucleotide 6, below, with either oligonucleotide 3 (specific for PHalpha 57) or oligonucleotide 5 (specific for PHalpha 108) as the primers. The cycling conditions used were as follows: 20 s at 94 °C, 30 s at 57 °C, and 60 s at 68 °C (40 cycles for PHalpha 57, 45 cycles for PHalpha 108, and 35 cycles for beta -actin); followed by one cycle of 10 min at 72 °C. The PCR was performed as described by Saiki et al. (28).

The procedures of Frohman et al. (29) were followed for the 5'-RACE analyses using the appropriate reagents purchased from Life Technologies. RNA (1 µg) was reverse transcribed with SuperScript II and oligonucleotide 2, below, as the primer. This primer was used for first strand synthesis of specifically alpha -subunit cDNAs carrying either the 57 or the 108 nucleotide sequence. These cDNAs were purified through a GlassMax spin cartridge (Life Technologies) and were tailed with dCTP and TdT. Anchored PCR was carried out with a 5'-RACE anchor primer and oligonucleotides specific for PHalpha 57 ( oligonucleotide 3 below) and PHalpha 108 (oligonucleotide 5 below). The cycling conditions were as follows: 42 cycles of 20 s at 94 °C, 30 s at 57 °C, and 60 s at 68 °C; followed by one cycle of 10 min at 72 °C. The amplified products were purified and cloned directly into TA vectors (Invitrogen Corporation).

The sequences of the oligonucleotides used in all these studies are as follows.
<AR><R><C><UP>1:</UP></C></R><R><C><UP>2:</UP></C></R><R><C><UP>3:</UP></C></R><R><C><UP>4:</UP></C></R><R><C><UP>5:</UP></C></R><R><C><UP>6:</UP></C></R></AR><AR><R><C><UP>   CACAGGCTGCTGCGCCAGGGAAA</UP></C></R><R><C><UP>   CCAACTTGTGTTGTTTGATGAACTGC</UP></C></R><R><C>   TGAATATGGCCAGGCATGATG     </C></R><R><C>   GTGCATGCTGGAACCAGAAGTA</C></R><R><C>   CTTCCTGTATTCTTCCTGCTG</C></R><R><C>   GAAGGTTATTTGCCAGGGTTTCAC</C></R></AR>

Protein Expression

The plasmid, pT7-6 (30) was used to construct vectors capable of co-producing both subunits of SCS. The configuration of the recombinant vector, pT7-6 Ecbeta /Ecalpha , carrying the genes for the E. coli enzyme is illustrated in Fig. 3A. Both cDNAs of the pig heart alpha -subunits were modified to include a ClaI restriction site at the equivalent position relative to their bacterial counterpart. These modified sequences were cloned into pT7-6 Ecbeta /Ecalpha in place of the E. coli gene. The resulting plasmids, pT7-6 Ecbeta /PHalpha 57 and Ecbeta /PHalpha 108, were used as negative controls; although the expression of the individual E. coli beta -subunit and the pig heart alpha -subunit can occur, the subsequent formation of SCS hybrids does not. A cDNA sequence encoding the pig heart beta -subunit (31) was altered to include NdeI and EspI restriction sites at the appropriate locations. The E. coli gene coding for the beta -subunit in pT7-6 Ecbeta /PHalpha 57 and Ecbeta /PHalpha 108 was replaced with the modified pig heart beta -subunit sequence creating the expression plasmids, pT7-6 PHbeta /PHalpha 57 and pT7-6 PHbeta /PHalpha 108. The above mentioned sequence alterations were achieved using standard mutagenesis procedures (32) on uracil-enriched templates (33). The mutagenic oligonucleotides were as follows.
<AR><R><C><UP>ClaI:</UP></C></R><R><C><UP>EspI:</UP></C></R><R><C><UP>NdeI:</UP></C></R></AR><AR><R><C><UP>    CATCTCTATATCGATAAAAATACG</UP></C></R><R><C>    <UP>GGCCACAGCCTGCTGAGCTGCATCCTC</UP></C></R><R><C>    <UP>AGACTGAACATATGAACCTGCAGGA</UP></C></R></AR>
For protein expression, typically 2.5-liter cultures of BL21(DE3) carrying the expression plasmids were grown from freshly transformed cells and were incubated at 37 °C until the A600 reached a value of 0.6. Induction of expression was achieved by the addition of isopropyl-1-thio-beta -D-galactopyranoside to a final concentration of 0.1 mM. Following induction, the cultures were allowed to incubate further at 37 °C for 5 h with vigorous agitation, after which the cells were harvested and frozen.


Fig. 3. Expression of the two isoforms of pig heart SCS in E. coli. A, the expression plasmid, pT7-6 Ecbeta /Ecalpha , carries both genes for the E. coli enzyme. The genes are under the control of a T7phi 10 promoter and the atpE ribosome binding sequence (RBS). Translation of the two subunits is coupled through an overlap termed the TCR. The corresponding regions of the pig heart beta - and alpha -subunits are presented below. B, the E. coli alpha -subunit was replaced individually with the two alpha -subunits of the pig heart enzyme in pT7-6 Ecbeta /PHalpha 57 and Ecbeta /PHalpha 108. The E. coli beta -subunit was replaced further with the pig heart beta -subunit in pT7-6 PHbeta /PHalpha 57 and PHbeta /PHalpha 108. The TCR of the E. coli sequence was preserved throughout. C, all four constructs were introduced into BL21(DE3) cells. Expression was induced by the addition of isopropyl-1-thio-beta -D-galactopyranoside. Samples were taken at the time of induction, and at 2.5 h and 5.0 h thereafter. Harvested cells were ruptured by sonication and assayed for succinyl-CoA synthetase activity using either ATP (closed symbols) or GTP (open symbols) as the nucleotide substrate. Activity is shown as specific activity relative to that measured at the time of induction: PHbeta /PHalpha 57 (black-diamond , diamond ); Ecbeta /PHalpha 57 (bullet , open circle ); PHbeta /PHalpha 108; (black-triangle, triangle ); Ecbeta /PHalpha 108 (black-square, square ).
[View Larger Version of this Image (17K GIF file)]

Protein Purification and Related Techniques

The frozen bacterial cultures were thawed and resuspended in 100 ml of "sonication" buffer (50 mM potassium phosphate, pH 7.4, 1 mM EDTA, 0.1 mM PMSF). These suspensions were sonicated over crushed ice and centrifuged to pellet the cell debris. Each supernatant was subjected to a two-step ammonium sulfate precipitation. The protein fraction precipitating between 15% and 40% (w/v) ammonium sulfate was collected by centrifugation and redissolved in a minimal volume of 10 mM potassium phosphate, 1 mM EDTA, 0.1 mM PMSF at pH 7.4. These solutions were desalted by gel filtration through Sephadex G25 equilibrated and eluted with the same dissolving buffer. Eluted fractions that contained high enzyme activity were pooled and loaded directly onto a 50-ml hydroxyapatite column equilibrated with 10 mM potassium phosphate, pH 7.4, 1 mM EDTA, 0.1 mM PMSF. The column was washed with another 200 ml of the buffer. Two columns were set up and run simultaneously in this manner, one for expressed PHbeta /PHalpha 57 and the other for expressed PHbeta /PHalpha 108. Elution (from a common 500-ml gradient reservoir) was carried out with a salt gradient of 10 mM to 400 mM potassium phosphate, pH 7.4. All of the above purification procedures were conducted at 4 °C. Protein extracts made from minced pig heart tissue were fractionated in a similar manner. Succinyl-CoA synthetase activity was measured by following the change of absorbance at 235 nm using the method of Cha (34).


RESULTS

cDNAs Encoding the alpha -Subunit of Pig Heart Succinyl-CoA Synthetase

Approximately 105 plaques from an unamplified pig heart cDNA library were screened as described under "Materials and Methods." A total of 25 clones were recovered from the library. Of these, 12 were found to be full-length and were selected for further analysis. It was observed that for all these clones two fragments were produced upon EcoRI digestion, indicative of a single, internal EcoRI site. The clones were classified into two groups on the basis of the size of the larger EcoRI fragment (Fig. 1A). Class I accounted for nine of these clones and contained a 1.15-kb EcoRI fragment. The remaining Class II clones contained a slightly larger 1.2-kb fragment. Representatives from each group were selected for sequencing. The two classes of cDNAs were identical throughout their sequence, with the exception of one short region midway through their open reading frames (Fig. 1A). A stretch of 108 nucleotides in the Class II clones replaced a 57-nucleotide sequence in the Class I clones.



Fig. 1. Sequences of cDNAs encoding the alpha -subunit of pig heart succinyl-CoA synthetase. A, diagrammatic alignment of Class I and II cDNAs on the basis of sequence identity (thick lines). The arrows indicate open reading frames. The boxes highlight the regions of sequence differences: clear box, 57 bp; striped box, 108 bp. Given in B is the complete nucleotide sequence of a representative Class I clone, PHalpha 57. The derived amino acid sequence of the alpha -subunit of pig heart succinyl-CoA synthetase is shown below in single-letter code. The vertical arrow shows the cleavage point of the signal sequence. The numerals on the right (in bold) count the amino acids and on the left (in italics) the nucleotides. As in A, the 57 nucleotides specific to Class I clones are outlined by a box. Shown in C is the corresponding region of a Class II clone, PHalpha 108, highlighting the unique 108 nucleotides in a box.
[View Larger Versions of these Images (8 + 42K GIF file)]

The nucleotide and deduced amino acid sequence of a Class I clone, PHalpha 57, is shown in Fig. 1B. The cDNA PHalpha 57 encodes a 333-amino acid protein with a high degree of similarity to the precursor alpha -subunit of the rat liver enzyme (21): 305 of the 333 amino acids are identical in the two subunits. Both mammalian proteins carry a putative signal peptide of 27 amino acids, which would be removed upon entry into the mitochondria (35). Part of the sequence derived from a Class II clone, PHalpha 108, is shown in Fig. 1C. As stated previously, PHalpha 108 was identical to PHalpha 57 except for the replacement of a short stretch of sequence within its open reading frame. Substitution of this sequence preserves the reading frame and results in a novel 36 amino acid stretch within the alpha -subunit. The identities of the remaining clones were designated using the presence of a unique NdeI site at the 3' end of the PHalpha 108-specific sequence (Fig. 1A) as a discriminating characteristic of Class II clones.

The molecular masses of the mature proteins (without signal sequence) encoded by PHalpha 57 and PHalpha 108, were calculated to be 32.11 kDa and 34.45 kDa, respectively. The value predicted for the PHalpha 57-encoded protein is consistent with that estimated for the alpha -subunit of "native" SCS purified from pig heart tissue (36). Expression of PHalpha 57 in bacteria produced a protein that co-migrated with the alpha -subunit of the native enzyme on SDS-polyacrylamide gel electrophoresis, whereas PHalpha 108 produced a significantly larger protein. Amino acid analyses of peptide fragments generated by cyanogen bromide treatment of the native enzyme identified the alpha -subunit encoded by PHalpha 57 as that corresponding to the subunit present in native enzyme. Moreover, the amino acid sequence derived from the 57 nucleotides present in the PHalpha 57 cDNA is conserved in known forms of SCS (Fig. 2A). The unique sequence from PHalpha 108 was not found in a search of the various data banks.


Fig. 2. Location of the variable region within known forms of SCS. A, alignment of the PHalpha 57 encoded sequence and flanking residues with those reported in the alpha -subunits of SCS from rat liver (21), E. coli (37), Arabidopsis thaliana (Swiss Protein Data Base), Trichomonas vaginalis (38), Saccharomyces cerevisiae (39), and Thermus flavus (40). The designations "CoA-binding domain" and "phosphohistidine domain" are derived from inspection of the crystallographic model of E. coli SCS (4). Histidine 168 in the E. coli sequence is shown in bold (see "Discussion"). B, a ribbon representation of the alpha -subunit of E. coli SCS (4). The binding domain for CoA is shown on the left; the phosphohistidine-containing domain is on the right. Connecting these two domains, and highlighted in black, lies the region of sequence that is variable in the pig heart clones.
[View Larger Version of this Image (50K GIF file)]

The crystallographic model of the alpha -subunit of the E. coli enzyme (illustrated in Fig. 2B) was examined focusing on the corresponding location of the unique segments encoded by PHalpha 57 and PHalpha 108. The amino acid sequence replaced in the two pig heart isoforms corresponds to a polypeptide stretch that interconnects the two domains of the alpha -subunit: the CoA-binding domain and the phosphohistidine domain (Fig. 2B). Note: as can be seen in Fig. 2A, the amino acid residues are highly conserved on either side of both interconnecting sequences and are thought to play a role in catalysis. The sequence SRSGTLTYE to the right forms an alpha -helix that stabilizes the phosphohistidine loop, whereas the residues to the left come in close contact with the reactive thiol group of CoA (4). This comparison to the model of the E. coli alpha -subunit serves to demonstrate that the longer amino acid sequence encoded by PHalpha 108 can be accommodated within the structure of the protein.

Co-expression of Both Isoforms with the beta -Subunit

Prompted by the earlier reports of heterogeneity in the enzyme (10-13), we considered both pig heart alpha -subunits as authentic proteins contributing to enzyme activity. To better understand the functional significance of the novel PHalpha 108-encoded protein, a bicistronic expression system in bacteria was developed for the production of the pig heart enzymes. The recombinant vector, pT7-6 Ecbeta /Ecalpha (Fig. 3A), had been used previously for the production of the E. coli enzyme (41). In this vector, the two genes for the E. coli enzyme overlap in such a manner that translation of the alpha -subunit is coupled to that of the beta -subunit, ensuring that equal levels of both are produced (37). The nucleotide sequence responsible for this coupling is referred to here as the translational coupling region (TCR) and occurs within the overlapping ends of the two genes as illustrated in Fig. 3A. The beta -subunit of SCS from either E. coli or pig heart was produced in combination with each alpha -subunit isoform (see "Materials and Methods"). The TCR was retained in all of these cDNA constructs (Fig. 3B). Although high levels of the subunits were produced by expression, greater than 90% of this protein was insoluble. Despite this, we could clearly measure elevated levels of a GTP-specific activity in the bacterial lysates following the expression of both PHbeta /PHalpha 57 and PHbeta /PHalpha 108. The enzyme of the host E. coli cells uses ATP or GTP as the nucleotide substrate (42), contributing a basal SCS activity in these experiments. As shown in Fig. 3C, when measured from the time of induction to 5 h, there was little increase above basal levels of the ATP- or GTP-specific activities by the controls (Ecbeta /PHalpha 57 and Ecbeta /PHalpha 108). In contrast, the GTP-specific activity associated with the expression of the two plasmids PHbeta /PHalpha 57 and PHbeta /PHalpha 108 increased by a factor of two over the course of the experiment, while the ATP-specific activity remained low and relatively constant as seen in the controls. We conclude that two separate isoenzymes with GTP-specific activities are produced by the combination of each of the two alpha -subunit isoforms with the pig heart beta -subunit.

It was first reported by Cha et al. (10) that conventional preparations of SCS from pig heart tissue were resolved into two separate peaks of GTP-specific activity by hydroxyapatite column chromatography. We have consistently made the same observation during routine purification of the native pig heart enzyme. A profile monitoring the GTP-specific activity of one such purification is presented in Fig. 4C. The first peak of enzymatic activity to emerge from the column is never more than 10% of the total, but is consistently present and invariably discarded. The second peak to emerge often accounts for greater that 90% of the total enzyme; these fractions are pooled for further purification. In the present studies, bacterial cell extracts from cultures with the two expression combinations PHbeta /PHalpha 57 and PHbeta /PHalpha 108 were prepared for hydroxyapatite column chromatography as described under "Materials and Methods." Their simultaneous fractionation on identical columns is illustrated in Fig. 4 (A and B, respectively). The first peak of enzymatic activity that emerged from both columns with 65 mM phosphate was specific for both ATP and GTP, a characteristic of the host bacterial SCS. The second peak of activity detected, albeit at different points of elution in both fractionations, showed an absolute specificity for GTP, that expected of the pig heart enzymes. As can be seen by comparing Fig. 4A with Fig. 4C, the GTP-specific activity produced by the PHbeta /PHalpha 57 combination eluted from the column in the range of 170 mM phosphate, coincident with the main peak of a native pig heart SCS preparation. It is not surprising, then, that the native enzyme purified from pig heart tissue had been found to comprise the PHalpha 57 protein. It was, however, a surprise to find that the GTP-specific activity produced by the PHbeta /PHalpha 108 combination emerged earlier with 110 mM phosphate, colinear with the minor peak of a native preparation (compare Fig. 4B with Fig. 4C). Unfortunately, attempts to purify this minor isozyme from the others in pig heart tissue have met with limited success.


Fig. 4. Separation of the two isoforms by hydroxyapatite column chromatography. Partially purified extracts from bacterial cultures expressing the pig heart isozymes, PHbeta /PHalpha 57 (A) and PHbeta /PHalpha 108 (B), were fractionated on hydroxyapatite in parallel (see "Materials and Methods"). A corresponding extract from pig heart tissue was fractionated in a similar manner but on a larger scale (C). In each case, the enzymes were eluted by increasing the concentration of potassium phosphate (shown on the top); the three graphs were aligned relative to this gradient. Fractions were assayed for ATP- and GTP-specific activities.
[View Larger Version of this Image (25K GIF file)]

Studies of the alpha -Subunit Gene

Further experiments were carried out with the aim of delineating the molecular mechanisms involved in generating these two nearly identical cDNAs. We screened two pig genomic DNA libraries (see "Materials and Methods"). Two clones, designated lambda E4 and lambda E6, were recovered from a lambda EMBL-3 library. Fragments of lambda E6 hybridized to a probe specific for the 57-nucleotide sequence (oligonucleotide 3 under "Materials and Methods") but not to a probe specific for the 108-nucleotide sequence (oligonucleotide 4). In contrast, fragments of lambda E4 hybridized only to the probe specific for the 108-nucleotide sequence. The positive hybridization results are presented in Fig. 5A. Furthermore, it appeared that these clones represented two parts of the alpha -subunit gene since lambda E6 also contained the remaining upstream sequence while lambda E4 contained the remaining downstream sequence of the alpha -subunit. The two clones failed to hybridize to each other, and thus did not overlap. A third clone, lambda 3551, was recovered from a lambda GEM11 library and proved to overlap both lambda E6 and lambda E4. As shown by Southern blot analyses, an 11-kb fragment of lambda 3551 hybridized to both probes (Fig. 5A). This clearly established that the two isoform sequences originate from within a common gene.


Fig. 5. Restriction enzyme mapping and hybridization analysis of genomic clones. A, the DNA purified from the genomic clones lambda E6, lambda E4, and lambda 3551 was digested with a variety of the following enzymes: SalI/SstI (SS), SalI/EcoRI (SE) or SalI (Sa), in the case of lambda E6 and lambda E4; SstI/BamHI (SB) or SstI/EcoRI (SE), in the case of lambda 3551. The digested DNA fragments were separated by electrophoresis, transferred to GeneScreen membranes and probed, as indicated, with 32P-labeled oligonucleotides specific for the 57- and 108-nucleotide exons (see "Materials and Methods"). The approximate size of each hybridizing fragment is indicated to the right of the autoradiograms. B, the three clones were analyzed by restriction enzyme digestion and hybridization to create a composite map of the genomic locus. Placed below the main map are the relative positions of the clones. The sizes of the genomic inserts are indicated. Part of the overlapping clone lambda 3551 is magnified to show the region containing the 57-and 108-nucleotide exons. The restriction digestion sites within the gene are EcoRI (E), SstI (S), SalI (Sa), BamHI (B), ClaI (C), HinDIII (H), XbaI (Xb), XhoI (X), and BglII (Bg). The positions and orientations of the primers (#1, #2, #3, and #4) used in the PCR experiments are shown as numbered arrows below. Their nucleotide sequences are given under "Materials and Methods."
[View Larger Version of this Image (47K GIF file)]

A map generated from extensive trials of restriction digestions and hybridization analyses of these clones has been compiled in Fig. 5B. The sizes of the relevant introns were estimated using methods involving PCR (see Fig. 5B). The intron upstream of the 57-nucleotide sequence was 200 bp, and the intron downstream of the 108-nucleotide sequence was 1.3 kb. PCR carried out directly on genomic DNA with the same primer pairs yielded similarly sized fragments. The size of the intervening region between the 57- and 108-nucleotide exons was found to be 7.5 kb by restriction digest analyses.

The nucleotide sequences of the exon-intron boundaries were established by sequence comparison of the cDNA and genomic clones. The sequences unique to PHalpha 57 and PHalpha 108 are represented as exons within the gene (the boxed sequences in Fig. 6A). With one exception, the 5' donor and 3' acceptor splice sites of the introns conform to the "GT-AG" rule (43). The deviation from this rule involves the 5' donor and 3' acceptor splice sites of the intron that is immediately downstream of the 108-nucleotide exon, and pertains to the splicing of PHalpha 108. The dinucleotide AT rather than GT is used at the 5' donor site; to maintain reading frame, the 108-nucleotide exon must use the dinucleotide AA at the 3' acceptor site (Fig. 6A). Note: the dinucleotide AG at this acceptor site provides the perfect junction for splicing to the 57-nucleotide exon. Thus, the 3' acceptor site is being used differently by the two exons (Fig. 6B).


Fig. 6. Characterization of the splice sites involved in generating the PHalpha 57 and PHalpha 108 messages. A, partial sequence of the genomic clone, lambda 3551, showing the exon-intron stretches of the alpha -subunit gene that are involved in differential splicing. Exonic residues are shown in bold uppercase letters. Intronic residues are represented in plain lowercase letters. A single g residue is shown in bold lowercase to highlight its alternate use as either intronic or exonic. The exons specific to the PHalpha 57 and PHalpha 108 messages are boxed. B, a diagram illustrating the splicing events that produce the PHalpha 57 and PHalpha 108 messages. The top line summarizes the relevant exon-intron organization in the genomic DNA, and the next two lines below, the spliced isoforms. Nucleotide residues within the exons are presented in triplet codon form to emphasize the reading frame.
[View Larger Version of this Image (55K GIF file)]

Since the production of the PHalpha 108 message involved the use of a non-consensus splice site pair (AT-AA), we sought direct evidence for the presence of the PHalpha 108 message in tissues. Total RNA prepared from four tissues of a newborn piglet was reverse transcribed with oligo(dT) and subjected to PCR specific for each isoform according to the scheme outlined in Fig. 7. The PHalpha 57 message was readily detected in all four tissues, liver, brain, heart, and skeletal muscle, whereas, the PHalpha 108 message was only detected in heart and skeletal muscle (Fig. 7). We carried out 45 cycles of PHalpha 108-specific PCR (compared with 40 cycles for PHalpha 57) to be certain about the absence of this message in liver and brain tissue. Reverse transcribed-PCR was also carried out with each tissue type to monitor the levels of the beta -actin message as an internal control. These observations led us to believe that production of the PHalpha 108 message is regulated in a tissue-specific manner. Furthermore, the presence of the two messages in heart and skeletal muscle was consistent with earlier reports of heterogeneity of GTP-specific SCS in these two tissues (10, 11).


Fig. 7. Tissue-specific expression of PHalpha 108. Total RNA was purified from the tissue of the liver, heart, skeletal muscle, and brain of a newborn piglet. Oligo(dT)-primed first strand synthesis reactions were carried out with or without the addition of SuperScript II reverse transcriptase (±RT). Subsequent analyses via isoform-specific PCR were conducted with the primer pairs 6/3 and 6/5 for the cDNA fragments specific to PHalpha 57 and PHalpha 108, respectively. The predicted sizes of the amplified products are given below their respective schematics. Positive controls for PCR were carried out with 100 pg of the cDNA clones, PHalpha 57 and PHalpha 108; negative controls were done with water. First strand synthesis reactions were subjected to beta -actin specific PCR with the following primers: 5'-primer; TGGAATCCTGTGGCATCCATGAAAC; 3'-primer; TAAAACGCAGCTCAGTAACAGTCCG. The PCR products were resolved by agarose-gel electrophoresis.
[View Larger Version of this Image (25K GIF file)]

The full-length clones recovered in the library screen had identical 3' UTRs followed by short poly(A) tails (Fig. 1). The longest 5' UTR from each class of clones was similar in size and identical in sequence. The 5' UTR was unexpectedly short, containing just 36 nucleotides (Fig. 1B). In contrast, for example, the 5' UTR of the corresponding rat liver cDNA is over 500 bp long (21). To rule out the possibility that these clones had truncated 5' UTRs due to anomalies in the creation of the libraries, we carried out 5'-RACE reactions specific for each isoform (for details see "Materials and Methods"). The cDNA used in these reactions was synthesized from heart RNA, since both messages were produced in this tissue. The longest 5'-RACE products derived from the two messages were no longer than 36 nucleotides, the length already present in the cDNA clones. Thus, we concluded that the only difference between the two messages was the 57- and 108-nucleotide sequences.


DISCUSSION

The derived amino acid sequence of the 57-nucleotide exon is conserved in known forms of SCS (see Fig. 2A). Furthermore, this is consistent with the finding that the PHalpha 57 protein is the predominant form of the alpha -subunit in preparations of the enzyme from pig heart tissue. The identification of the equivalent segment as an external loop in the structure of the E. coli enzyme (Fig. 2B) suggests that changes in amino acid sequence and or length (as found in PHalpha 108) can be readily accommodated. Although part of the active site region in the alpha -subunit, this sequence can not dictate the specificity of the substrate nucleotide since both the PHalpha 57/PHbeta and PHalpha 108/PHbeta constructs expressed GTP-specific SCS activities (Fig. 3). Luo and Nishimura (44) created a mutant of E. coli SCS in which one histidine residue (in bold, Fig. 2A), corresponding to His-168 in the PHalpha 57-subunit sequence, was replaced by Asn. This mutant was devoid of full catalytic activity but was able to catalyze some of the partial reactions at significant rates. In particular, phosphorylation with ATP occurred at a rate approximately 10-fold greater than that in the wild-type enzyme, while the formation of succinyl-CoA proceeded at one-tenth that of the wild-type rate (44). Thus, this loop is positioned in the alpha -subunit to have possible influence on the catalytic properties of SCS. And in turn, its substitution would have possible influence on the metabolism of that cell.

Any standard biochemistry textbook will point out that ketone bodies are routinely being used for fuel in cardiac and skeletal muscle of higher animals (for example, see Ref. 45). The brain only uses ketone bodies when glucose supplies are very low, such as during starvation; liver tissue is unable to breakdown ketone bodies since it lacks the central enzyme, CoA transferase. The pattern of PHalpha 108 levels in various tissues matches that expected of an enzyme involved in ketone body metabolism. On this basis we hypothesize that succinyl-CoA synthetase is produced, in part, as two separate GTP-specific isoforms in pig heart tissue. The major form contains the alpha -subunit encoded by the PHalpha 57 message and the minor form by PHalpha 108. The major isoform of the enzyme plays the role of substrate-level phosphorylation within the citric acid cycle, while the minor form plays a specialized role providing succinyl-CoA in ketone body activation. This would be consistent with the proposal that two separate enzymes could best accommodate the opposing functional demands of the citric acid cycle and ketotic pathways (5, 6).

The splicing mechanism used to generate PHalpha 108 would certainly be novel, since the intron immediately downstream of the 108-nucleotide exon carries the splice site dinucleotides, AT-AA. This would seem to contravene the invariant GT-AG rule followed in pre-mRNA splicing (43). Nevertheless, as reported by Carothers et al. (46), the dinucleotide pair, AT-AA, has been demonstrated experimentally to function within the context of a major class intron. The fourth intron of the dihydrofolate reductase gene normally contains the dinucleotide pair GT-AG commonly associated with splicing. However a change in the last nucleotide of the intron from G to A crippled the splicing (46). A suppressor mutation due to a single-base substitution at the second site was identified and isolated. The revertant was found to have an A in place of G in the first position of the intron (46). Thus a major class GT-AG intron was capable of splicing properly with donor and acceptor dinucleotides of AT and AA, respectively. The splicing of the intron immediately downstream of the 108-specific exon now represents an example of a "natural" AT-AA intron.

The use of the dinucleotide AT as a 5' donor in splicing pre-mRNA is not new. A minor class of introns containing the dinucleotide pair AT-AC has recently been described (47, 48). Five such AT-AC introns are known. All share conserved sequences at their 5' donor and branch sites that are distinct from those found in major class introns. Consequently, it was discovered that these introns use the correspondingly rare small nuclear RNAs, U11 and U12, in place of the major species, U1 and U2 (49, 50). We believe that the major small nuclear RNAs, U1 and U2, are used in splicing the 57- and 108-exons to the common downstream exon. Five of the six nucleotides defining their 5' donor sites, GTGAGT and ATAAGT, respectively, are identical to the consensus binding sequence for U1, GTAAGT (51). Although we have not yet identified the branch site, U2 is likely to be used in branch formation. Splicing of the 57-exon involves a typical GT-AG dinucleotide pair and would therefore be expected to use the major splicing components, U1 and U2. Since AT-AA dinucleotide pairs have previously been found to operate within the context of a major class intron (46), it is conceivable that splicing of the 108-exon also uses the major splicing machinery.

The differential use of the common downstream exon deserves special mention. It is believed that the formation of a non-Watson-Crick base pair interaction between the first and last nucleotides of an intron is necessary for splicing (52). Such interactions are only possible between G-G, A-C, and A-A base pairs given the geometrical disposition of the RNA strand within the spliceosome (53). Splicing in the majority of cases, including the 57-exon, involves the formation of a G-G base pair. Splicing of the minor class of AT-AC introns are possible due to their ability to form A-C base pairs (53). If the splicing of the 108-exon were to use the same 3' acceptor dinucleotide as the 57-exon, it would be forced to form an A-G base pair, an interaction that is unfavorable given the constraints of geometry. This is consistent with the observations that intron splicing is crippled by G to A changes in the first nucleotide (46, 52). Thus, the splicing of the 108-exon selects AA over AG at the 3' acceptor site to form an allowed A-A non-Watson-Crick base pair. We speculate that the differential use of the acceptor site can be accommodated by the "normal" splicing machinery, and that the selection of the 108-exon is governed by tissue-specific trans acting factors.


FOOTNOTES

*   This work was supported by Grant MT-2805 from the Medical Research Council of Canada.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF008430-AF008433, AF008588, and AF008589.


Dagger    Present address: Hospital for Sick Children, Toronto, Ontario M5G 1X8, Canada.
§   Present address: Scripps Institute, La Jolla, CA 92037.
   Present address: University of Western Ontario, London, Ontario N6A 5B8, Canada.
par    To whom correspondence should be addressed. Tel.: 403-492-2419; Fax: 403-492-0886; E-mail: wtwt{at}obi-wab.biochem.ualberta.ca.
1   The abbreviations used are: SCS, succinyl-CoA synthetase (EC 6.2.1.4 and EC 6.2.1.5); NDP, purine ribonucleoside diphosphate; NTP, purine ribonucleoside triphosphate; PCR, polymerase chain reaction; 5'-RACE, rapid amplification of 5' cDNA ends; PMSF, phenylmethylsulfonyl fluoride; UTR, untranslated region; TCR, translational coupling region; bp, base pair(s); kb, kilobase pair(s).

ACKNOWLEDGEMENTS

We thank Warren Henning for able technical assistance and Roger Bradley for help with the photography. We are indebted to Marie Fraser, Michael Joyce, and Steven Rice for their thoughtful suggestions on the preparation of this manuscript.


REFERENCES

  1. Nishimura, J. S. (1986) Adv. Enzymol. 58, 141-172
  2. Bridger, W. A. (1971) Biochem. Biophys Res. Comm. 42, 948-954 [CrossRef][Medline] [Order article via Infotrieve]
  3. Wang, T., Jurasek, L., and Bridger, W. A. (1972) Biochemistry 11, 2067-2070 [CrossRef][Medline] [Order article via Infotrieve]
  4. Wolodko, W. T., Fraser, M. E., James, M. N. G., and Bridger, W. A. (1994) J. Biol. Chem. 269, 10883-10894 [Abstract/Free Full Text]
  5. Ottaway, J. H., and McMinn, C. L. (1979) Biochem. Soc. Trans. 7, 411-412 [Medline] [Order article via Infotrieve]
  6. Ottaway, J. H., McClellan, J. A., and Saunderson, C. L. (1981) Int. J. Biochem. 13, 401-410 [CrossRef][Medline] [Order article via Infotrieve]
  7. Lascelles, J. (1964) in Tetrapyrrole Biosynthesis and Its Regulation, (Benjamin, W. A., Ed.) New. York., p. 84
  8. Baccanari, D. P., and Cha, S. (1973) J. Biol. Chem. 248, 15-24 [Abstract/Free Full Text]
  9. Baccanari, D. P., and Cha, S. (1973) Biochim. Biophys. Acta 119, 226-234
  10. Cha, S., Cha, C.-J. M., and Parks, R. E., Jr. (1967) J. Biol. Chem. 242, 2577-2581 [Abstract/Free Full Text]
  11. Meshkova, N. P., and Matveeva, L. N. (1970) Biokhimiya 35, 374-381
  12. Labbe, R. F., Kurumada, T., and Onisawa, J. (1965) Biochim. Biophys. Acta 111, 403-415 [Medline] [Order article via Infotrieve]
  13. Weitzman, P. D. J., Jenkins, T., Else, A. J., and Holt, R. A. (1986) FEBS Lett. 199, 57-60 [CrossRef][Medline] [Order article via Infotrieve]
  14. Jenkins, T. M., and Weitzman, P. D. J. (1986) FEBS Lett. 205, 215-218 [CrossRef][Medline] [Order article via Infotrieve]
  15. McClellan, J. A., and Ottaway, J. H. (1980) Comp. Biochem. Physiol. 67B, 679-684 [CrossRef]
  16. Yanish-Perron, C., Viera, J., and Messing, J. (1985) Gene 33, 103-199 [CrossRef][Medline] [Order article via Infotrieve]
  17. Studier, F. W., and Moffatt, B. A. (1986) J. Mol. Biol. 189, 113-119 [CrossRef][Medline] [Order article via Infotrieve]
  18. Young, R., and Davis, R. W. (1983) Science 222, 778-789 [Abstract/Free Full Text]
  19. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) Molecular Cloning: A Laboratory Manual, 1st Ed, Cold Spring Harbor Laboratory Press
  20. Lin, T., and Bridger, W. A. (1992) J. Biol. Chem. 267, 975-978 [Abstract/Free Full Text]
  21. Henning, W. D., Upton, C., Majumdar, R., McFadden, G., and Bridger, W. A. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 1432-1436 [Abstract/Free Full Text]
  22. Huynh, T. V., Young, R. A., and Davis, R. W. (1985) in DNA Cloning (Glover, D. M., ed), Vol. I, IRL Press Limited, Oxford
  23. Haas, M. J., and Fleming, D. J. (1988) Anal. Biochem. 168, 239-242 [CrossRef][Medline] [Order article via Infotrieve]
  24. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A. 74, 5463-5467 [Abstract/Free Full Text]
  25. Blin, N., and Stafford, W. D. (1976) Nucleic Acids Res. 3, 2303-2308
  26. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed, Cold Spring Harbor Laboratory Press
  27. Feinberg, A. P., and Vogelstein, B. (1983) Anal. Biochem. 132, 6-13 [CrossRef][Medline] [Order article via Infotrieve]
  28. Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R., Horn, G. T., Mullis, K. B., and Erlich, H. A. (1988) Science 239, 487-491 [Abstract/Free Full Text]
  29. Frohman, M. A., Dush, M. K., and Martin, G. R. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 8995-8999
  30. Tabor, S., and Richardson, C. C. (1985) Proc. Natl. Acad. Sci. U. S. A. 82, 1074-1078 [Abstract/Free Full Text]
  31. Bailey, D. L., Wolodko, W. T., and Bridger, W. A. (1993) Protein Science 2, 1255-1262 [Abstract]
  32. Zoller, M. J., and Smith, M. (1983) Meth. Enzymol. 100, 468-500 [Medline] [Order article via Infotrieve]
  33. Kunkel, T. A. (1985) Proc. Natl. Acad. Sci. U. S. A. 82, 488-492 [Abstract/Free Full Text]
  34. Cha, S. (1969) Meth. Enzymol. 13, 62-69
  35. Majumdar, R., and Bridger, W. A. (1990) Can. J. Biochem. Cell Biol. 68, 292-299
  36. Brownie, E., and Bridger, W. A. (1972) Can. J. Biochem. 50, 719-724 [Medline] [Order article via Infotrieve]
  37. Buck, D., Spencer, M. E., and Guest, J. R. (1985) Biochemistry 24, 6245-6252 [CrossRef][Medline] [Order article via Infotrieve]
  38. Lahti, C. V., d'Oliveira, C. E., and Johnson, P. J. (1992) J. Bacteriol. 174, 6822-6830 [Abstract/Free Full Text]
  39. Reed, S. I., Hadwiger, J. A., Richardson, H. E., and Wittenberg, C. (1989) J. Cell Sci. Suppl, 12 , 29-37
  40. Nishiyama, M., Horinouchi, S., and Beppu, T. (1991) Mol. Gen. Genet. 226, 1-9 [CrossRef][Medline] [Order article via Infotrieve]
  41. Ryan, D. G., and Bridger, W. A. (1991) J. Mol. Biol. 219, 165-174 [CrossRef][Medline] [Order article via Infotrieve]
  42. Murakami, K., Mitchell, T., and Nishimura, J. S. (1972) J. Biol. Chem. 247, 6247-6252 [Abstract/Free Full Text]
  43. Jacob, M., and Gallinaro, H. (1989) Nucleic Acids Res. 17, 2159-2180 [Abstract/Free Full Text]
  44. Luo, G. -X., and Nishimura, J. S. (1991) J. Biol. Chem. 266, 20781-20785 [Abstract/Free Full Text]
  45. Stryer, L. (1988) Biochemistry, 3rd Ed, W. H. Freeman and Company, New York
  46. Carothers, A. M., Urlaub, G., Grunberger, D., and Chasin, L. A. (1993) Mol. Cell. Biol. 13, 5085-5098 [Abstract/Free Full Text]
  47. Jackson, I. J. (1991) Nucleic Acids Res. 19, 3795-3798 [Free Full Text]
  48. Hall, S. L., and Padgett, R. A. (1994) J. Mol. Biol. 239, 357-365 [CrossRef][Medline] [Order article via Infotrieve]
  49. Hall, S. L., and Padgett, R. A. (1996) Science 271, 1716-1718 [Abstract]
  50. Tarn, W.-Y., and Steitz, J. A. (1996) Cell 84, 801-811 [CrossRef][Medline] [Order article via Infotrieve]
  51. Shapiro, M. B., and Senepathy, P. (1986) Nucleic Acids Res. 15, 7155-7174 [Abstract/Free Full Text]
  52. Parker, R., and Siliciano, P. G. (1993) Nature 361, 660-662 [CrossRef][Medline] [Order article via Infotrieve]
  53. Mount, S. M. (1996) Science 271, 1690-1692 [CrossRef][Medline] [Order article via Infotrieve]

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
Q. Wu and A. R. Krainer
AT-AC Pre-mRNA Splicing Mechanisms and Conservation of Minor Introns in Voltage-Gated Ion Channel Genes
Mol. Cell. Biol., May 1, 1999; 19(5): 3225 - 3236.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. D. Johnson, W. W. Muhonen, and D. O. Lambeth
Characterization of the ATP- and GTP-specific Succinyl-CoA Synthetases in Pigeon. THE ENZYMES INCORPORATE THE SAME alpha -SUBUNIT
J. Biol. Chem., October 16, 1998; 273(42): 27573 - 27579.
[Abstract] [Full Text] [PDF]