![]()
|
|
||||||||
(Received for publication, April 9, 1997, and in revised form, June 6, 1997)
From the Section of Plastic Surgery, Department of Surgery, Yale
University School of Medicine,
New Haven, Connecticut 06520-8041
Maximal gene expression driven by the promoter
for the transforming growth factor Transforming growth factor- These features suggested that the TGF- In the present study we investigated in more detail sequences within
the TGF- Using procedures approved by Yale Animal Care
and Use Committee, parietal bones from 22-day-old Harlan Sprague Dawley
rat fetuses (Charles River Breeding Laboratories) were dissected free of sutures and digested for five 20-min intervals with collagenase. The
first digestion releases less differentiated periosteal cells, and the
last three digestions are enriched with cells with differentiated osteoblast characteristics. Primary cultures were plated at 5 × 103 cells/cm2 in Dulbecco's modified Eagle's
medium containing 20 mM HEPES (pH 7.2), 100 µg/ml
ascorbic acid, penicillin and streptomycin, and 10% fetal bovine
serum. Cultures reach confluence (5-6 × 104
cells/cm2) within 6-7 days. Proliferating cultures were
collected at 75% confluence. Every 3-4 days, confluent cultures were
re-fed the same medium except that ascorbic acid and serum were reduced
by half. Differentiated cultures were collected 1 week after
confluence. Mineralizing cultures were supplemented with 3 mM Constructs pEN1.0, pEXH0.9, pSN0.8, pAN0.4,
pAX0.2, pAS0.2, pXN0.1, and pSN0.1 containing fragments of the rat
TGF-
Cultures at 50-60% confluence were rinsed
in serum-free medium and exposed to 1-1.5 µg of plasmid construct
per 4.5 cm2 culture with 0.5% LipofectinTM (Life
Technologies, Inc.) for 3 h. Cells were re-fed medium supplemented
with 5% fetal bovine serum and cultured 48-72 h to reach confluence.
Cultures were rinsed with phosphate-buffered saline and extracted with
cell lysis buffer (Promega). Nuclei were cleared by centrifugation at
12,000 × g for 5 min. A commercial kit was used to
measure luciferase activity (Promega) in supernatants and corrected for protein by the Bradford method (10).
Cultures were rinsed with
phosphate-buffered saline containing the phosphatase inhibitors sodium
orthovanadate (1 mM) and sodium fluoride (10 mM) on ice. Cells were scraped into the buffer and
collected by centrifugation. Nuclear extracts were prepared by the
method of Lee et al. (11, 12) with minor modifications. Briefly, cells were lysed in hypotonic buffer (10 mM HEPES
(pH 7.4), 1.5 mM MgCl2, 10 mM KCl,
0.5 mM dithiothreitol) supplemented with phosphatase
inhibitors, protease inhibitors, phenylmethylsulfonyl fluoride (0.5 mM), pepstatin A (1 µg/ml), leupeptin (2 µg/ml), and
aprotinin (2 µg/ml), and 1% Triton X-100. Nuclei were pelleted and
resuspended in hypertonic buffer containing 0.42 M NaCl,
0.2 mM Na2EDTA, 25% glycerol, and the
phosphatase and protease inhibitors described above. Soluble proteins
released by 30-min incubations on ice were collected by centrifugation
at 12,000 × g for 5 min, and the supernatant was
aliquoted, and corrected for protein content (10), and stored at
Double-stranded
oligonucleotide probes were annealed by heating to 95 °C and cooling
to 25 °C in 10 mM Tris-Cl (pH 8.0), 1 mM
EDTA, 5 mM MgCl2 over a period of 1 h.
Probes were end-labeled to 1-3 × 105 cpm/ng DNA with
[ Table I.
Oligonucleotides used in gel electrophoretic mobility shift assays
Volume 272, Number 34,
Issue of August 22, 1997
pp. 21260-21267
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.
Type I Receptor*

type I receptor (TGF-
RI)
occurs with a 1.0-kilobase pair fragment immediately upstream of exon
1. This region lacks a typical TATA box but contains CCAAT boxes,
multiple Sp1, and PEBP2/CBF
binding sites among other possible
cis-acting elements. Alterations within two CCAAT box
sequences do not mitigate reporter gene expression driven by the basal
promoter, and no nuclear factor binds to oligonucleotides encompassing
these sites. In contrast, other deletions or site-specific mutations
reveal an essential Sp1 site in the basal promoter and several
dispersed upstream Sp1 sites that contribute to maximal reporter gene
expression. The proportions of transcription factors Sp1 and Sp3, and
their ratios of binding to consensus elements, are maintained in bone cells at different stages of differentiation. Finally, nuclear factor
that binds to PEBP2/CBF
-related cis-acting elements in the basal promoter sequence also occurs in osteoblasts. Our studies reveal that constitutive expression of TGF-
RI may be determined by
constitutive nuclear factor binding to Sp1 sites, whereas other elements may account for the variations in TGF-
RI levels that parallel changes in bone cell differentiation or activity.
(TGF-
)1 receptors occur on
most cells, and a functional TGF-
type I receptor (TGF-
RI) is
required for all known TGF-
-dependent effects. In some
situations its activity is controlled by complex interactions with
other cell surface components (1-3). However, in contrast to
TGF-
RII and the cell surface proteoglycan also termed TGF-
RIII or
betaglycan, expression of TGF-
RI is maintained on differentiated
bone cells (4). For these reasons, and because little is known about
the molecular control of TGF-
RI expression, we cloned the rat
TGF-
RI promoter and characterized several of its functional aspects
in cultures of primary and continuous skeletal and nonskeletal cells derived from fetal rats. The rat TGF-
RI promoter lacks a typical TATA box, but initiates transcription at multiple sites within a 220-bp
span upstream of the initial methionine codon in differentiated bone
cells. The 3
-terminal 300-bp sequence encompassing this region
contains a GC-rich CpG island, seven consensus Sp1 binding sites, and
two CCAAT boxes. Transfection studies using different fragments of
TGF-
RI promoter cloned upstream of the reporter gene luciferase
demonstrated maximal activity by a 1.0-kb fragment that encompassed
these and other possible cis-acting elements. Importantly,
several dispersed elements appeared to cooperate for maximal
reporter gene expression in osteoblast-enriched cultures (5).
Coincident with this work, the human TGF-
RI promoter was cloned, and
its sequence reveals a similar organization with identically spaced
CCAAT box motifs (6).
RI gene is driven by a
constitutively active promoter that maintains expression of TGF-
RI
in many cells. Nevertheless, this promoter is partly unusual to the
extent that other promoters organized in a similar way tend to lack
CCAAT box sequences. Imposed on this are our previous observations that
the proportions of TGF-
RI mRNA and protein may vary with the
osteoblast phenotype and that its levels are rapidly controlled by
certain stimulatory and inhibitory bone growth regulators (4,
7).2 Initial TGF-
RI
promoter activity studies substantiate that osteoblast-related variations in steady state mRNA levels are controlled at least in
part at the level of gene transcription (4,
5).3 Therefore, the
widespread expression of TGF-
RI, driven by a constitutively active
promoter, may in some instances be regulated by other
cis-acting regulatory elements.
RI promoter that are required for maximal and basal
activity. We examined the importance of two CCAAT boxes and various
consensus and putative binding sites for Sp1 transcription factor
family members that occur in this region and identified the presence of
PEBP2/CBF
binding sites. Our results identify that some of elements
are not used under basal conditions, some appear to be essential
components of constitutive TGF-
RI gene expression, and yet others
may help to determine phenotype-dependent TGF-
RI
expression by differentiated bone cells.
Cell Cultures
-glycerol phosphate and collected 2 weeks after
confluence. Mineralized nodules were only observed in population 3-5,
were evident 3-4 days after adding
-glycerol phosphate, and
accumulated throughout 2 weeks of incubation (8, 9). Clonal rat
osteosarcoma-derived osteoblast-like ROS 17/2.8 cultures (obtained
from Dr. Gideon Rodan; Merck Sharp and Dohme Research
Laboratories, West Point, PA) and first passage skin fibroblasts from
rat fetuses used to isolate bone cells were cultured and treated by
similar procedures (4).
RI promoter cloned upstream of the reporter gene luciferase were
described previously (5). Since its publication, we noted several
sequence compressions in the CpG island when we confirmed
oligonucleotide sequences for nuclear factor binding studies. A
corrected sequence for accession number U48401 has been submitted to
GenBank. To produce the deletion mutant pSX3, an oligonucleotide primer (pMR2) corresponding to nucleotides
240 to
221 of the rat TGF-
RI promoter was prepared to include an XhoI site (underlined)
(5
-CCTGGCGGAGCTCGAGCGGCCCTGGACTTCTGC-3
). Twenty-five PCR
cycles were performed at 94 °C for 30 s (denaturation), 58 °C for 1 min (annealing), and 72 °C for 2 min (extension) with pMR2, reverse Sp6 sequencing primer (5
-GATTTAGGTGACACTATAG-3
), pGEM-ES1.1 (comprising 1.1 kb of TGF-
RI promoter sequence; Ref. 5)
as template, all four dNTPs, and 1 unit of Taq DNA
polymerase (Boehringer Mannheim). The 0.73-kb PCR product was
gel-purified (Qiagen), and the fragment released with XhoI
and SacI was used to replace the corresponding wild type
sequence within pSN0.8. Other mutation and deletion constructs were
prepared by analogous PCR procedures. Constructs pCAATµ1, with a
mutation in the forward CCAAT box at nucleotides
124 to
120, and
pAN0.4µ2, incorporating the substitutions in probe XN2µ2 as shown
in Fig. 9, were prepared with pAN0.4 DNA as template. Insert for
pCAATµ1 was produced with forward RVprimer3
(5
-CTAGCAAAATAGGCTGTCCC-3
), corresponding to vector DNA upstream of
polylinker, and reverse primer PMR1 [5
-TAACTGCTCGAGGGGCGCACGAAGCTTCTGCCCGGCCTCC-3
),
corresponding to nucleotides
136 to
98 of the TGF-
RI promoter,
with XhoI site (underlined) and substitutions
(double underlined) as shown in Fig. 4. The 0.25-kb product
was released with SacI and XhoI and inserted into
the corresponding region in wild type pAN0.4. Insert for pAN0.4µ2 was
produced with forward primer
(5
-AGCGAGGCCGCGGCGGCGGCGGGGACCTGGGGCGAGGAGA-3
), corresponding to nucleotides
86 to
47 with substitutions
(double underlined) at nucleotides
60 to
61, and
backward primer GLprimer2 [5
-CTTTATGTTTTTGGCGTCTTCCA-3
],
corresponding to vector DNA downstream of the polylinker
NcoI site. The 0.14-kb product was digested with
SacII and NcoI (see Fig. 4), and the 54-bp
downstream fragment was inserted into the corresponding region in wild
type pAN0.4. Constructs pCAAT2 (wild type) and pCAATµ2 (with a 3-base
pair substitution in the backward CCAAT box at nucleotides
216 to
220) were prepared with TGF-
RI promoter DNA from nucleotides
700
to
203, obtained by digestion with SacI and
ApaI, and cloned into pBluescript II KS as template. Insert
for pCAAT2 was produced with a forward primer that added a downstream
SacI site (underlined) at the 5
end, immediately
upstream of promoter DNA nucleotides
238 to
217
(5
-CGGGAGCTCAGAAGTCCAGGGCCGCTCATTG-3
), and backward primer T3 (5
-ATTAACCCTCACTAAAG-3
), corresponding to vector DNA. Insert for pCAATµ2 was produced with a similar forward primer, also
including a 3-base substitution in the CCAAT motif (double underlined)
plus 9 bases at the 3
end
(5
-CGGGAGCTCAGAAGTCCAGGGCCGCTCGAGGGCCGCCCAG-3
) and backward primer T3. The products were digested with SacI
and ApaI and inserted into pSN0.8 (5) previously digested
with the same restriction enzymes. Plasmid constructs were purified with the Wizard Maxiprep Kit (Promega). DNA of all constructs was
verified by sequencing.
Fig. 9.
Localization of an essential Sp1 binding
domain in region XN2 of the rat TGF-
RI promoter. A,
nuclear protein (5 µg) from osteoblast-enriched cultures was combined
with 32P-labeled oligonucleotides XN2, XN2µ1, XN2µ2, or
XN2µ3. Oligonucleotide sequences are shown in Table I, and positions
are shown in Fig. 2. Protein-DNA complexes were resolved on 5%
nondenaturing polyacrylamide gels and visualized by autoradiography.
B, pGL3-Basic (vector), pAN0.4, or pAN0.4µ2, containing
the substitutions found in XN2µ2, were assessed for reporter gene
expression in fetal rat-derived osteoblast-enriched cultures. Data are
shown as relative luciferase activity, corrected for protein content.
Data are results from three separate studies with nine replicate
cultures per condition. By analysis of variance, only pAN0.4 was
significantly different from pGL3 basic.
[View Larger Version of this Image (36K GIF file)]
Fig. 4.
Effects of CCAAT boxes within the rat
TGF-
RI promoter on reporter gene expression. Wild type
sequences contained in constructs pAN0.4 and pCAAT2 and the
substitutions introduced into pCAATµ1 and pCAATµ2 are shown on the
left. Arrows indicate the positions and
orientation of each CCAAT box sequence. Plasmid constructs were
inserted upstream of the reporter gene luciferase and transfected into
less differentiated periosteal cells and osteoblast-enriched cell
cultures from fetal rat bone. Data are shown as relative luciferase
activity, corrected for protein content, and are results from three
separate studies and nine replicate cultures per condition. By
Student's t test, there was no significant difference
between constructs with wild type and modified sequences.
[View Larger Version of this Image (19K GIF file)]
75 °C.
-32P]dCTP and Klenow fragment of Escherichia
coli DNA polymerase I at 25 °C for 25 min and gel-purified.
Nuclear extracts (5-7 µg protein) were incubated in binding buffer
(25 mM HEPES (pH 7.5), 80 mM KCl, 2 mM dithiothreitol, 0.5 mg/ml bovine serum albumin, 12.5%
glycerol) containing 62.5 µg/ml of poly(dI/dC) (Sigma) on ice for 10 min, and then supplemented with 3 × 104 cpm (0.1-0.2
ng) of 32P-labeled oligonucleotide probe for 30 min in a
total volume of 20 µl. In competitive binding studies, unlabeled
native or mutated oligonucleotides were added just before
32P-labeled probe. Probes used in this study are shown in
Table I and Fig. 9. To assess
transcription factor immunologically in gel shift analyses, 0.1-1.0
µg of rabbit polyclonal anti-Sp1 or anti-Sp3 antibody or rabbit IgG
(Santa Cruz) was incubated with nuclear extract in binding buffer on
ice for 60 min before adding 32P-labeled probe. Nuclear
protein-DNA complexes were resolved on 5% nondenaturing polyacrylamide
gels in 0.5 × TBE buffer (90 mM Tris borate (pH 8.3),
2 mM EDTA) by electrophoresis for 2.5 h at 20 °C
with 130 V. Gels were dried and analyzed by autoradiography.
RI
promoter sequence (5). Shift refers to slower migration through polyacrylamide gel: +, presence;
, absence. Factor refers to gel
shift complexes identified with transcription factor specific antisera.
Nucleotide substitutions in µXN1 that differ from the wild type
sequence of region XN1 the rat TGF-
RI promoter are shown in boldface
and underlined.
Designation
5
-sequence-3
Position
Shift
Factor
SA1
GTGCGGAGGCGTGGTTAGAG
260
to
241+
Sp1
SX1
CGCTCATTGGCCGCCCAGGGCCCGAGGGCGGGG
225 to
193
AX5
AGGGCCCGAGGGCGGGGCTCTCCGCTGGGTCCCTCTAGGGCGCT
209 to
166+
Sp1
AX2
CGGGCGGCGGGGGAGGCGGGGTC
163 to
141+
Sp1
AX6
GGCGGGAGCCGGGCAGCCAATGCGTGCGCC
140 to
111
AX3
CGGGCAGCCAATGCGTGCGCC
131 to
111
XN1
TCGAGCAGTTACAAAGGGCCGGAGCGAGGCCGCGGCGG
108 to
71+
Sp1, PEBP2/CBF
µXN1
TCGAGCAGTTACAAAGGGCCGGAGCGAATTCGCGGCGG
108
to
71+
Sp1
SXN1.2
GCCGGAGCGAGGCCGCGGCGGCGGCGGGGAGGTG
91 to
58+
PEBP2/CBF
XN2
CGGCGGGGAGGTGGGGCGAGGAGAG
70 to
46+
Sp1
XN3
GAGGCGAGGCTTGTTGAGGAGAAGCTGAG
48 to
20
SP1
ATTCGATCGGGCGGGGCGAGC
none
+
Sp1
PEBP2/CBF
GCTATTAACCACAATACTCG
none
+
PEBP2/CBF

Forty µg of nuclear protein was fractionated by electrophoresis through an 8% denaturing polyacrylamide gel (12). Proteins were blotted from the gels onto Immobilon P membranes (Millipore) by electrophoresis (Ideal Scientific Company, Inc.). Membranes were washed in TBST buffer (10 mM Tris-Cl (pH 8.0), 150 mM NaCl, 0.05% Tween 20), and blocked in 5% defatted milk dissolved in TBST. Blots were incubated with 1:2000 dilution of anti-Sp1 antibody (Santa Cruz) for 1 h, washed, incubated with a 1:3000 dilution of goat anti-rabbit IgG conjugated to horseradish peroxidase (Bio-Rad), washed in TBST, incubated with enhanced chemiluminescence (Amersham Corp.) reagents, and exposed to x-ray film.
Statistical AnalysisData were analyzed in multiple samples after multiple determinations and where appropriate are expressed as means ± S.E. In experiments comparing more than one variable or group, statistical differences were assessed by analysis of variance with limits set by Dunnet. In experiments where a single group was compared with control, analysis defaulted to Student's t test. Comparisons were performed with a commercial statistical software package (SigmaStat®). Differences among groups were considered significant when p values were <0.05.
RI
Promoter
By sequence analysis, many transcription factor binding
sites occur within a CpG island at the 3
-terminal 300-bp region of the
rat TGF-
RI promoter. Consistent with other similarly organized promoters, transcription initiates at several sites within a ~200-bp span immediately upstream of exon 1 (5). There are seven consensus Sp1
binding sites, including three GC boxes, and at least nine other
potential Sp1 binding sites with 80-90% sequence homology to
consensus GC boxes within the 0.9-kb region upstream of the initiator
methionine codon at position +22 to +25 (Ref. 5; see
Table II). As shown in Fig.
1, deleting various spans that include
Sp1 binding sites from the maximally active 1.0-kb region termed EN
(flanked by EcoRI and NcoI restriction sites)
significantly limited reporter expression. As in earlier studies,
pSN0.7, pAN0.4, pXN0.1, and pSN0.1, derived from pEN1.0 by truncation
from the 5
end, caused incremental decreases in reporter gene
expression. However, even the short fragments contained in pXN0.1 and
pSN0.1 maintained a low but significant level of promoter activity by comparison to the promoter-less pGL3-Basic vector. Deletions from the
3
end (pEXH0.8, pAX0.2, and pAS0.2) also limited reporter expression.
With pAX0.2 and pAS0.2, reporter gene expression was consistently below
the activity driven by pGL3-Basic. These findings indicated that
sequences in region XN (flanked by XhoI and NcoI restriction sites) in the TGF-
RI promoter are essential for basal promoter function, although other sequences upstream of the
XhoI site appear necessary for maximal promoter activity.
Many cis-acting Sp1 binding elements occur within regions
EN, AN (flanked by ApaI and NcoI restriction
sites), and XN of the promoter (see Fig. 1 and Table II). Region AX
(flanked by ApaI and XhoI restriction sites)
contains four consensus Sp1 binding sites, including one GC box. When
the Sp1 binding sites in this region were deleted internally in
construct pSX3, promoter activity was severely limited. Therefore,
sequences encompassing various Sp1 sites appear to be important
components of the TGF-
RI promoter, and several may be required for
maximal activity.
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
RI promoter. A, positions of various
restriction endonuclease cleavage sites used to generate fragments of
the rat TGF-
promoter. B, putative nuclear factor binding
sites identified by sequence analysis. The black arrow at
position +1 indicates the most downstream transcription initiation site
(5). C, DNA encoding the portions of the TGF-
RI promoter
indicated by gray bars was ligated upstream of the reporter
gene luciferase in transfection vector pGL3-Basic and co-transfected
with a reporter construct encoding
-galactosidase (5) in primary
osteoblast-enriched cultures from fetal rat bone. Data are shown as
relative luciferase activity (by comparison to pGL3-Basic vector),
corrected for protein content.
-Galactosidase activity never varied
by more than 6% (S.E.) within an experiment. Data are results from 2 to 14 separate overlapping studies with 6-44 replicate cultures per
condition. By analysis of variance, all other constructs are
significantly lower in activity than pEN1.0.
Two CCAAT Boxes in the Rat TGF-
RI Promoter Are Inactive in Bone
Cells
Because promoter construct pAN0.4 maintains strong
activity, we used oligonucleotide probes spanning each of the several
clusters of cis-acting elements in this area in
electrophoretic mobility shift assays. As shown in Fig.
2 and Table I, probes SA1, SX1, AX2, AX3,
AX5, and AX6 possess several putative Sp1 binding sites. While most
growth factor receptor gene promoters so far identified lack TATA and
CCAAT boxes, two CCAAT boxes occur in this GC-rich region of the
TGF-
RI promoter. One is at
216 to
220 in the backward
orientation within SX1, and the other is at
124 to
120 in the
forward orientation within AX3. When oligonucleotide probes were
32P-labeled and combined with nuclear extract from primary
osteoblast-enriched bone cell cultures, no DNA-protein complexes
occurred with probes SX1 or AX3 (Fig.
3A). Probe AX6, encompassing
but slightly larger than AX3, was also examined with nuclear extract
from these cells, from dermal fibroblasts, from undifferentiated
periosteal bone cells, and from the highly differentiated
osteosarcoma-derived osteoblast-like cell line, ROS17/2.8. Analogous to
results with 32P-AX3, 32P-AX6 never bound
nuclear factor from osteoblast-enriched cultures (Fig. 3B)
or any other cell type examined so far (data not shown). PCR primers
with substitutions in the CCAAT box regions were used to create mutated
reporter plasmid constructs. As shown in Fig. 4, pCAATµ1 (with alterations in the
forward CCAAT box) and pCAATµ2 (with alterations in the backward
CCAAT box) each promoted reporter gene expression equivalent to the
parental constructs. Although less overall TGF-
RI promoter activity
occurs with undifferentiated bone cells (5), similar results
occurred in these cells and the osteoblast-enriched bone cell cultures
transfected with pCAATµ1. Consequently, neither CCAAT box motif binds
nuclear factor nor are they essential for basal promoter activity
in bone cells.
RI
promoter. Restriction endonuclease cleavage sites and
transcription factor binding sites are as described in Fig. 1.
Positions of oligonucleotide used for nuclear factor binding studies
are designated from below. Open bars indicate no detectable
binding by nuclear factor from rat osteoblast-enriched cultures,
black bars indicate predominantly Sp1 binding, light
gray bars (SXN1 and SXN1.2) indicate PEBP2/CBF
binding, and the
dark gray bar (XN1) indicates Sp1 and PEBP2/CBF
binding.
0.26- to
0.1-kb region of the rat TGF-
RI promoter. A, nuclear
protein (7 µg) derived from less differentiated periosteal bone cells
(PERIOS), osteoblast-enriched cultures (OB),
fetal rat dermal fibroblasts (RDF), and ROS 17/2.8 cultures
(ROS) was combined with 32P-AX5,
32P-SX1, or 32P-AX3 as indicated. B,
nuclear protein (7 µg) from fetal rat osteoblast-enriched cultures
was combined with 32P-labeled oligonucleotides SA1, SX1,
AX5, AX2, AX6, AX3, or SP1, without or with 50-fold molar excess of
unlabeled SP1 as indicated. Oligonucleotide sequences are shown in
Table I and positions are shown in Fig. 2. Protein-DNA complexes were
resolved on 5% nondenaturing polyacrylamide gels and visualized by
autoradiography.
Functional Sp1 Binding Sites in the TGF-
RI
Promoter
Primary osteoblast-enriched cell cultures are derived
from normal tissue and appear to be controlled in appropriate
physiological ways. Because they express high levels of TGF-
RI
mRNA, protein, and promoter activity (4, 5, 7, 9), and protein that associates with Sp1 binding sites, many subsequent studies were performed with extracts from this culture model. Probes SA1, AX2, and
AX5 all formed slowly migrating radiolabeled complexes identical to
those with 32P-SP1, containing a consensus Sp1 binding
site, and were effectively reduced by unlabeled consensus
oligonucleotide SP1 (Fig. 3B). With oligonucleotide AX5 as a
representative site to characterize Sp1 binding further, a portion of
band S1 supershifted to an even more slowly migrating complex with
anti-Sp1 antiserum, while the remainder of band S1 and all of band S2
were insensitive to any amount of anti-Sp1 antiserum that we examined
(see below). Parallel results occurred with 32P-labeled
oligonucleotide probes SA1, AX2, AX5, and SP1 (data not shown). Since
unlabeled oligonucleotide SP1 displaced bands S1 and S2 completely,
inefficient binding by anti-Sp1 antibody may account in part for this
difference. Alternatively, other Sp1-like nuclear proteins might also
bind these probes. Two Sp1 family members, Sp2 and Sp3, bind analogous
DNA elements with similar affinities (13). Sp3 is comparable in
Mr to Sp1 and could account for complexes in
bands S1 and S2 that are resistant to anti-Sp1 antibody. Addition of
0.1 or 1 µg of anti-Sp1 antibody each supershifted band S1 to a
similar extent, and 0.1 or 1.0 µg of anti-Sp3 antibody depleted band
S2 and in part band S1. Simultaneous use of both antibodies eliminated
nearly all 32P-probe from bands S1 and S2. The more obvious
effect at band S1 with both antibodies suggests that loss of Sp3 (band
S2) when only anti-Sp3 antibody is used may make more
32P-probe available for binding by Sp1. No gel shift,
supershift, or depletion occurred with normal rabbit IgG (Fig.
5). Band S1 therefore appears to contain
Sp1 (by supershift) and Sp3 (by antibody depletion), whereas band S2
contains predominantly Sp3. The fractional amount of nucleotide binding
to Sp1 and Sp3 was similar with each 32P-labeled probe
examined. Partitioning of Sp1 and Sp3 in these ways has been noted
previously (14-17) and may relate in part to multiple Sp3 isoforms
arising from differential initiation codon utilization.4
RI
promoter DNA. Nuclear protein (5 µg) from fetal rat
osteoblast-enriched cultures was incubated for 1 h on ice with
antibody or control solutions and then incubated for 30 min with
32P-AX5 plus no addition (
), 0.1 or 1 µg of anti-Sp1 or
anti-Sp3 IgG, or 1 µg of nonimmune rabbit IgG, as indicated.
Oligonucleotide sequences are shown in Table I, and positions are shown
in Fig. 2. Protein-DNA complexes were analyzed by 5% native
polyacrylamide gel electrophoresis and autoradiography. S1
and S2 refer to complexes that are distinguished by anti-Sp1
and anti-Sp3 specific IgGs.
Binding to Sp1-like sites occurred with oligonucleotide probes XN1
(from
108 to
71) and XN2 (from
70 to
46) of region XN and
nuclear extract from osteoblast-enriched cultures (Fig. 6A). 32P-XN2
formed nuclear factor complexes similar to those with probes SA1, AX2,
AX5, or SP1, whereas binding to 32P-XN1 occurred in several
complexes. As shown in Fig. 6B, after a longer exposure to
film, band S1, while minimal, was detected with 32P-XN1,
was specifically reduced by excess unlabeled probe SP1 (Fig.
6B), and supershifted with anti-Sp1 antibody (data not
shown). Band S2 was not detected with 32P-XN1, consistent
with the faint binding in band S1 that normally accounts for the
majority of nuclear factor binding by Sp1-like sites. Also, unlabeled
SXN1.2 in which the Sp1 binding site was eliminated did not reduce
32P-XN1 in band S1 (Fig. 6B). No nuclear factor
complexes formed with 32P-XN3.
0.1 kb in the rat TGF-
RI promoter. A, nuclear
protein (7 µg) from fetal rat osteoblast-enriched cultures was
combined with oligonucleotides 32P-oligonucleotides XN1,
XN2, or XN3 from the TGF-
RI promoter. B, nuclear protein
was combined with 32P-XN1 and the following additions: no
addition (
); 100-fold molar excess unlabeled oligonucleotides XN1,
µXN1, SXN1.2, PEBP2/CBF, or SP1 as indicated. Oligonucleotide
sequences are shown in Table I and positions are shown in Fig. 2.
Protein-DNA complexes were resolved on 5% nondenaturing polyacrylamide
gels and visualized by autoradiography. S1 and S2
refer to a complexes reactive with anti-Sp1-specific IgG, C
refers to a complex consistent with binding to PEBP2/CBF
transcription factor(s), and U refers to complexes containing presently uncharacterized nuclear protein.
The various Sp1 sites in regions SA, AX, and XN were also compared by
competitive binding studies where 25- and 50-fold excess unlabeled
oligonucleotides inhibited nuclear factor binding to 32P-SP1 to different extents. Consistent with direct
binding studies (Fig. 3), oligonucleotides SA1, AX5, and XN2 competed
with very high affinity, and SX1 and XN1 did not. Because the same Sp1
sites occur in SX1 and AX5, upstream sequences may restrict Sp1 binding to this region in some instances. Probe AX2, which contains both an Sp1
binding site and a GC box, inhibited Sp1 binding to 32P-SP1
less efficiently than SA1, AX5, and XN2 (Fig.
7). Although AX2 clearly binds Sp1 (Fig.
3), the proximity of the two Sp1 sites or flanking sequences may cause
less avid binding to Sp1 than other sequence configurations. Analogous
to the low to negligible amounts of Sp1 binding to 32P-XN1
and 32P-XN3 seen in Fig. 6, oligonucleotide XN1 inhibited
32P-SP1 binding only weakly (Fig. 7), and XN3 had no effect
(data not shown).
RI promoter. Nuclear protein (5 µg)
from osteoblast-enriched cultures was combined with 32P-SP1
oligonucleotide and no addition (none), or with 25- or
50-fold molar excess (xs) of unlabeled oligonucleotides
SP1, SA1, SX1, AX5, AX2, XN1, or XN2, as
indicated. Oligonucleotide sequences are shown in Table I and positions
are shown in Fig. 2. Protein-DNA complexes were resolved on 5%
nondenaturing polyacrylamide gels and visualized by
autoradiography.
Oligonucleotide XN2 contains four potential, overlapping Sp1 binding
sites (designated as Sp1 binding domains 2 to 5 in Fig. 8) and effectively competed with
32P-SP1. Because Sp1-related complexes were not competed by
and did not form with oligonucleotide SXN1.2 (Fig. 6B, and
other data not shown), binding domains 2 and 3 in oligonucleotide XN2
are unlikely to be active, whereas domain 4 may require more 3
sequence. To assess whether domain 4 or 5 or both are functional,
probes XN2µ1, XN2µ2, and XN2µ3, derived from XN2 by specific
nucleotide substitutions shown in Fig. 8, were examined. Although small
decreases in binding occurred with XN2µ1 and XN2µ3, only XN2µ2
could not form nuclear factor complex (Fig.
9A), indicating site 4 as the most active site in XN2. Consistent with this, when the nucleotide substitutions found in XN2µ2 were introduced into the reporter construct pAN0.4 to create pAN0.4µ2, reporter activity fell to the
level of pGL3Basic (Fig. 9B), revealing that this specific Sp1 binding site is essential for basal gene expression from the TGF-
RI promoter.
RI promoter. A, putative
Sp1 binding domains are indicated by gray boxes. The
PEBP2/CBF-
binding domain is indicated by the open box.
B, the sequences and names designated for the oligonucleotide
probes, their positions within the rat TGF-
RI promoter, and the
identity of transcription factors that associate with these
oligonucleotides (see Fig. 9) are indicated. The nucleotide
substitutions in XN2µ1, XN2µ2, and XN2µ3 that differ from
parental XN2 are underlined.
Ratios of Sp1 to Sp3 Do Not Change Significantly during Bone Cell Differentiation
TGF-
RI is constitutively expressed in many
tissues, although its level may vary with cell phenotype and
differentiation status (1, 4). Using several fetal rat skin- and
bone-derived cultures, we found consistent increases in the relative
amounts of cell surface TGF-
RI protein, mRNA, and promoter
activity in parallel with expression of the osteoblast phenotype (4,
5). These variations could not be accounted for by the amounts of Sp1
or Sp3 in nuclear extracts from these cultures. In contrast to
TGF-
RI protein, mRNA and promoter activity profiles, Sp1 and
Sp3, were more abundant in fetal rat fibroblasts and osteoblast-like
ROS 17/2.8 osteosarcoma-derived cells relative to primary bone-derived cell cultures, by both gel mobility shift and immunoblot analyses (Figs. 3B and 10). Furthermore, the ratio of band S1
(containing Sp1 and Sp3) to band S2 (containing Sp3) was similar in
each cell type when the nuclear extracts were assessed by gel mobility
shift assay without or with anti-Sp1 antibody (Fig.
10A). Nuclear extracts from
proliferating, differentiating, or mineralizing osteoblast-enriched cell cultures (18) also showed analogous ratios between bands S1 and S2
and isoform distribution patterns with anti-Sp1 and anti-Sp3 antisera,
although at later stages of culturing the nuclear factor profiles
became more complex (Fig. 11).
) or
with 0.5 µg anti-Sp1 IgG (+). When present, IgG was included for
1 h before the addition of 32P-AX5. Protein-DNA
complexes were resolved on 5% nondenaturing polyacrylamide gels and
visualized by autoradiography. Oligonucleotide sequences are shown in
Table I, and positions are shown in Fig. 2. B, nuclear
protein (30 µg) from RDF, PERIOS,
OB, and ROS cultures was resolved on 8%
SDS-polyacrylamide gel, transferred to membrane, and blotted with
anti-Sp1 IgG. The immunoreactive 105- and 95-kDa Sp1 bands are
indicated.
) or with (+)
0.5 µg of anti-Sp1 or anti-Sp3 IgG, as indicated. When present, IgGs
were included for 1 h before the addition of 32P-XN2.
Oligonucleotide sequences are shown in Table I and positions are shown
in Fig. 2. Protein-DNA complexes were resolved on 5% nondenaturing
polyacrylamide gels and visualized by autoradiography. Identical
binding ratios were obtained with other upstream Sp1 reactive
oligonucleotide probes.
Other Possible Transcription Factor Binding Sites in the TGF-
RI
Promoter
Sequence analysis also revealed other possible
cis-acting elements within region AX. As described earlier,
upstream oligonucleotides SA1, AX5, and AX2 bound nuclear protein from
fetal rat bone cells and dermal fibroblasts essentially in complexes
consistent with binding to Sp1 sites. Several possible
cis-acting sequences reside downstream of these sites. Of
these, a binding site for hepatocyte nuclear factor (HNF)-5 occurs
downstream of nucleotide
21 and has not yet been investigated. No
nuclear factor complexes formed with oligonucleotide XN3, which spans
nucleotides
48 to
20 (Fig. 6A). In addition to the Sp1
binding sites in XN1 and XN2, XN1 contains a potential
cis-acting element for transcription factors of the
PEBP2/CBF
family (19-21). As shown in Fig. 6B,
32P-XN1 binding within complexes designated as band C was
inhibited by unlabeled oligonucleotides XN1 (intact) and SXN1.2 (where
the Sp1 binding site in XN1 was eliminated). Binding to band C was also
reduced by a probe containing a PEBP2/CBF
consensus sequence (19),
but not by µXN1, where the PEBP2/CBF
binding site in XN1 contained
three nucleotide substitutions. Other complexes designated as band U
also formed with 32P-XN1. They were essentially eliminated
by unlabeled XN1 but varied slightly in intensity in the presence of
the other site specific, truncated, or mutated XN1-derived probes that
we tested. Formation of these complexes may in some instances depend on
the presence of other nuclear factors. In other cases they may become
more evident when other binding sites found in 32P-XN1 are
eliminated and fewer nuclear factors are therefore competing for probe.
We have not yet identified the proteins that elicit the U bands.
The rat TGF-
RI promoter contains a variety of
cis-acting elements that could contribute to constitutive or
conditional expression. By transfecting reporter gene constructs into
osteoblast-enriched cultures, we previously defined regions within the
TGF-
RI promoter that are associated with maximal and basal activity.
To understand TGF-
RI gene expression in more detail, we have now
defined certain important transcription factor binding sites that may
control basal promoter activity in many cells.
Similar to various growth factor receptor promoters, the TGF-
RI
promoter lacks TATA box sequence but contains a GC-enriched so-called
CpG island (22, 23) with many transcription factor Sp1 binding sites.
Analogous to the human TGF-
RI promoter (6), CCAAT box-like sequences
that occur in this region make them unlike promoters for many other
growth factors or growth factor receptors (24-32). Nonetheless,
oligonucleotides spanning the CCAAT box sites do not bind detectable
levels of nuclear protein, and reporter gene expression was not reduced
when these sites were disrupted. Therefore, flanking sequences or the
association of other transcription elements in nearby areas may limit
the contribution of the CCAAT boxes to TGF-
RI expression under the
conditions that we have examined so far.
Unlike genes controlled by CCAAT box and TATA box elements, rat
TGF-
RI mRNA transcription initiates from multiple locations, characteristic of a constitutively expressed gene controlled by an
Sp1-dependent promoter (5, 33). Although deletions that included various Sp1 binding sites invariably limited TGF-
RI promoter activity, some of these elements, clustered within a 0.3-kb
sequence at the 3
end of the promoter, appeared more essential than
others. By gel shift and immunodetection assays, we determined that
these regions associated to equivalent extents with either Sp1 or with
the closely related transcription factor Sp3, also present in the rat
cell nuclear extracts that we examined. This result is consistent with
the similar structural features, conservation of DNA binding domains,
and similar abilities of both Sp1 family members factors to recognize
specific cis-acting elements with identical affinities
(13-17, 34, 35). Unlike Sp1, Sp3 may reduce Sp1-dependent
gene expression (34). We detected two complexes reactive with antibody
specific for Sp3 by gel shift analysis consistent with earlier reports
(14-16). Furthermore, whereas TGF-
RI and its mRNA levels vary
by relation to other TGF-
receptors on various bone- and
skin-derived cells, we did not find changes in the amounts of Sp1 or
the ratio of Sp1 to Sp3 that could account for those differences in the
various cell types, or in osteoblast-enriched cultures at various
stages of differentiation. Consequently, in the basal state,
constitutively low levels of TGF-
RI expression may be tempered by
the presence of both Sp1 and Sp3.
In other situations the proportions of Sp1 and Sp3 may change, or other
cellular proteins may modify their function. For example, Sp1 forms
heteromeric complexes with several cellular proteins. p107, a member of
the retinoblastoma family of proteins, binds Sp1 and represses
Sp1-dependent transcription, whereas retinoblastoma itself
has been reported to interact with Sp1 and Sp3. Furthermore, p107 and
retinoblastoma may complex with E2F, with cyclins, and cyclin-dependent kinases. Sp1 also interacts with the RelA
subunit of transcription factor NF-
B, and the cellular protein YY1
(36-40). Therefore, several conditions may arise that could account
for variations in Sp1 activity, and its ability to drive TGF-
RI gene expression during the cell cycle, in various cell lineages, or in cell
phenotype development.
Overall, our studies support a crucial role for several sequences
throughout the TGF-
RI promoter that contain Sp1 binding sites.
Deletion of 5
upstream sequences, reducing the promoter region to 0.7 kb, decreases its activity by 40-60%. Elimination of either another
0.4 kb from the 5
end or an internal downstream sequence further
suppresses promoter function. However, elimination of 0.1 kb of
sequence from the 3
end, a region that itself directs only moderate
reporter gene expression, potently suppresses the activity of longer
promoter fragments that still retain multiple Sp1 binding sites.
Therefore, several regions can contribute to optimal TGF-
RI gene
expression, although sequence information within the 0.1-kb 3
span is
essential for basal promoter activity. Using several overlapping
oligonucleotides spanning this region, we located a specific sequence
where substitution by two nucleotides completely eliminated Sp1 binding
and suppressed reporter gene expression from a minimal promoter
fragment. These results confirm the importance of multiple Sp1 sites
throughout the TGF-
RI promoter and establish that one downstream
site at position
63 to
54, ~90% homologous to consensus Sp1
binding sites, contributes heavily to basal promoter activity. This
finding is analogous results with the TGF-
promoter, where several
related but nonconsensus Sp1 binding sites are also required for
optimal promoter activity (41). It is difficult to compare our results
directly with those for the human TGF-
RI promoter. Even the longest
construct used to assess the human promoter region reached upstream
only as far as 0.7 kb and, most importantly, did not contain the 3
109-bp sequence where we detect an essential Sp1 site (6). Thus, at least two regulatory sites, including the important downstream Sp1
binding site (numbered
80 to
71 in the human promoter), have not
yet been assessed for their effect on gene expression driven by the
human TGF-
RI promoter.
Within the 3
-terminal 0.1-kb region of the TGF-
RI promoter, we also
found a related binding site for members of the PEBP2/CBF
transcription factor family. PEBP2/CBF
family members (also termed polyoma virus enhancer binding protein 2, or PEBP2
; and acute myelogenous leukemia factors; Refs. 19-21) were previously identified in nuclear extracts from differentiated osteoblasts and found to have a
critical role in the expression of the osteoblast-related protein,
osteocalcin (18, 42, 43). Our studies with the TGF-
RI have now
identified a new target for PEBP2/CBF
activity beyond the
virus-infected or immunological tissues where their identity was first
established (19). The presence of a PEBP2/CBF
-related element in
this downstream region of the TGF-
RI promoter may account in part
for the high level of TGF-
RI mRNA and protein expression and
promoter activity by differentiated osteoblasts (4), imposed upon the
constitutive levels regulated by Sp1 and other basal elements. We are
continuing to characterize this and several other even more potent
PEBP2/CBF
binding sites further upstream (see Fig. 1) to identify
the osteoblast-enriched PEBP2/CBF
family members that bind to these
sequences and to examine variations in PEBP2/CBF
expression during
osteoblast differentiation.2,3
In addition to the Sp1 and PEBP2/CBF
-related complexes, others
designated as band U also form with an oligonucleotide from this
important 3
-terminal control region. This sequence contains elements
for two other transcriptional regulators, HNF-5 and heat shock protein
70 (Hsp70). By relative migration, the slower migrating band presently
seems inconsistent with a complex containing the Mr of transcription factor HNF-5. It also seems
unlikely to be accounted for by Hsp70 because of the basal growth
conditions of our studies and the presence of another possible Hsp70
site in oligonucleotide SX1 that does not exhibit the same complex. However, it may represent a complex containing a basal transcription factor of the TFII family. TFII-related proteins are commonly involved
in the expression of many genes transcribed by polymerase II, although
the TGF-
RI promoter lacks a TATA box where these agents customarily
bind (5, 6). Nevertheless, our studies demonstrate that basal gene
expression from the TGF-
RI promoter relies heavily on several Sp1
binding sites. One of these cis-acting elements, which
occurs far downstream, appears essential for optimal TGF-
RI promoter
activity. However, the effectiveness of these sites may be modified by
other negative or positive transcription regulators whose expression
may vary with cell phenotype or with other extracellular circumstances.
These and other differences may account for changes in TGF-
RI levels
and therefore sensitivity to this important growth regulator during
development, differentiation, or hormonal control in skeletal tissue
(4, 44).
To whom correspondence should be addressed: Section of Plastic
Surgery, Yale University School of Medicine, 333 Cedar St., P.O. Box
208041, New Haven, CT 06520-8041. Tel.: 203-785-4927; Fax:
203-785-5714; E-mail: CentrellMA{at}MASPO3.MAS.YALE.EDU.
R, transforming growth factor
receptor; bp,
base pair(s); kb, kilobase pair(s); PCR, polymerase chain
reaction.