JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ji, C.
Right arrow Articles by Centrella, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ji, C.
Right arrow Articles by Centrella, M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 34, Issue of August 22, 1997 pp. 21260-21267
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Multiple and Essential Sp1 Binding Sites in the Promoter for Transforming Growth Factor-beta Type I Receptor*

(Received for publication, April 9, 1997, and in revised form, June 6, 1997)

Changhua Ji , Sandra Casinghino , Thomas L. McCarthy and Michael Centrella Dagger

From the Section of Plastic Surgery, Department of Surgery, Yale University School of Medicine, New Haven, Connecticut 06520-8041

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES


ABSTRACT

Maximal gene expression driven by the promoter for the transforming growth factor beta  type I receptor (TGF-beta RI) occurs with a 1.0-kilobase pair fragment immediately upstream of exon 1. This region lacks a typical TATA box but contains CCAAT boxes, multiple Sp1, and PEBP2/CBFalpha binding sites among other possible cis-acting elements. Alterations within two CCAAT box sequences do not mitigate reporter gene expression driven by the basal promoter, and no nuclear factor binds to oligonucleotides encompassing these sites. In contrast, other deletions or site-specific mutations reveal an essential Sp1 site in the basal promoter and several dispersed upstream Sp1 sites that contribute to maximal reporter gene expression. The proportions of transcription factors Sp1 and Sp3, and their ratios of binding to consensus elements, are maintained in bone cells at different stages of differentiation. Finally, nuclear factor that binds to PEBP2/CBFalpha -related cis-acting elements in the basal promoter sequence also occurs in osteoblasts. Our studies reveal that constitutive expression of TGF-beta RI may be determined by constitutive nuclear factor binding to Sp1 sites, whereas other elements may account for the variations in TGF-beta RI levels that parallel changes in bone cell differentiation or activity.


INTRODUCTION

Transforming growth factor-beta (TGF-beta )1 receptors occur on most cells, and a functional TGF-beta type I receptor (TGF-beta RI) is required for all known TGF-beta -dependent effects. In some situations its activity is controlled by complex interactions with other cell surface components (1-3). However, in contrast to TGF-beta RII and the cell surface proteoglycan also termed TGF-beta RIII or betaglycan, expression of TGF-beta RI is maintained on differentiated bone cells (4). For these reasons, and because little is known about the molecular control of TGF-beta RI expression, we cloned the rat TGF-beta RI promoter and characterized several of its functional aspects in cultures of primary and continuous skeletal and nonskeletal cells derived from fetal rats. The rat TGF-beta RI promoter lacks a typical TATA box, but initiates transcription at multiple sites within a 220-bp span upstream of the initial methionine codon in differentiated bone cells. The 3'-terminal 300-bp sequence encompassing this region contains a GC-rich CpG island, seven consensus Sp1 binding sites, and two CCAAT boxes. Transfection studies using different fragments of TGF-beta RI promoter cloned upstream of the reporter gene luciferase demonstrated maximal activity by a 1.0-kb fragment that encompassed these and other possible cis-acting elements. Importantly, several dispersed elements appeared to cooperate for maximal reporter gene expression in osteoblast-enriched cultures (5). Coincident with this work, the human TGF-beta RI promoter was cloned, and its sequence reveals a similar organization with identically spaced CCAAT box motifs (6).

These features suggested that the TGF-beta RI gene is driven by a constitutively active promoter that maintains expression of TGF-beta RI in many cells. Nevertheless, this promoter is partly unusual to the extent that other promoters organized in a similar way tend to lack CCAAT box sequences. Imposed on this are our previous observations that the proportions of TGF-beta RI mRNA and protein may vary with the osteoblast phenotype and that its levels are rapidly controlled by certain stimulatory and inhibitory bone growth regulators (4, 7).2 Initial TGF-beta RI promoter activity studies substantiate that osteoblast-related variations in steady state mRNA levels are controlled at least in part at the level of gene transcription (4, 5).3 Therefore, the widespread expression of TGF-beta RI, driven by a constitutively active promoter, may in some instances be regulated by other cis-acting regulatory elements.

In the present study we investigated in more detail sequences within the TGF-beta RI promoter that are required for maximal and basal activity. We examined the importance of two CCAAT boxes and various consensus and putative binding sites for Sp1 transcription factor family members that occur in this region and identified the presence of PEBP2/CBFalpha binding sites. Our results identify that some of elements are not used under basal conditions, some appear to be essential components of constitutive TGF-beta RI gene expression, and yet others may help to determine phenotype-dependent TGF-beta RI expression by differentiated bone cells.


EXPERIMENTAL PROCEDURES

Cell Cultures

Using procedures approved by Yale Animal Care and Use Committee, parietal bones from 22-day-old Harlan Sprague Dawley rat fetuses (Charles River Breeding Laboratories) were dissected free of sutures and digested for five 20-min intervals with collagenase. The first digestion releases less differentiated periosteal cells, and the last three digestions are enriched with cells with differentiated osteoblast characteristics. Primary cultures were plated at 5 × 103 cells/cm2 in Dulbecco's modified Eagle's medium containing 20 mM HEPES (pH 7.2), 100 µg/ml ascorbic acid, penicillin and streptomycin, and 10% fetal bovine serum. Cultures reach confluence (5-6 × 104 cells/cm2) within 6-7 days. Proliferating cultures were collected at 75% confluence. Every 3-4 days, confluent cultures were re-fed the same medium except that ascorbic acid and serum were reduced by half. Differentiated cultures were collected 1 week after confluence. Mineralizing cultures were supplemented with 3 mM beta -glycerol phosphate and collected 2 weeks after confluence. Mineralized nodules were only observed in population 3-5, were evident 3-4 days after adding beta -glycerol phosphate, and accumulated throughout 2 weeks of incubation (8, 9). Clonal rat osteosarcoma-derived osteoblast-like ROS 17/2.8 cultures (obtained from Dr. Gideon Rodan; Merck Sharp and Dohme Research Laboratories, West Point, PA) and first passage skin fibroblasts from rat fetuses used to isolate bone cells were cultured and treated by similar procedures (4).

Plasmids

Constructs pEN1.0, pEXH0.9, pSN0.8, pAN0.4, pAX0.2, pAS0.2, pXN0.1, and pSN0.1 containing fragments of the rat TGF-beta RI promoter cloned upstream of the reporter gene luciferase were described previously (5). Since its publication, we noted several sequence compressions in the CpG island when we confirmed oligonucleotide sequences for nuclear factor binding studies. A corrected sequence for accession number U48401 has been submitted to GenBank. To produce the deletion mutant pSX3, an oligonucleotide primer (pMR2) corresponding to nucleotides -240 to -221 of the rat TGF-beta RI promoter was prepared to include an XhoI site (underlined) (5'-CCTGGCGGAGCTCGAGCGGCCCTGGACTTCTGC-3'). Twenty-five PCR cycles were performed at 94 °C for 30 s (denaturation), 58 °C for 1 min (annealing), and 72 °C for 2 min (extension) with pMR2, reverse Sp6 sequencing primer (5'-GATTTAGGTGACACTATAG-3'), pGEM-ES1.1 (comprising 1.1 kb of TGF-beta RI promoter sequence; Ref. 5) as template, all four dNTPs, and 1 unit of Taq DNA polymerase (Boehringer Mannheim). The 0.73-kb PCR product was gel-purified (Qiagen), and the fragment released with XhoI and SacI was used to replace the corresponding wild type sequence within pSN0.8. Other mutation and deletion constructs were prepared by analogous PCR procedures. Constructs pCAATµ1, with a mutation in the forward CCAAT box at nucleotides -124 to -120, and pAN0.4µ2, incorporating the substitutions in probe XN2µ2 as shown in Fig. 9, were prepared with pAN0.4 DNA as template. Insert for pCAATµ1 was produced with forward RVprimer3 (5'-CTAGCAAAATAGGCTGTCCC-3'), corresponding to vector DNA upstream of polylinker, and reverse primer PMR1 [5'-TAACTGCTCGAGGGGCGCACGAAGCTTCTGCCCGGCCTCC-3'), corresponding to nucleotides -136 to -98 of the TGF-beta RI promoter, with XhoI site (underlined) and substitutions (double underlined) as shown in Fig. 4. The 0.25-kb product was released with SacI and XhoI and inserted into the corresponding region in wild type pAN0.4. Insert for pAN0.4µ2 was produced with forward primer (5'-AGCGAGGCCGCGGCGGCGGCGGGGACCTGGGGCGAGGAGA-3'), corresponding to nucleotides -86 to -47 with substitutions (double underlined) at nucleotides -60 to -61, and backward primer GLprimer2 [5'-CTTTATGTTTTTGGCGTCTTCCA-3'], corresponding to vector DNA downstream of the polylinker NcoI site. The 0.14-kb product was digested with SacII and NcoI (see Fig. 4), and the 54-bp downstream fragment was inserted into the corresponding region in wild type pAN0.4. Constructs pCAAT2 (wild type) and pCAATµ2 (with a 3-base pair substitution in the backward CCAAT box at nucleotides -216 to -220) were prepared with TGF-beta RI promoter DNA from nucleotides -700 to -203, obtained by digestion with SacI and ApaI, and cloned into pBluescript II KS as template. Insert for pCAAT2 was produced with a forward primer that added a downstream SacI site (underlined) at the 5' end, immediately upstream of promoter DNA nucleotides -238 to -217 (5'-CGGGAGCTCAGAAGTCCAGGGCCGCTCATTG-3'), and backward primer T3 (5'-ATTAACCCTCACTAAAG-3'), corresponding to vector DNA. Insert for pCAATµ2 was produced with a similar forward primer, also including a 3-base substitution in the CCAAT motif (double underlined) plus 9 bases at the 3' end (5'-CGGGAGCTCAGAAGTCCAGGGCCGCTCGAGGGCCGCCCAG-3') and backward primer T3. The products were digested with SacI and ApaI and inserted into pSN0.8 (5) previously digested with the same restriction enzymes. Plasmid constructs were purified with the Wizard Maxiprep Kit (Promega). DNA of all constructs was verified by sequencing.


Fig. 9. Localization of an essential Sp1 binding domain in region XN2 of the rat TGF-beta RI promoter. A, nuclear protein (5 µg) from osteoblast-enriched cultures was combined with 32P-labeled oligonucleotides XN2, XN2µ1, XN2µ2, or XN2µ3. Oligonucleotide sequences are shown in Table I, and positions are shown in Fig. 2. Protein-DNA complexes were resolved on 5% nondenaturing polyacrylamide gels and visualized by autoradiography. B, pGL3-Basic (vector), pAN0.4, or pAN0.4µ2, containing the substitutions found in XN2µ2, were assessed for reporter gene expression in fetal rat-derived osteoblast-enriched cultures. Data are shown as relative luciferase activity, corrected for protein content. Data are results from three separate studies with nine replicate cultures per condition. By analysis of variance, only pAN0.4 was significantly different from pGL3 basic.
[View Larger Version of this Image (36K GIF file)]


Fig. 4. Effects of CCAAT boxes within the rat TGF-beta RI promoter on reporter gene expression. Wild type sequences contained in constructs pAN0.4 and pCAAT2 and the substitutions introduced into pCAATµ1 and pCAATµ2 are shown on the left. Arrows indicate the positions and orientation of each CCAAT box sequence. Plasmid constructs were inserted upstream of the reporter gene luciferase and transfected into less differentiated periosteal cells and osteoblast-enriched cell cultures from fetal rat bone. Data are shown as relative luciferase activity, corrected for protein content, and are results from three separate studies and nine replicate cultures per condition. By Student's t test, there was no significant difference between constructs with wild type and modified sequences.
[View Larger Version of this Image (19K GIF file)]

Transfections

Cultures at 50-60% confluence were rinsed in serum-free medium and exposed to 1-1.5 µg of plasmid construct per 4.5 cm2 culture with 0.5% LipofectinTM (Life Technologies, Inc.) for 3 h. Cells were re-fed medium supplemented with 5% fetal bovine serum and cultured 48-72 h to reach confluence. Cultures were rinsed with phosphate-buffered saline and extracted with cell lysis buffer (Promega). Nuclei were cleared by centrifugation at 12,000 × g for 5 min. A commercial kit was used to measure luciferase activity (Promega) in supernatants and corrected for protein by the Bradford method (10).

Nuclear Extracts

Cultures were rinsed with phosphate-buffered saline containing the phosphatase inhibitors sodium orthovanadate (1 mM) and sodium fluoride (10 mM) on ice. Cells were scraped into the buffer and collected by centrifugation. Nuclear extracts were prepared by the method of Lee et al. (11, 12) with minor modifications. Briefly, cells were lysed in hypotonic buffer (10 mM HEPES (pH 7.4), 1.5 mM MgCl2, 10 mM KCl, 0.5 mM dithiothreitol) supplemented with phosphatase inhibitors, protease inhibitors, phenylmethylsulfonyl fluoride (0.5 mM), pepstatin A (1 µg/ml), leupeptin (2 µg/ml), and aprotinin (2 µg/ml), and 1% Triton X-100. Nuclei were pelleted and resuspended in hypertonic buffer containing 0.42 M NaCl, 0.2 mM Na2EDTA, 25% glycerol, and the phosphatase and protease inhibitors described above. Soluble proteins released by 30-min incubations on ice were collected by centrifugation at 12,000 × g for 5 min, and the supernatant was aliquoted, and corrected for protein content (10), and stored at -75 °C.

Electrophoretic Mobility Shift Assays

Double-stranded oligonucleotide probes were annealed by heating to 95 °C and cooling to 25 °C in 10 mM Tris-Cl (pH 8.0), 1 mM EDTA, 5 mM MgCl2 over a period of 1 h. Probes were end-labeled to 1-3 × 105 cpm/ng DNA with [alpha -32P]dCTP and Klenow fragment of Escherichia coli DNA polymerase I at 25 °C for 25 min and gel-purified. Nuclear extracts (5-7 µg protein) were incubated in binding buffer (25 mM HEPES (pH 7.5), 80 mM KCl, 2 mM dithiothreitol, 0.5 mg/ml bovine serum albumin, 12.5% glycerol) containing 62.5 µg/ml of poly(dI/dC) (Sigma) on ice for 10 min, and then supplemented with 3 × 104 cpm (0.1-0.2 ng) of 32P-labeled oligonucleotide probe for 30 min in a total volume of 20 µl. In competitive binding studies, unlabeled native or mutated oligonucleotides were added just before 32P-labeled probe. Probes used in this study are shown in Table I and Fig. 9. To assess transcription factor immunologically in gel shift analyses, 0.1-1.0 µg of rabbit polyclonal anti-Sp1 or anti-Sp3 antibody or rabbit IgG (Santa Cruz) was incubated with nuclear extract in binding buffer on ice for 60 min before adding 32P-labeled probe. Nuclear protein-DNA complexes were resolved on 5% nondenaturing polyacrylamide gels in 0.5 × TBE buffer (90 mM Tris borate (pH 8.3), 2 mM EDTA) by electrophoresis for 2.5 h at 20 °C with 130 V. Gels were dried and analyzed by autoradiography.

Table I. Oligonucleotides used in gel electrophoretic mobility shift assays

Positions of oligonucleotides are by reference to rat TGF-beta RI promoter sequence (5). Shift refers to slower migration through polyacrylamide gel: +, presence; -, absence. Factor refers to gel shift complexes identified with transcription factor specific antisera. Nucleotide substitutions in µXN1 that differ from the wild type sequence of region XN1 the rat TGF-beta RI promoter are shown in boldface and underlined.

Designation 5'-sequence-3' Position Shift Factor

SA1 GTGCGGAGGCGTGGTTAGAG  -260 to -241 + Sp1
SX1 CGCTCATTGGCCGCCCAGGGCCCGAGGGCGGGG  -225 to -193  -
AX5 AGGGCCCGAGGGCGGGGCTCTCCGCTGGGTCCCTCTAGGGCGCT  -209 to -166 + Sp1
AX2 CGGGCGGCGGGGGAGGCGGGGTC  -163 to -141 + Sp1
AX6 GGCGGGAGCCGGGCAGCCAATGCGTGCGCC  -140 to -111  -
AX3 CGGGCAGCCAATGCGTGCGCC  -131 to -111  -
XN1 TCGAGCAGTTACAAAGGGCCGGAGCGAGGCCGCGGCGG  -108 to -71 + Sp1, PEBP2/CBFalpha
µXN1 TCGAGCAGTTACAAAGGGCCGGAGCGAATTCGCGGCGG  -108 to -71 + Sp1
SXN1.2 GCCGGAGCGAGGCCGCGGCGGCGGCGGGGAGGTG  -91  to -58 + PEBP2/CBFalpha
XN2 CGGCGGGGAGGTGGGGCGAGGAGAG  -70  to -46 + Sp1
XN3 GAGGCGAGGCTTGTTGAGGAGAAGCTGAG  -48  to -20  -
SP1 ATTCGATCGGGCGGGGCGAGC none + Sp1
PEBP2/CBF GCTATTAACCACAATACTCG none + PEBP2/CBFalpha

Immunoblots

Forty µg of nuclear protein was fractionated by electrophoresis through an 8% denaturing polyacrylamide gel (12). Proteins were blotted from the gels onto Immobilon P membranes (Millipore) by electrophoresis (Ideal Scientific Company, Inc.). Membranes were washed in TBST buffer (10 mM Tris-Cl (pH 8.0), 150 mM NaCl, 0.05% Tween 20), and blocked in 5% defatted milk dissolved in TBST. Blots were incubated with 1:2000 dilution of anti-Sp1 antibody (Santa Cruz) for 1 h, washed, incubated with a 1:3000 dilution of goat anti-rabbit IgG conjugated to horseradish peroxidase (Bio-Rad), washed in TBST, incubated with enhanced chemiluminescence (Amersham Corp.) reagents, and exposed to x-ray film.

Statistical Analysis

Data were analyzed in multiple samples after multiple determinations and where appropriate are expressed as means ± S.E. In experiments comparing more than one variable or group, statistical differences were assessed by analysis of variance with limits set by Dunnet. In experiments where a single group was compared with control, analysis defaulted to Student's t test. Comparisons were performed with a commercial statistical software package (SigmaStat®). Differences among groups were considered significant when p values were <0.05.


RESULTS

Multiple Sp1 Binding Sites within Active Elements of the TGF-beta RI Promoter

By sequence analysis, many transcription factor binding sites occur within a CpG island at the 3'-terminal 300-bp region of the rat TGF-beta RI promoter. Consistent with other similarly organized promoters, transcription initiates at several sites within a ~200-bp span immediately upstream of exon 1 (5). There are seven consensus Sp1 binding sites, including three GC boxes, and at least nine other potential Sp1 binding sites with 80-90% sequence homology to consensus GC boxes within the 0.9-kb region upstream of the initiator methionine codon at position +22 to +25 (Ref. 5; see Table II). As shown in Fig. 1, deleting various spans that include Sp1 binding sites from the maximally active 1.0-kb region termed EN (flanked by EcoRI and NcoI restriction sites) significantly limited reporter expression. As in earlier studies, pSN0.7, pAN0.4, pXN0.1, and pSN0.1, derived from pEN1.0 by truncation from the 5' end, caused incremental decreases in reporter gene expression. However, even the short fragments contained in pXN0.1 and pSN0.1 maintained a low but significant level of promoter activity by comparison to the promoter-less pGL3-Basic vector. Deletions from the 3' end (pEXH0.8, pAX0.2, and pAS0.2) also limited reporter expression. With pAX0.2 and pAS0.2, reporter gene expression was consistently below the activity driven by pGL3-Basic. These findings indicated that sequences in region XN (flanked by XhoI and NcoI restriction sites) in the TGF-beta RI promoter are essential for basal promoter function, although other sequences upstream of the XhoI site appear necessary for maximal promoter activity. Many cis-acting Sp1 binding elements occur within regions EN, AN (flanked by ApaI and NcoI restriction sites), and XN of the promoter (see Fig. 1 and Table II). Region AX (flanked by ApaI and XhoI restriction sites) contains four consensus Sp1 binding sites, including one GC box. When the Sp1 binding sites in this region were deleted internally in construct pSX3, promoter activity was severely limited. Therefore, sequences encompassing various Sp1 sites appear to be important components of the TGF-beta RI promoter, and several may be required for maximal activity.

Table II. Locations of GC boxes, Sp1 binding sites, and potential Sp1 binding sites in the rat TGF-beta RI promoter sequence

Positions of oligonucleotides are by reference to rat TGF-beta RI promoter sequence (5). Nucleotides that differ from various DNA binding sequences previously defined as consensus GC boxes ((G/T)(G/A)GG(C/A)G(G/T)(G/A)(G/A)(C/T)) or Sp1 binding sites (GGGCGG) are in boldface and underlined.

5'-Sequence-3' Position Homology to GC box/Sp1 sites

%
GGGGCGAAGC  -838 to -848 90
GCGGCGGGGA  -767 to -758 80
GAGGCGGAGC  -694 to -703 100 (GC box)
GGGCGG  -631 to -626 100 (Sp1 site)
GGGGCAGGGT  -344 to -353 90
GAGGCGTGGT  -255 to -246 100 (GC box)
GGGCGG  -210 to -215 100 (Sp1 site)
GGGCGG  -200 to -195 100 (Sp1 site)
GGGCGG  -162 to -157 100 (Sp1 site)
GAGGCGGGGT  -151 to -142 100 (GC box)
TCGGCGGGAG  -142 to -133 80
GGGCCGGAGC  -93  to -84 90
GCGGCGGGGA  -71  to -62 80
GGGGAGGTGG  -66  to -57 80
GAGGTGGGGC  -63  to -54 90
GGGGCGAGGA  -58  to -49 80


Fig. 1. Cooperative effect among Sp1 binding sites in the rat TGF-beta RI promoter. A, positions of various restriction endonuclease cleavage sites used to generate fragments of the rat TGF-beta promoter. B, putative nuclear factor binding sites identified by sequence analysis. The black arrow at position +1 indicates the most downstream transcription initiation site (5). C, DNA encoding the portions of the TGF-beta RI promoter indicated by gray bars was ligated upstream of the reporter gene luciferase in transfection vector pGL3-Basic and co-transfected with a reporter construct encoding beta -galactosidase (5) in primary osteoblast-enriched cultures from fetal rat bone. Data are shown as relative luciferase activity (by comparison to pGL3-Basic vector), corrected for protein content. beta -Galactosidase activity never varied by more than 6% (S.E.) within an experiment. Data are results from 2 to 14 separate overlapping studies with 6-44 replicate cultures per condition. By analysis of variance, all other constructs are significantly lower in activity than pEN1.0.
[View Larger Version of this Image (25K GIF file)]

Two CCAAT Boxes in the Rat TGF-beta RI Promoter Are Inactive in Bone Cells

Because promoter construct pAN0.4 maintains strong activity, we used oligonucleotide probes spanning each of the several clusters of cis-acting elements in this area in electrophoretic mobility shift assays. As shown in Fig. 2 and Table I, probes SA1, SX1, AX2, AX3, AX5, and AX6 possess several putative Sp1 binding sites. While most growth factor receptor gene promoters so far identified lack TATA and CCAAT boxes, two CCAAT boxes occur in this GC-rich region of the TGF-beta RI promoter. One is at -216 to -220 in the backward orientation within SX1, and the other is at -124 to -120 in the forward orientation within AX3. When oligonucleotide probes were 32P-labeled and combined with nuclear extract from primary osteoblast-enriched bone cell cultures, no DNA-protein complexes occurred with probes SX1 or AX3 (Fig. 3A). Probe AX6, encompassing but slightly larger than AX3, was also examined with nuclear extract from these cells, from dermal fibroblasts, from undifferentiated periosteal bone cells, and from the highly differentiated osteosarcoma-derived osteoblast-like cell line, ROS17/2.8. Analogous to results with 32P-AX3, 32P-AX6 never bound nuclear factor from osteoblast-enriched cultures (Fig. 3B) or any other cell type examined so far (data not shown). PCR primers with substitutions in the CCAAT box regions were used to create mutated reporter plasmid constructs. As shown in Fig. 4, pCAATµ1 (with alterations in the forward CCAAT box) and pCAATµ2 (with alterations in the backward CCAAT box) each promoted reporter gene expression equivalent to the parental constructs. Although less overall TGF-beta RI promoter activity occurs with undifferentiated bone cells (5), similar results occurred in these cells and the osteoblast-enriched bone cell cultures transfected with pCAATµ1. Consequently, neither CCAAT box motif binds nuclear factor nor are they essential for basal promoter activity in bone cells.


Fig. 2. Nuclear factor binding sites and positions of oligonucleotides used for gel migration analysis of the rat TGF-beta RI promoter. Restriction endonuclease cleavage sites and transcription factor binding sites are as described in Fig. 1. Positions of oligonucleotide used for nuclear factor binding studies are designated from below. Open bars indicate no detectable binding by nuclear factor from rat osteoblast-enriched cultures, black bars indicate predominantly Sp1 binding, light gray bars (SXN1 and SXN1.2) indicate PEBP2/CBFalpha binding, and the dark gray bar (XN1) indicates Sp1 and PEBP2/CBFalpha binding.
[View Larger Version of this Image (17K GIF file)]


Fig. 3. Nuclear factor binding in the -0.26- to -0.1-kb region of the rat TGF-beta RI promoter. A, nuclear protein (7 µg) derived from less differentiated periosteal bone cells (PERIOS), osteoblast-enriched cultures (OB), fetal rat dermal fibroblasts (RDF), and ROS 17/2.8 cultures (ROS) was combined with 32P-AX5, 32P-SX1, or 32P-AX3 as indicated. B, nuclear protein (7 µg) from fetal rat osteoblast-enriched cultures was combined with 32P-labeled oligonucleotides SA1, SX1, AX5, AX2, AX6, AX3, or SP1, without or with 50-fold molar excess of unlabeled SP1 as indicated. Oligonucleotide sequences are shown in Table I and positions are shown in Fig. 2. Protein-DNA complexes were resolved on 5% nondenaturing polyacrylamide gels and visualized by autoradiography.
[View Larger Version of this Image (60K GIF file)]

Functional Sp1 Binding Sites in the TGF-beta RI Promoter

Primary osteoblast-enriched cell cultures are derived from normal tissue and appear to be controlled in appropriate physiological ways. Because they express high levels of TGF-beta RI mRNA, protein, and promoter activity (4, 5, 7, 9), and protein that associates with Sp1 binding sites, many subsequent studies were performed with extracts from this culture model. Probes SA1, AX2, and AX5 all formed slowly migrating radiolabeled complexes identical to those with 32P-SP1, containing a consensus Sp1 binding site, and were effectively reduced by unlabeled consensus oligonucleotide SP1 (Fig. 3B). With oligonucleotide AX5 as a representative site to characterize Sp1 binding further, a portion of band S1 supershifted to an even more slowly migrating complex with anti-Sp1 antiserum, while the remainder of band S1 and all of band S2 were insensitive to any amount of anti-Sp1 antiserum that we examined (see below). Parallel results occurred with 32P-labeled oligonucleotide probes SA1, AX2, AX5, and SP1 (data not shown). Since unlabeled oligonucleotide SP1 displaced bands S1 and S2 completely, inefficient binding by anti-Sp1 antibody may account in part for this difference. Alternatively, other Sp1-like nuclear proteins might also bind these probes. Two Sp1 family members, Sp2 and Sp3, bind analogous DNA elements with similar affinities (13). Sp3 is comparable in Mr to Sp1 and could account for complexes in bands S1 and S2 that are resistant to anti-Sp1 antibody. Addition of 0.1 or 1 µg of anti-Sp1 antibody each supershifted band S1 to a similar extent, and 0.1 or 1.0 µg of anti-Sp3 antibody depleted band S2 and in part band S1. Simultaneous use of both antibodies eliminated nearly all 32P-probe from bands S1 and S2. The more obvious effect at band S1 with both antibodies suggests that loss of Sp3 (band S2) when only anti-Sp3 antibody is used may make more 32P-probe available for binding by Sp1. No gel shift, supershift, or depletion occurred with normal rabbit IgG (Fig. 5). Band S1 therefore appears to contain Sp1 (by supershift) and Sp3 (by antibody depletion), whereas band S2 contains predominantly Sp3. The fractional amount of nucleotide binding to Sp1 and Sp3 was similar with each 32P-labeled probe examined. Partitioning of Sp1 and Sp3 in these ways has been noted previously (14-17) and may relate in part to multiple Sp3 isoforms arising from differential initiation codon utilization.4


Fig. 5. Binding of Sp1 and Sp3 to rat TGF-beta RI promoter DNA. Nuclear protein (5 µg) from fetal rat osteoblast-enriched cultures was incubated for 1 h on ice with antibody or control solutions and then incubated for 30 min with 32P-AX5 plus no addition (-), 0.1 or 1 µg of anti-Sp1 or anti-Sp3 IgG, or 1 µg of nonimmune rabbit IgG, as indicated. Oligonucleotide sequences are shown in Table I, and positions are shown in Fig. 2. Protein-DNA complexes were analyzed by 5% native polyacrylamide gel electrophoresis and autoradiography. S1 and S2 refer to complexes that are distinguished by anti-Sp1 and anti-Sp3 specific IgGs.
[View Larger Version of this Image (63K GIF file)]

Binding to Sp1-like sites occurred with oligonucleotide probes XN1 (from -108 to -71) and XN2 (from -70 to -46) of region XN and nuclear extract from osteoblast-enriched cultures (Fig. 6A). 32P-XN2 formed nuclear factor complexes similar to those with probes SA1, AX2, AX5, or SP1, whereas binding to 32P-XN1 occurred in several complexes. As shown in Fig. 6B, after a longer exposure to film, band S1, while minimal, was detected with 32P-XN1, was specifically reduced by excess unlabeled probe SP1 (Fig. 6B), and supershifted with anti-Sp1 antibody (data not shown). Band S2 was not detected with 32P-XN1, consistent with the faint binding in band S1 that normally accounts for the majority of nuclear factor binding by Sp1-like sites. Also, unlabeled SXN1.2 in which the Sp1 binding site was eliminated did not reduce 32P-XN1 in band S1 (Fig. 6B). No nuclear factor complexes formed with 32P-XN3.


Fig. 6. Nuclear factor binding to regions downstream of -0.1 kb in the rat TGF-beta RI promoter. A, nuclear protein (7 µg) from fetal rat osteoblast-enriched cultures was combined with oligonucleotides 32P-oligonucleotides XN1, XN2, or XN3 from the TGF-beta RI promoter. B, nuclear protein was combined with 32P-XN1 and the following additions: no addition (-); 100-fold molar excess unlabeled oligonucleotides XN1, µXN1, SXN1.2, PEBP2/CBF, or SP1 as indicated. Oligonucleotide sequences are shown in Table I and positions are shown in Fig. 2. Protein-DNA complexes were resolved on 5% nondenaturing polyacrylamide gels and visualized by autoradiography. S1 and S2 refer to a complexes reactive with anti-Sp1-specific IgG, C refers to a complex consistent with binding to PEBP2/CBFalpha transcription factor(s), and U refers to complexes containing presently uncharacterized nuclear protein.
[View Larger Version of this Image (65K GIF file)]

The various Sp1 sites in regions SA, AX, and XN were also compared by competitive binding studies where 25- and 50-fold excess unlabeled oligonucleotides inhibited nuclear factor binding to 32P-SP1 to different extents. Consistent with direct binding studies (Fig. 3), oligonucleotides SA1, AX5, and XN2 competed with very high affinity, and SX1 and XN1 did not. Because the same Sp1 sites occur in SX1 and AX5, upstream sequences may restrict Sp1 binding to this region in some instances. Probe AX2, which contains both an Sp1 binding site and a GC box, inhibited Sp1 binding to 32P-SP1 less efficiently than SA1, AX5, and XN2 (Fig. 7). Although AX2 clearly binds Sp1 (Fig. 3), the proximity of the two Sp1 sites or flanking sequences may cause less avid binding to Sp1 than other sequence configurations. Analogous to the low to negligible amounts of Sp1 binding to 32P-XN1 and 32P-XN3 seen in Fig. 6, oligonucleotide XN1 inhibited 32P-SP1 binding only weakly (Fig. 7), and XN3 had no effect (data not shown).


Fig. 7. Relative affinities for Sp1 in various regions of the rat TGF-beta RI promoter. Nuclear protein (5 µg) from osteoblast-enriched cultures was combined with 32P-SP1 oligonucleotide and no addition (none), or with 25- or 50-fold molar excess (xs) of unlabeled oligonucleotides SP1, SA1, SX1, AX5, AX2, XN1, or XN2, as indicated. Oligonucleotide sequences are shown in Table I and positions are shown in Fig. 2. Protein-DNA complexes were resolved on 5% nondenaturing polyacrylamide gels and visualized by autoradiography.
[View Larger Version of this Image (58K GIF file)]

Oligonucleotide XN2 contains four potential, overlapping Sp1 binding sites (designated as Sp1 binding domains 2 to 5 in Fig. 8) and effectively competed with 32P-SP1. Because Sp1-related complexes were not competed by and did not form with oligonucleotide SXN1.2 (Fig. 6B, and other data not shown), binding domains 2 and 3 in oligonucleotide XN2 are unlikely to be active, whereas domain 4 may require more 3' sequence. To assess whether domain 4 or 5 or both are functional, probes XN2µ1, XN2µ2, and XN2µ3, derived from XN2 by specific nucleotide substitutions shown in Fig. 8, were examined. Although small decreases in binding occurred with XN2µ1 and XN2µ3, only XN2µ2 could not form nuclear factor complex (Fig. 9A), indicating site 4 as the most active site in XN2. Consistent with this, when the nucleotide substitutions found in XN2µ2 were introduced into the reporter construct pAN0.4 to create pAN0.4µ2, reporter activity fell to the level of pGL3Basic (Fig. 9B), revealing that this specific Sp1 binding site is essential for basal gene expression from the TGF-beta RI promoter.


Fig. 8. Oligonucleotides used to localize Sp1 binding within region XN2 of the rat TGF-beta RI promoter. A, putative Sp1 binding domains are indicated by gray boxes. The PEBP2/CBF-alpha binding domain is indicated by the open box. B, the sequences and names designated for the oligonucleotide probes, their positions within the rat TGF-beta RI promoter, and the identity of transcription factors that associate with these oligonucleotides (see Fig. 9) are indicated. The nucleotide substitutions in XN2µ1, XN2µ2, and XN2µ3 that differ from parental XN2 are underlined.
[View Larger Version of this Image (25K GIF file)]

Ratios of Sp1 to Sp3 Do Not Change Significantly during Bone Cell Differentiation

TGF-beta RI is constitutively expressed in many tissues, although its level may vary with cell phenotype and differentiation status (1, 4). Using several fetal rat skin- and bone-derived cultures, we found consistent increases in the relative amounts of cell surface TGF-beta RI protein, mRNA, and promoter activity in parallel with expression of the osteoblast phenotype (4, 5). These variations could not be accounted for by the amounts of Sp1 or Sp3 in nuclear extracts from these cultures. In contrast to TGF-beta RI protein, mRNA and promoter activity profiles, Sp1 and Sp3, were more abundant in fetal rat fibroblasts and osteoblast-like ROS 17/2.8 osteosarcoma-derived cells relative to primary bone-derived cell cultures, by both gel mobility shift and immunoblot analyses (Figs. 3B and 10). Furthermore, the ratio of band S1 (containing Sp1 and Sp3) to band S2 (containing Sp3) was similar in each cell type when the nuclear extracts were assessed by gel mobility shift assay without or with anti-Sp1 antibody (Fig. 10A). Nuclear extracts from proliferating, differentiating, or mineralizing osteoblast-enriched cell cultures (18) also showed analogous ratios between bands S1 and S2 and isoform distribution patterns with anti-Sp1 and anti-Sp3 antisera, although at later stages of culturing the nuclear factor profiles became more complex (Fig. 11).


Fig. 10. Relative Sp1 levels in various fetal rat-derived cell cultures. A, nuclear protein (5 µg) derived from fetal rat dermal fibroblasts (RDF), less differentiated periosteal bone cells (PERIOS), osteoblast-enriched cultures (OB), and ROS 17/2.8 cultures (ROS) was combined with 32P-AX5 without (-) or with 0.5 µg anti-Sp1 IgG (+). When present, IgG was included for 1 h before the addition of 32P-AX5. Protein-DNA complexes were resolved on 5% nondenaturing polyacrylamide gels and visualized by autoradiography. Oligonucleotide sequences are shown in Table I, and positions are shown in Fig. 2. B, nuclear protein (30 µg) from RDF, PERIOS, OB, and ROS cultures was resolved on 8% SDS-polyacrylamide gel, transferred to membrane, and blotted with anti-Sp1 IgG. The immunoreactive 105- and 95-kDa Sp1 bands are indicated.
[View Larger Version of this Image (57K GIF file)]


Fig. 11. Distribution of Sp1 and Sp3 during osteoblast differentiation in vitro. A nuclear protein (5 µg) from proliferating (P), differentiating (D), and mineralizing (M) osteoblast-enriched cultures was combined with 32P-XN2 without (-) or with (+) 0.5 µg of anti-Sp1 or anti-Sp3 IgG, as indicated. When present, IgGs were included for 1 h before the addition of 32P-XN2. Oligonucleotide sequences are shown in Table I and positions are shown in Fig. 2. Protein-DNA complexes were resolved on 5% nondenaturing polyacrylamide gels and visualized by autoradiography. Identical binding ratios were obtained with other upstream Sp1 reactive oligonucleotide probes.
[View Larger Version of this Image (72K GIF file)]

Other Possible Transcription Factor Binding Sites in the TGF-beta RI Promoter

Sequence analysis also revealed other possible cis-acting elements within region AX. As described earlier, upstream oligonucleotides SA1, AX5, and AX2 bound nuclear protein from fetal rat bone cells and dermal fibroblasts essentially in complexes consistent with binding to Sp1 sites. Several possible cis-acting sequences reside downstream of these sites. Of these, a binding site for hepatocyte nuclear factor (HNF)-5 occurs downstream of nucleotide -21 and has not yet been investigated. No nuclear factor complexes formed with oligonucleotide XN3, which spans nucleotides -48 to -20 (Fig. 6A). In addition to the Sp1 binding sites in XN1 and XN2, XN1 contains a potential cis-acting element for transcription factors of the PEBP2/CBFalpha family (19-21). As shown in Fig. 6B, 32P-XN1 binding within complexes designated as band C was inhibited by unlabeled oligonucleotides XN1 (intact) and SXN1.2 (where the Sp1 binding site in XN1 was eliminated). Binding to band C was also reduced by a probe containing a PEBP2/CBFalpha consensus sequence (19), but not by µXN1, where the PEBP2/CBFalpha binding site in XN1 contained three nucleotide substitutions. Other complexes designated as band U also formed with 32P-XN1. They were essentially eliminated by unlabeled XN1 but varied slightly in intensity in the presence of the other site specific, truncated, or mutated XN1-derived probes that we tested. Formation of these complexes may in some instances depend on the presence of other nuclear factors. In other cases they may become more evident when other binding sites found in 32P-XN1 are eliminated and fewer nuclear factors are therefore competing for probe. We have not yet identified the proteins that elicit the U bands.


DISCUSSION

The rat TGF-beta RI promoter contains a variety of cis-acting elements that could contribute to constitutive or conditional expression. By transfecting reporter gene constructs into osteoblast-enriched cultures, we previously defined regions within the TGF-beta RI promoter that are associated with maximal and basal activity. To understand TGF-beta RI gene expression in more detail, we have now defined certain important transcription factor binding sites that may control basal promoter activity in many cells.

Similar to various growth factor receptor promoters, the TGF-beta RI promoter lacks TATA box sequence but contains a GC-enriched so-called CpG island (22, 23) with many transcription factor Sp1 binding sites. Analogous to the human TGF-beta RI promoter (6), CCAAT box-like sequences that occur in this region make them unlike promoters for many other growth factors or growth factor receptors (24-32). Nonetheless, oligonucleotides spanning the CCAAT box sites do not bind detectable levels of nuclear protein, and reporter gene expression was not reduced when these sites were disrupted. Therefore, flanking sequences or the association of other transcription elements in nearby areas may limit the contribution of the CCAAT boxes to TGF-beta RI expression under the conditions that we have examined so far.

Unlike genes controlled by CCAAT box and TATA box elements, rat TGF-beta RI mRNA transcription initiates from multiple locations, characteristic of a constitutively expressed gene controlled by an Sp1-dependent promoter (5, 33). Although deletions that included various Sp1 binding sites invariably limited TGF-beta RI promoter activity, some of these elements, clustered within a 0.3-kb sequence at the 3' end of the promoter, appeared more essential than others. By gel shift and immunodetection assays, we determined that these regions associated to equivalent extents with either Sp1 or with the closely related transcription factor Sp3, also present in the rat cell nuclear extracts that we examined. This result is consistent with the similar structural features, conservation of DNA binding domains, and similar abilities of both Sp1 family members factors to recognize specific cis-acting elements with identical affinities (13-17, 34, 35). Unlike Sp1, Sp3 may reduce Sp1-dependent gene expression (34). We detected two complexes reactive with antibody specific for Sp3 by gel shift analysis consistent with earlier reports (14-16). Furthermore, whereas TGF-beta RI and its mRNA levels vary by relation to other TGF-beta receptors on various bone- and skin-derived cells, we did not find changes in the amounts of Sp1 or the ratio of Sp1 to Sp3 that could account for those differences in the various cell types, or in osteoblast-enriched cultures at various stages of differentiation. Consequently, in the basal state, constitutively low levels of TGF-beta RI expression may be tempered by the presence of both Sp1 and Sp3.

In other situations the proportions of Sp1 and Sp3 may change, or other cellular proteins may modify their function. For example, Sp1 forms heteromeric complexes with several cellular proteins. p107, a member of the retinoblastoma family of proteins, binds Sp1 and represses Sp1-dependent transcription, whereas retinoblastoma itself has been reported to interact with Sp1 and Sp3. Furthermore, p107 and retinoblastoma may complex with E2F, with cyclins, and cyclin-dependent kinases. Sp1 also interacts with the RelA subunit of transcription factor NF-kappa B, and the cellular protein YY1 (36-40). Therefore, several conditions may arise that could account for variations in Sp1 activity, and its ability to drive TGF-beta RI gene expression during the cell cycle, in various cell lineages, or in cell phenotype development.

Overall, our studies support a crucial role for several sequences throughout the TGF-beta RI promoter that contain Sp1 binding sites. Deletion of 5' upstream sequences, reducing the promoter region to 0.7 kb, decreases its activity by 40-60%. Elimination of either another 0.4 kb from the 5' end or an internal downstream sequence further suppresses promoter function. However, elimination of 0.1 kb of sequence from the 3' end, a region that itself directs only moderate reporter gene expression, potently suppresses the activity of longer promoter fragments that still retain multiple Sp1 binding sites. Therefore, several regions can contribute to optimal TGF-beta RI gene expression, although sequence information within the 0.1-kb 3' span is essential for basal promoter activity. Using several overlapping oligonucleotides spanning this region, we located a specific sequence where substitution by two nucleotides completely eliminated Sp1 binding and suppressed reporter gene expression from a minimal promoter fragment. These results confirm the importance of multiple Sp1 sites throughout the TGF-beta RI promoter and establish that one downstream site at position -63 to -54, ~90% homologous to consensus Sp1 binding sites, contributes heavily to basal promoter activity. This finding is analogous results with the TGF-alpha promoter, where several related but nonconsensus Sp1 binding sites are also required for optimal promoter activity (41). It is difficult to compare our results directly with those for the human TGF-beta RI promoter. Even the longest construct used to assess the human promoter region reached upstream only as far as 0.7 kb and, most importantly, did not contain the 3' 109-bp sequence where we detect an essential Sp1 site (6). Thus, at least two regulatory sites, including the important downstream Sp1 binding site (numbered -80 to -71 in the human promoter), have not yet been assessed for their effect on gene expression driven by the human TGF-beta RI promoter.

Within the 3'-terminal 0.1-kb region of the TGF-beta RI promoter, we also found a related binding site for members of the PEBP2/CBFalpha transcription factor family. PEBP2/CBFalpha family members (also termed polyoma virus enhancer binding protein 2, or PEBP2alpha ; and acute myelogenous leukemia factors; Refs. 19-21) were previously identified in nuclear extracts from differentiated osteoblasts and found to have a critical role in the expression of the osteoblast-related protein, osteocalcin (18, 42, 43). Our studies with the TGF-beta RI have now identified a new target for PEBP2/CBFalpha activity beyond the virus-infected or immunological tissues where their identity was first established (19). The presence of a PEBP2/CBFalpha -related element in this downstream region of the TGF-beta RI promoter may account in part for the high level of TGF-beta RI mRNA and protein expression and promoter activity by differentiated osteoblasts (4), imposed upon the constitutive levels regulated by Sp1 and other basal elements. We are continuing to characterize this and several other even more potent PEBP2/CBFalpha binding sites further upstream (see Fig. 1) to identify the osteoblast-enriched PEBP2/CBFalpha family members that bind to these sequences and to examine variations in PEBP2/CBFalpha expression during osteoblast differentiation.2,3

In addition to the Sp1 and PEBP2/CBFalpha -related complexes, others designated as band U also form with an oligonucleotide from this important 3'-terminal control region. This sequence contains elements for two other transcriptional regulators, HNF-5 and heat shock protein 70 (Hsp70). By relative migration, the slower migrating band presently seems inconsistent with a complex containing the Mr of transcription factor HNF-5. It also seems unlikely to be accounted for by Hsp70 because of the basal growth conditions of our studies and the presence of another possible Hsp70 site in oligonucleotide SX1 that does not exhibit the same complex. However, it may represent a complex containing a basal transcription factor of the TFII family. TFII-related proteins are commonly involved in the expression of many genes transcribed by polymerase II, although the TGF-beta RI promoter lacks a TATA box where these agents customarily bind (5, 6). Nevertheless, our studies demonstrate that basal gene expression from the TGF-beta RI promoter relies heavily on several Sp1 binding sites. One of these cis-acting elements, which occurs far downstream, appears essential for optimal TGF-beta RI promoter activity. However, the effectiveness of these sites may be modified by other negative or positive transcription regulators whose expression may vary with cell phenotype or with other extracellular circumstances. These and other differences may account for changes in TGF-beta RI levels and therefore sensitivity to this important growth regulator during development, differentiation, or hormonal control in skeletal tissue (4, 44).


FOOTNOTES

*   This work was supported by National Institutes of Health Grants AR-39201 and DK-47421, by the Section of Plastic Surgery, and the Department of Surgery (Yale University). These studies were presented in part at the 18th Annual Meeting of the American Society for Bone and Mineral Research, Sept. 7-11, 1996, Seattle, WA.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Dagger    To whom correspondence should be addressed: Section of Plastic Surgery, Yale University School of Medicine, 333 Cedar St., P.O. Box 208041, New Haven, CT 06520-8041. Tel.: 203-785-4927; Fax: 203-785-5714; E-mail: CentrellMA{at}MASPO3.MAS.YALE.EDU.
1   The abbreviations used are: TGF, transforming growth factor; TGF-beta R, transforming growth factor beta  receptor; bp, base pair(s); kb, kilobase pair(s); PCR, polymerase chain reaction.
2   D. J. Chang, C. Ji, T. L. McCarthy, and M. Centrella, unpublished results.
3   C. Ji, D. J. Chang, T. L. McCarthy, and M. Centrella, unpublished results.
4   J. M. Horowitz, Duke University, personal communication.

REFERENCES

  1. Massague, J., Attisano, L., and Wrana, J. L. (1994) Trends Cell Biol. 4, 172-178 [CrossRef][Medline] [Order article via Infotrieve]
  2. Kingsley, D. M. (1994) Genes Dev. 8, 133-146 [Free Full Text]
  3. Carcamo, J., Zentella, A., and Massague, J. (1995) Mol. Cell. Biol. 15, 1573-1581 [Abstract]
  4. Centrella, M., Casinghino, S., Kim, J., Pham, T., Rosen, V., Wozney, J., and McCarthy, T. L. (1995) Mol. Cell. Biol. 15, 3273-3281 [Abstract]
  5. Ji, C., Casinghino, S., McCarthy, T. L., and Centrella, M. (1996) J. Cell. Biochem. 63, 478-490 [CrossRef][Medline] [Order article via Infotrieve]
  6. Bloom, B. B., Humphries, D. E., Kuang, P.-P., Fine, A., and Goldstein, R. H. (1996) Biochim. Biophys. Acta 1312, 243-248 [Medline] [Order article via Infotrieve]
  7. Centrella, M., McCarthy, T. L., and Canalis, E. (1991) Mol. Cell. Biol. 11, 4490-4496 [Abstract/Free Full Text]
  8. Lian, J. B., and Stein, G. S. (1993) J. Oral Implantol. 19, 95-105 [Medline] [Order article via Infotrieve]
  9. Centrella, M., Casinghino, S., Gundberg, C., McCarthy, T. L., Wozney, J., and Rosen, V. (1996) Ann. N. Y. Acad. Sci. 785, 224-226 [Medline] [Order article via Infotrieve]
  10. Bradford, M. M. (1976) Anal. Biochem. 72, 248-254 [CrossRef][Medline] [Order article via Infotrieve]
  11. Lee, K. A., Bindereif, A., and Green, M. R. (1988) Gene Anal. Tech. 5, 22-31 [CrossRef][Medline] [Order article via Infotrieve]
  12. Thomas, M. J., Umayahara, Y., Shu, H., Centrella, M., Rotwein, P., and McCarthy, T. L. (1996) J. Biol. Chem. 271, 21835-21841 [Abstract/Free Full Text]
  13. Hagen, G., Muller, S., Beato, M., and Suske, G. (1992) Nucleic Acids Res. 20, 5519-5525 [Abstract/Free Full Text]
  14. Dennig, J., Hagen, G., Beato, M., and Suske, G. (1995) J. Biol. Chem. 270, 12737-12744 [Abstract/Free Full Text]
  15. Majello, B., DeLuca, P., Suske, G., and Lania, L. (1995) Oncogene 10, 1841-1848 [Medline] [Order article via Infotrieve]
  16. Daniel, S., and Kim, K.-H. (1996) J. Biol. Chem. 271, 1385-1392 [Abstract/Free Full Text]
  17. Sjottem, E., Anderssen, S., and Johansen, T. (1996) J. Virol. 70, 188-198 [Abstract]
  18. Banerjee, C., Hiebert, S. W., Stein, J. L., Lian, J. B., and Stein, G. S. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 4968-4973 [Abstract/Free Full Text]
  19. Ito, Y. (1996) J. Cancer Res. Clin. Oncol. 122, 266-274 [CrossRef][Medline] [Order article via Infotrieve]
  20. Hiebert, S. W., Downing, J. R., Lenny, N., and Meyers, S. (1996) Curr. Top. Microbiol. Immunol. 221, 253-258
  21. Wang, S., and Speck, N. (1992) Mol. Cell. Biol. 12, 89-102 [Abstract/Free Full Text]
  22. Gardiner-Garden, M., and Frommer, M. (1987) J. Mol. Biol. 196, 261-282 [CrossRef][Medline] [Order article via Infotrieve]
  23. Tazi, J., and Bird, A. (1990) Cell 60, 909-920 [CrossRef][Medline] [Order article via Infotrieve]
  24. Ishii, S., Xu, Y.-H., Stratton, R. H., Roe, B. A., Merlino, G. T., and Pastan, I. (1985) Proc. Natl. Acad. Sci. U. S. A. 82, 4920-4924 [Abstract/Free Full Text]
  25. Araki, E., Shimada, F., Uzawa, H., Mori, M., and Ebina, Y. (1987) J. Biol. Chem. 262, 16186-16191 [Abstract/Free Full Text]
  26. Sehgal, A., Patil, N., and Chao, M. (1988) Mol. Cell. Biol. 8, 3160-3167 [Abstract/Free Full Text]
  27. Cooke, D. W., Bankert, L. A., Roberts, C. T., Jr., LeRoith, B., and Casella, S. J. (1991) Biochem. Biophys. Res. Commun. 177, 1113-1120 [CrossRef][Medline] [Order article via Infotrieve]
  28. Saito, H., Kouhara, H., Kasayama, S., Kishimoto, T., and Sato, B. (1992) Biochem. Biophys. Res. Commun. 183, 688-693 [CrossRef][Medline] [Order article via Infotrieve]
  29. Pang, J.-H. S., Hung, R.-Y., Wu, C.-J., Fang, Y.-Y., and Chau, L.-Y. (1995) J. Biol. Chem. 270, 14123-14129 [Abstract/Free Full Text]
  30. Youussoufian, H., Zon, L. I., Orkin, S. H., D'Andrea, A. D., and Lodish, H. F. (1990) Mol. Cell. Biol. 10, 3675-3682 [Abstract/Free Full Text]
  31. Ye, K., Dinarello, C. A., and Clark, B. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 2295-2299 [Abstract/Free Full Text]
  32. Humphries, D. E., Bloom, B. B., Fine, A., and Goldstein, R. H. (1994) Biochem. Biophys. Res. Commun. 203, 1020-1027 [CrossRef]