|
|
|
|||||||
|
|||||||||
(Received for publication, May 2, 1997, and in revised form, June 5, 1997)
From the ABSTRACT Interleukin-5 (IL-5), which is produced by
CD4+ T helper 2 (Th2) cells, but not by Th1
cells, plays a key role in the development of eosinophilia in asthma.
Despite increasing evidence that the outcome of many diseases is
determined by the ratio of the two subsets of CD4+ T helper
cells, Th1 and Th2, the molecular basis for Th1- and Th2-specific gene
expression remains to be elucidated. We previously established a
critical role for the transcription factor GATA-3 in IL-5 promoter
activation in EL-4 cells, which express both Th1- and Th2-type
cytokines. Our studies reported here demonstrate that GATA-3 is
critical for expression of the IL-5 gene in bona fide Th2
cells. Whereas mutations in the GATA-3 site abolished antigen- or
cAMP-stimulated IL-5 promoter activation in Th2 cells, ectopic
expression of GATA-3 in Th1 cells or in a non-lymphoid, non-IL-5-producing cell line activated the IL-5 promoter. During the
differentiation of naive CD4+ T cells isolated from T cell
receptor transgenic mice, GATA-3 gene expression was
up-regulated in developing Th2 cells, but was down-regulated in Th1
cells, and antigen- or cAMP-activated Th2 cells (but not Th1 cells)
expressed the GATA-3 protein. Thus, GATA-3 may play an important role
in the balance between Th1 and Th2 subsets in immune responses.
Inhibition of GATA-3 activity has therapeutic potential in the
treatment of asthma and other hypereosinophilic diseases.
INTRODUCTION Activated CD4+ T cells are subdivided into two
subsets, T helper 1 (Th1) and Th2, based on their biological functions,
which, in turn, depend on the cytokines they produce (1-4). Th1 cells produce interleukin-2 (IL-2)1
and interferon- Asthma is a chronic obstructive disease of the small airways. Evolving
evidence indicates that asthma is the result of an inflammatory process
interacting with a susceptible airway best defined at present as airway
hyperresponsiveness (9). In asthma, the most striking and consistent
pathophysiology is damage to the bronchial epithelium caused by
cytotoxic cationic proteins released by infiltrating eosinophils (10,
11). Various lines of evidence indicate that secreted products of
activated T cells, such as the cytokine IL-5, play a central role in
orchestrating the unique inflammatory response seen in asthma. Since it
was isolated and cloned in the mid-1980s, the intimate relationship between IL-5, eosinophils, and asthma has been extensively documented (12).
IL-5 has multiple effects on the biology of eosinophils not limited to
differentiation, proliferation, recruitment, and activation (12).
Increasing evidence places IL-5 in a key role in the development of
eosinophilia in asthma (5, 6). IL-5 mRNA was significantly enhanced
in bronchoalveolar lavage cells obtained from asthmatics challenged
with ragweed antigen (8). Again, peripheral blood T cells from
asthmatics were found to secrete IL-5 in response to the common house
dust mite (Dermatophagoides farinae) antigen (13). Most
striking, in ovalbumin-sensitized guinea pigs and mice, monoclonal
antibody to IL-5 decreased pulmonary eosinophilia and prevented the
development of airway hyperresponsiveness (14, 15). Also, in a mouse
model of asthma, IL-5-deficient mice were found to lack eosinophilia,
lung pathology (16, 17), and airway hyperresponsiveness upon allergen
challenge (16).
In both humans and mice, the production of IL-5 is restricted to a few
cell types, which include T cells (7), mast cells (18), and eosinophils
(19), the predominant source being T cells of the Th2-type (7). In
general, IL-5 is not produced constitutively by Th2 cells. IL-5 gene
expression has been shown to be stimulated by antigen, mitogens
(concanavalin A), eicosanoid compounds (leukotriene B4 and
prostaglandins), and cytokines (20, 21). Intracellular cAMP-increasing
agents, such as IL-1 The molecular mechanisms underlying Th2 cell-specific IL-5 gene
expression are unclear. In our previous studies of IL-5 promoter activation by cAMP in the murine cell line EL-4, which expresses both
Th2- and Th1-type cytokines, we showed that deletion of the IL-5
promoter to In this report, we show that the transcription factor GATA-3 is crucial
for IL-5 gene expression in bona fide Th2 cells and that
ectopic expression of GATA-3 alone results in IL-5 promoter activation
in a non-IL-5-producing cell line. We also show that GATA-3 activity is
present only in Th2 cells and is undetectable in Th1 cells. Inhibition
of GATA-3 activity may therefore be effective in the treatment of
asthma and other hypereosinophilic diseases.
EXPERIMENTAL PROCEDURES Both D10
and C19 clones were maintained in Click's medium
supplemented with 10% fetal bovine serum, 5 units/ml murine
recombinant IL-2 (Boehringer Mannheim), 50 µM
Total cellular RNA was
prepared by using Trizol (Life Technologies, Inc.) according to
the instructions of the manufacturer. 10 µg of total RNA from each
sample was fractionated on a formaldehyde-agarose gel and transferred
to a nylon membrane. DNA fragments derived from murine
GATA-3 cDNA (~60-bp BglI-ClaI
fragment not containing any part of the zinc finger domain) were
labeled with [ Rested D10 or A.E7 cells were washed
once in serum-free RPMI 1640 medium and resuspended in the same medium.
Cells (5 × 106) were incubated with 15 µg of DNA (5 µg of reporter plasmid, 2 µg of cytomegalovirus- Cells were left
unstimulated or were stimulated as described above. All APCs were
mitomycin C-treated and depleted of T cells. Nuclear extracts were
prepared as described previously (25). The probes in the EMSAs were two
double-stranded oligonucleotides containing sequences between RESULTS We have used the established nontransformed murine T cell clones
D10.G4.1 (Th2) (31) and C19 (Th1) (32) and Th1 and Th2 cells obtained
by differentiation of naive CD4+ T cells from DO11.10 TCR
transgenic mice to gain insight into mechanisms that permit IL-5 gene
expression in Th2 cells but limit its expression in Th1 cells.
In our
previous studies of cAMP-induced IL-5 promoter activation using an
~550-bp promoter fragment and the murine T cell line EL-4, we had
identified two regions in the IL-5 5
We next investigated the binding
of nuclear proteins to the GATA element and the CLE0 element using
nuclear extracts from Th2 (D10) cells. As shown in Fig.
2A (lane 1), two
complexes were detected using nuclear extracts from unstimulated D10
cells. The binding intensity of both complexes was augmented upon
stimulation of the cells with Bt2cAMP + PMA (lane
2). Although both complexes were competed for by an excess of the
unlabeled wild-type oligonucleotide, competition for complex I
formation was incomplete even with a 100-fold molar excess of the
unlabeled competitor, suggesting that complex I binds with a lower
affinity to the GATA site than complex II (lane 3).
Oligonucleotides containing specific mutations in three different
regions of the double GATA site were also used as competitors. Mutant 1 contained mutations in the distal GATA sequence, and mutant 2 in the
proximal sequence, whereas mutant 3 was mutated in both sequences. None
of these mutants was able to compete for formation of the complexes,
suggesting the involvement of the entire sequence between
We then tested the same extracts for binding to the AP-1 site within
the CLE0 element. As shown in Fig. 2B, used at only half the
amounts used in the GATA-3 binding assays, robust inducible binding
activity was detected with both D10 and C19 nuclear extracts. The
anti-c-Jun and anti-c-Fos (reactive to all Fos family proteins) Abs did
not affect the formation of the complex with either extract (lanes 7 and 10, respectively), whereas the
anti-JunB and anti-JunD Abs supershifted/inhibited complex formation
(lanes 8 and 9, respectively). Taken together,
these results demonstrated that D10 and C19 cells contain similar
levels of AP-1 binding activity. However, D10 cells constitutively
contain some GATA-3 DNA binding activity that is augmented upon
stimulation of the cells. In contrast, unstimulated C19 cells contain
very little GATA-3 DNA binding activity that decreases upon stimulation
of the cells.
We investigated whether the observed difference in
GATA-3 binding activity between the Th1 (C19) and Th2 (D10) clones was also true in Th1 and Th2 cells obtained by differentiation of naive
splenic CD4+ T cells from DO11.10 TCR transgenic mice.
Nuclear extracts were prepared from the Th1 and Th2 cells stimulated
with Ag for 8 or 24 h, and GATA and AP-1 binding activities were
determined with the extracts. The Th1 cell extract from both time
points generated two complexes with the GATA probe (Fig.
3A, lanes 1-6),
whereas the Th2 extract generated three complexes (lanes
7-12). Complexes I and II were of the same mobility and
reactivity to antisera as complexes I and II illustrated in Fig. 2.
Complex II was not formed with the Th1 extract. A new complex (III),
specific for Ag stimulation and of mobility intermediate between
complexes I and II, was formed with both Th1 and Th2 extracts. Complex
III was more distinct with the 24-h extracts (Fig. 3A,
left panel, compare lane 4 with lane 1 and lane 10 with lane 7). Complex III, formed
with both the Th1 extracts (lanes 3 and 6) and
the Th2 extracts (lanes 9 and 12), was inhibited
by the anti-GATA-4 antiserum. However, the anti-GATA-3 Ab did not react
with any of the complexes formed with the Th1 extracts (lanes 2 and 5). By contrast, in our EMSAs with the Th2
extracts, complex I was slightly inhibited by the anti-GATA-3 Ab, and
complex II, only formed with Th2 nuclear proteins, was supershifted by
the anti-GATA-3 Ab (lanes 8 and 11). Essentially
identical data were obtained in EMSAs with nuclear extracts from
Ag-stimulated D10 and C19 cells (data not shown). We have also explored
GATA-3 binding activity in another Th1-type clone, A.E7 (35). No IL-5
mRNA was detected in Northern blot analyses of RNA prepared from
A.E7 cells that were stimulated for 24 h with Ag (data not shown).
Also, nuclear extracts prepared from Ag-induced A.E7 cells had no
detectable GATA-3 binding activity (data not shown). We do not know the
exact composition of the different complexes that are formed with Th2
nuclear extracts and the IL-5 GATA site. Complex II could represent a
higher order form (dimer or tetramer) of complex I that may contain a
monomer or dimer of GATA-3. The oligonucleotide competition experiments suggest that complex I binds to the GATA site with a lower affinity than complex II. Also, formation of complex II was consistently more
sensitive to the anti-GATA-3 antibody than formation of complex I,
suggesting that the epitope recognized by the anti-GATA-3 monoclonal antibody in the GATA-3 protein is more accessible in complex II. Taken
together, it appears that activated Th1 cells lack GATA-3 DNA binding
activity. The significance of the reactivity of complex III to the
anti-GATA-4 antiserum is unclear at the present time since the
expression of GATA-4 has only been described in the heart, intestines,
and gonads (28, 29).
We also investigated AP-1 binding activity with the extracts of both
cells. In both cases, a major complex (Fig. 3A, right panel, shown by an arrow) and a minor complex were
obtained. Nuclear extracts from Th1 cells that were stimulated for
8 h contained less AP-1 binding activity than extracts from
similarly treated Th2 cells (Fig. 3A, right
panel, compare lanes 1 and 7). However, the
AP-1 binding activities of the 24-h extracts from the two cell types
were equivalent (lanes 2 and 8). The
supershift/inhibition studies again revealed the presence of JunB and
JunD in the complexes formed with both Th1 (lanes 4 and
5) and Th2 (lanes 10 and 11) extracts.
The anti-c-Jun Ab also partially inhibited formation of the
Th1-specific complex (lane 3). However, since there was residual DNA binding activity in the complexes generated with both Th1
and Th2 extracts that was not abolished by any of these antisera, we
cannot rule out the possibility that related proteins are also present
in the complexes. The residual binding appears not be due to any
binding to the Elf-1-like site within the CLE0 element since an
oligonucleotide containing a mutation in the Elf-1 site was able to
efficiently compete for binding to the CLE0 element using nuclear
extracts of either clones or cultured cells (data not shown). To ensure
that the lower intensity of the 8-h Th1 complex was not related to
technique, we tested the extracts for binding to a probe containing a
binding site for CREB. As illustrated in Fig. 3B, the CREB
binding activity was equivalent in the two nuclear extracts, ruling out
a general deficiency of proteins in the Th1 cell extracts.
Immunoprecipitation experiments performed with cell extracts prepared
from metabolically labeled cells have shown that the lack of GATA-3 DNA
binding activity in Th1 cells is due to the absence of GATA-3 protein
in these cells (data not shown).
Collectively, our data indicate that Th2 cells contain GATA-3 protein
in a constitutive fashion, which increases upon stimulation of the
cells by Ag or cAMP. In contrast, Th1 cells express very little/no
GATA-3 at the basal level, which reproducibly decreases upon
stimulation of the cells.
We reasoned that if GATA-3 controls tissue-specific
expression of IL-5, then ectopic expression of GATA-3 in
non-GATA-3-expressing cells would allow IL-5 gene expression in the
cells. Upon stimulation, neither Th1 clones nor the cervical carcinoma
cell line HeLa expresses IL-5 or GATA-3 protein, but do express AP-1
proteins. To test whether expression of GATA-3 RNA would
make these cells permissive for IL-5 promoter activation, Th1 cells
(A.E7) (Fig. 4A) or HeLa cells
(Fig. 4B) were transfected with the 1.7-kb IL-5
promoter-reporter construct together with a vector for either sense or
antisense (negative control) GATA-3 RNA expression. Although
it has been difficult to sustain high levels of GATA-3 RNA
expression in non-Th2 cells (especially in Th1 cells) by transient
transfection methods, in both A.E7 cells and HeLa cells, expression of
GATA-3 sense RNA, but not antisense RNA, resulted in
4-6-fold activation of the 1.7-kb IL-5 promoter upon stimulation with
Bt2cAMP and PMA. The absence of induction of the promoter
without stimulation of the cells suggests the need for binding of
inducible proteins to other DNA sites, most likely the AP-1 site within
the CLE0 element, for the induction of the promoter. However,
stimulation of the cells alone without GATA-3 expression did not
activate the IL-5 promoter. A minimal promoter containing IL-5 DNA
sequences between
To determine whether the
difference in GATA-3 activity between Th1 and Th2 cells reflected a
preferential up-regulation of GATA-3 gene expression in Th2
cells in the course of primary stimulation, naive spleen Thp cells were
allowed to differentiate along a Th1 or Th2 pathway by treatment with
Ag and the appropriate cytokines and anti-cytokine antibodies. Northern
blot analysis of GATA-3 mRNA expression was carried out
in differentiating cells harvested at different time points after
stimulation. Identification of differentiated cells as predominantly
Th1 or Th2 populations was carried out by ELISA for IL-4, IL-5, and
IFN-
DISCUSSION This study establishes a new role for the transcription factor
GATA-3 as a determinative factor in Th2-specific IL-5 gene expression.
The DNA sequence of the GATA-3 double site is identical in the human
and murine IL-5 genes. GATA-3 belongs to the GATA family of
transcription factors that bind to the WGATAR (W = A/T; R = A/G) DNA sequence through a highly conserved C4 zinc finger domain. Six members (GATA-1 to GATA-6) of this family have been identified in avians, with homologues in mammals and amphibians (29).
Based on their expression profile, the GATA proteins may be classified
functionally as hemopoietic (GATA-1 to GATA-3) or non-hemopoietic
(GATA-4 to GATA-6), and this classification is also valid from
structural considerations (29). GATA-3 is expressed primarily in T
lymphocytes and in the embryonic brain. Functionally important
GATA-3-binding sites have been identified in T cell receptor genes and
the CD8 gene (37-41). However, in the case of most of these
genes, a mutation of the GATA site in the context of a large promoter
fragment fails to inhibit the activity of the respective promoters,
suggesting redundancy in their enhancers (42). Knock out of the
GATA-3 gene in mice results in embryonic death on day 12, with a failure of fetal hematopoiesis and defects in the central
nervous system (43). Recently, GATA-3 was shown to be an
essential component in the earliest steps of T cell development in the
thymus using antisense oligonucleotides for GATA-3 in fetal thymus organ cultures (44) and using embryonic stem cells containing homozygous mutations in the GATA-3 gene and the
RAG-2 gene (45). Collectively, these studies indicate that
GATA-3 is not a functionally redundant GATA family protein.
Activation of IL-5 gene expression by both Ag and a combination of
Bt2cAMP and PMA requires the GATA site and the AP-1 site, but not the NF-AT site, in the IL-5 promoter, and both stimuli trigger
similar binding activities at the corresponding sites. This suggests
that activation of the TCR·CD3 complex might involve stimulation of
cAMP-dependent signaling pathways in the cell. Indeed,
engagement of the TCR·CD3 complex by foreign Ag or by anti-CD3
monoclonal antibodies has been shown to result in elevation of
intracellular cAMP levels in T cells that is associated with the onset
of DNA synthesis in the cells (46). Whereas several studies have
triggered a heightened appreciation for the role of cAMP as an
immunomodulator (47), there is a need to identify a molecular basis for
the differential effects of cAMP in the regulation of gene expression
at specific stages of activation or of differentiation of T cells
following stimulation via the TCR·CD3 complex. Our studies suggest
that specific transcription factors such as GATA-3 may play a role in
the differential effects of cAMP on immune responses during T cell
activation and/or differentiation.
There are two possible explanations for why the IL-5 gene is not
expressed in uninduced Th2 cells despite high basal levels of GATA-3.
First, the activation by GATA-3 requires post-translational modification of the protein; indeed, we have identified several potential protein kinase A and protein kinase C phosphorylation sites
in the GATA-3 protein. Second, IL-5 promoter activation also requires
binding of proteins to the AP-1 site within the CLE0 element (also
identical in the murine and human genes), which is only achieved once
the cells are activated. Among the AP-1 family of proteins, we have
detected only JunB and JunD in the complex that forms with the CLE0
element using both Th1 and Th2 extracts. Induction of JunB
transcription by cAMP has been previously described (48, 49). Similar
to our findings, in one of these studies (45), anti-Jun or anti-Fos
antibodies did not completely supershift/inhibit cAMP-induced complexes
formed with an AP-1 site. It is possible that Ag and
Bt2cAMP induce the formation of heterodimers of JunB/JunD
with an as yet unidentified Jun-related protein, and the resulting
complex exhibits a lower affinity for anti-JunB and anti-JunD
antibodies. Alternatively, cAMP induces the formation of heteromeric
complexes between JunB/JunD and other related bZIP proteins. Although
the AP-1 proteins recognize the TPA response element, which differs
from the cAMP response element by only 1 base pair, the distinction
between the TPA response element/cAMP response element and AP-1/CREB
is, however, not absolute. TPA response element- and cAMP response
element-related sequences have now been identified that are recognized
by both groups of proteins, and heterodimers between some members of
the CREB/ATF family and JunB, JunD, and c-Jun have been reported (50).
The complex formed with the AP-1 site in the IL-5 promoter might
therefore be composed of heteromeric complexes between JunB/JunD and
CREB/ATF proteins.
Recently, the proximal region of the IL-4 promoter was shown to
interact with c-Maf, the product of the proto-oncogene
c-maf, which is expressed in Th2 cells, but not in Th1 cells
(51). The results of multiple studies by different investigators
indicate that several transcription factors binding to the promoter
proximal region or to regions outside of the 800-bp IL-4 promoter may
coordinately regulate overall IL-4 promoter activity, the Th2
specificity being conferred by proteins such as c-Maf and probably also
NF-IL-6, which, like c-Maf, is expressed in Th2 cells, but not in Th1
cells (52-54). The IL-4 promoter also contains a double GATA site
between At the RNA level, the expression of GATA-3 in Th1 cells
generated by in vitro differentiation of naive
CD4+ T cells is at one-twentieth to one-thirtieth the level
detected in Th2 cells. In EMSAs, we have consistently detected a very
low level of GATA-3 binding activity in the resting Th1 clones C19 and
A.E7. Also, this activity reproducibly decreases upon stimulation of
the cells, whether by Ag or by a combination of Bt2cAMP and PMA. This decrease in binding activity may result from a higher rate of
turnover of GATA-3 RNA in activated Th1 cells as seen in
developing Th1 cells during a primary stimulation of naive primary
CD4+ T cells. This effect also appears to be specifically
targeted at GATA-3 since the same extracts used at half the amounts
displayed significant inducible binding activity at the AP-1 site. Our
data suggest that the decrease in GATA-3 levels in stimulated Th1 cells is another mechanism that ensures the specific profile of cytokine production by Th1 and Th2 cells.
Studies of asthma in both human and animal models are consistent with
the concept that airway inflammation, a characteristic feature of
asthma, requires the presence of activated Th2 cells. Among the Th2
cytokines, IL-5 is key to the eosinophilia typically associated with
the disease, being intimately involved with eosinophil differentiation,
proliferation, and survival. Eosinophilia is also a feature of a number
of other pathological conditions such as idiopathic hypereosinophilic
syndrome, parasitic infections, and allergies (12). If asthma results
from an abnormal skewing of the immune response in the lung toward the
generation of Th2 cells, then understanding the reversal of this
process is critical. One important target for the development of
anti-asthma therapeutics is therefore inhibition of IL-5 gene
expression in T cells. GATA-3 is an especially attractive target in
this regard since its expression is limited to T cells in the adult,
and therefore, any GATA-3-specific antagonist can be expected to have
minimum side effects. Another important question that arises from this
study is whether forced expression of GATA-3 in Th1 cells would aid in
altering Th1/Th2 ratios. This is important in controlling Th1-driven
pathologies, which include autoimmune diseases such as
insulin-dependent diabetes mellitus. In a recent study
investigating the role of CD4+ Th1 and Th2 cells in the
induction of diabetes mellitus, Th1 cells promoted disease, whereas Th2
cells did not (55).
Thus, this study identifies differential expression of the
GATA-3 gene in Th1 and Th2 cells and relates it to the
production of a cytokine of significant biomedical importance. This
raises intriguing questions about the role of GATA-3 in determining the balance between Th1 and Th2 subsets in immune responses and disease states. Additionally, identification of GATA-3 as a critical component in IL-5 gene expression raises possibilities for the therapy of asthma
and allergic diseases and idiopathic hypereosinophilic syndrome via
blockade of GATA-3 activation.
FOOTNOTES ACKNOWLEDGEMENTS We thank T. Honjo for the gift of the plasmid
p4k-pUC18 containing IL-5 promoter sequences, J. D. Engel for the
plasmid containing the murine GATA-3 cDNA and
GATA-3 expression vectors, K. M. Murphy for the DO11.10
TCR transgenic mice, D. Wilson for the anti-GATA-4 antiserum, and A. Marinov for excellent technical assistance with ELISAs.
REFERENCES
Volume 272, Number 34,
Issue of August 22, 1997
pp. 21597-21603
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.
,§,,
Department of Internal Medicine,
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
(IFN-) and stimulate microbicidal activity in
macrophages and promote cell-mediated immunity (1-4). Th2 cells, on
the other hand, produce IL-4 and IL-5, which stimulate IgE production
and eosinophilic inflammation, respectively (1-4). There is good
evidence that in atopic asthmatics, a Th2-type response occurs in the
airways (5-8). Although it appears that the outcome of many diseases
such as asthma is determined by the ratio of Th1 to Th2 cells (4), the
molecular basis for Th1- and Th2-specific gene expression remains to be
elucidated.
, prostaglandin E2, and the cAMP
analogue dibutyryl cyclic AMP (Bt2cAMP), have been shown to
differentially regulate cytokine production by Th1 and Th2 cells.
Whereas the production of the Th1 response-inducing cytokine IL-12 and
that of the Th1 cytokines IL-2 and IFN- are inhibited by
cAMP-increasing agents, the production of IL-5 is strongly induced by
the same agents, suggesting a possible immunoregulatory role for this
second messenger (21-24).
66, which disrupted a GATA site located between 70 and
60, abolished activation of the promoter (25). Furthermore, in
electrophoretic mobility shift assays (EMSAs), we demonstrated that the
transcription factor GATA-3, but not GATA-4, binds to this GATA site
(25). This was the first description of the involvement of GATA-3 in
the transcription of any cytokine gene (25). Yamagata et al.
(26), in their studies of transcription of the human IL-5 gene in the
ATL-16T cell line, also demonstrated the importance of the GATA site in
expression of the human IL-5 gene. However, two important points merit
consideration in comparing these two studies. First, IL-5 gene
expression in ATL-16T cells is largely constitutive (27).2
However, in both humans and mice, the IL-5 gene is expressed in an
inducible fashion, and therefore, the ATL-16T cells do not reflect the
typical expression characteristics of the IL-5 gene either in humans or
in mice. Second, GATA-4 is predominantly expressed in the heart,
intestines, epithelium, and reproductive organs, and its expression is
low or undetectable in both human and murine T cells (28, 29).
Therefore, the atypical high level of GATA-4 activity in ATL-16T cells
may contribute to the atypical (constitutive) nature of IL-5 gene
expression in these cells. In another study, Prieschl et al.
(30) showed that the GATA site located between 70 and 60 in the
IL-5 promoter is also important for IL-5 gene expression in mast cells.
In our previous study, we additionally demonstrated that activation of
the IL-5 promoter also requires an intact AP-1 site within the CLE0
element (consensus lymphokine element 0) located between 53 and 39 in the
promoter; mutation of this site in the context of an ~550-bp promoter
totally abrogated promoter activity.
-mercaptoethanol, 2 mM L-glutamine, and 50 µg/ml gentamycin at 37 °C with 5% CO2 (31, 32). The cells were stimulated every 2 weeks with the specific antigen (conalbumin for D10 cells, used at 100 µg/ml) and peptide AC1-16 (ASQKRPSQRHGSKYL; derived from myelin basic protein, used at 5 µg/ml)
and mitomycin C-treated splenocytes from syngeneic mice (I-Ak for D10 cells and I-Au for C19 cells).
Prior to use in experiments, dead cells were removed by density
gradient fractionation using lymphocyte separation medium (Organon
Teknika). DO11.10 mice, which are transgenic for the TCR recognizing
the ovalbumin peptide 323-339 (pOVA323-339), were
provided on BALB/c background by Dr. Ken Murphy (Washington University,
St. Louis, MO). To generate Th1 or Th2 cells from DO11.10 mice, naive
CD4+ T cells were first isolated from the spleens by
negative selection using monoclonal antibodies to CD8, class II MHC
I-Ad, and anti-Ig-coated magnetic beads (Collaborative
Research). Cultures were set up in flasks containing equal numbers of
CD4+ T cells and T cell-depleted APCs at a concentration of
2 × 106 cells/ml. To generate Th1 cells, cultures
contained pOVA323-339 at 5 µg/ml, IL-12 at 5 ng/ml, IL-2
at 10 units/ml, and anti-IL-4 at inhibitory concentrations. To generate
Th2 cells, cultures contained pOVA323-339 at 5 µg/ml,
IL-4 at 200 units/ml, IL-2 at 10 units/ml, and anti-IFN- antibody.
Cells were maintained in culture for 3 days, and at the end of this
period, cells were further stimulated with fresh mitomycin C-treated
and T cell-depleted APCs and Ag for 8 or 24 h (for making nuclear
extracts) or for 48 h for cytokine assays. Culture supernatants
were assayed for the presence of cytokines by ELISA using kits from
Endogen, Inc. (sensitivity: IL-4, 6 pg/ml; IL-5, 0.1 ng/ml; and
IFN-, 2 ng/ml).
-32P]dCTP using a random primer DNA
labeling kit (Boehringer Mannheim). Hybridization was performed using
QuikHyb (Stratagene) according to the instructions of the
manufacturer.
-galactosidase
plasmid as a monitor for transfection efficiency, and carrier plasmid
pGEM7Z to make up to 15 µg of total DNA) for 10 min at room
temperature, and electroporation was carried out using a GenePulser
(Bio-Rad) at 0.27 kV and 960 microfarads. The cells were left on ice
for 10-30 min, diluted to 5 ml with fresh medium, and incubated at
37 °C with or without Bt2cAMP + PMA. For antigen
stimulation, rested cells were first stimulated with conalbumin and
mitomycin C-treated and T cell-depleted APCs in complete medium
containing 5 units/ml IL-2 for 72 h and then subjected to
electroporation. Cells were harvested for reporter gene assays as
described previously (25). HeLa cells were transfected as described
previously (33, 34).
57 and
34 (containing the CLE0 element) and between 73 and 54
(containing the GATA element) in the IL-5 gene, and 22-bp
oligonucleotides containing the consensus CREB element (from
Stratagene). The oligonucleotides for the mutant CREB element were
purchased from Santa Cruz Biotechnology. The sequences of the
oligonucleotides used in the EMSAs were as follows: 
73CCTCTATCTGATTGTTAGCA54 (wild-type GATA),
CCTCgcgaTGATTGTTAGCA (GATA mutant 1), CCTCTATCTGAaaccTAGCA (GATA mutant
2), CCTCTATCcttTTGTTAGCA (GATA mutant 3), and
57AGCAATTATTCATTTCCTCAGAGA34 (CLE0).
Complementary oligonucleotides were annealed before use in EMSAs. The
antibodies to the c-Jun, JunB, JunD, and GATA-3 proteins were purchased
from Santa Cruz Biotechnology. The anti-GATA-3 antibody was a mouse
monoclonal IgG1 that does not cross-react with GATA-1, GATA-2, or
GATA-4. The anti-Fos antibody was purchased from Oncogene Science Inc.
The anti-GATA-4 antibody was kindly provided by Dr. David Wilson. The
competitor oligonucleotides were added at a 100-fold molar excess. The
binding reactions were analyzed by electrophoresis on 6% native
polyacrylamide gels (acrylamide/bisacrylamide = 30:1).
Electrophoresis was carried out at 200 V in 0.5 × TBE (1 × TBE = 0.05 M Tris base, 0.05 M boric acid,
and 1.0 mM EDTA) at 4 °C. Gels were dried and subjected
to autoradiography.
-Flanking Region of the IL-5 Gene Is
Critical for IL-5 Promoter Activation in Th2 Cells
-flanking region that were
critical for induction of the IL-5 promoter: one was the AP-1-binding
site within the CLE0 element, whereas the other was a region between
70 and 60 containing two overlapping GATA sites, deletion of which
abrogated activation of the promoter (25). To elucidate the molecular
mechanisms underlying transcriptional activation of the IL-5 gene by Ag
in Th2 cells, we transfected the murine Th2 clone D10.G4.1 (31) with a
reporter gene (firefly luciferase) construct containing a 1.7-kb
promoter fragment from the 5-flanking region immediately upstream of
the transcriptional start site of the IL-5 gene. Both Ag and
Bt2cAMP + PMA caused a 10-20-fold activation of the
wild-type IL-5 promoter, and mutations in the AP-1 site or the GATA
site in the context of the 1.7-kb promoter completely abolished
activation of the IL-5 promoter (Fig.
1A). Mutations in the NF-AT
site, on the other hand, had no effect on IL-5 promoter activity.
Fig. 1.
Transcriptional activation of the murine IL-5
promoter in D10 cells requires the GATA-3 and AP-1 sites (within the
CLE0 element), but not the NF-AT site. A, rested cells were
transfected with the indicated plasmids by electroporation and either
left unstimulated or stimulated with Bt2cAMP (1 mM) + PMA (25 ng/ml). The wild-type (wt)
promoter contained sequences between approximately 1700 and +24 of
the IL-5 promoter, and the individual mutations were made in the
context of this fragment. For antigen stimulation, rested cells were
first stimulated with conalbumin and mitomycin C-treated and T
cell-depleted APCs in complete medium containing 5 units/ml IL-2 for
72 h and then subjected to electroporation. After 18-20 h, cells
were harvested, and luciferase and -galactosidase assays were
performed as described previously (25). The luciferase activity
(arbitrary units) for each of the reporter plasmids is shown in the bar
graph, with results representing the average of multiple experiments
and normalized for -galactosidase activity. The deviations were no
more than 15% between experiments. B, the location and
sequence of the three site-directed mutations in the IL-5 promoter are
identified. Base pair changes are identified with lower-case
letters. mut., mutant.
[View Larger Version of this Image (20K GIF file)]
70 and 60
in the formation of the complexes (lanes 4-6). The
complexes (especially complex II) were supershifted by an anti-GATA-3
antibody (Ab) (lane 7), but not by an anti-GATA-4 antiserum
(lane 9). To compare GATA-3 DNA binding activity between Th1
and Th2 cells, we performed a similar analysis with nuclear extracts
from both D10 and C19 (Th1) cells prepared in the same experiment under
identical conditions. As shown in Fig. 2B (lower
panel), nuclear proteins from induced D10 cells generated two
complexes that were supershifted by the anti-GATA-3 Ab (lane
3), but not by the anti-GATA-4 Ab (lane 4). Using
identical protein amounts of nuclear extracts prepared from C19 cells,
we detected a very low level of binding activity in resting cells (Fig.
2B, upper panel, lane 1). Upon
treatment of the C19 cells with Bt2cAMP and PMA, whether
alone (data not shown) or in combination, the intensity of the
complexes did not increase, but consistently diminished (Fig.
2B, upper panel, compare lane 2 with
lane 1).
Fig. 2.
Th1 and Th2 clones differentially express
GATA-3 DNA binding activity. A, shown is the GATA-3 DNA
binding activity in unstimulated and stimulated Th2 (D10) cells.
B, GATA-3 DNA binding activity increases upon stimulation of
Th2 cells with Bt2cAMP+ PMA, but decreases in similarly
stimulated Th1 cells, whereas Th1 and Th2 cells contain equivalent CLE0
binding activity. Nuclear extracts were prepared as described
previously (25). The probes in the EMSAs were two double-stranded
oligonucleotides containing sequences between (i) 57 and 34
(containing the CLE0 element) and (ii) 73 and 54 (containing the
GATA element) in the IL-5 gene. The EMSAs were performed essentially as
reported previously (25). 2 and 1 µg of protein were used in each
lane for GATA and CLE0 binding assays, respectively. 2 µg of the
indicated antibodies was added per 20-µl reaction volume. The
competitor oligonucleotides were added at a 100-fold molar excess. The
binding reactions were analyzed by electrophoresis on 6% native
polyacrylamide gels. Gels were dried and subjected to autoradiography.
mut., mutant.
[View Larger Version of this Image (88K GIF file)]
Fig. 3.
Murine CD4+ Th2 cells, but not
Th1 cells, express GATA-3 DNA binding activity. Th1 and Th2 cells
were generated by differentiation of naive CD4+ T cells
isolated from TCR transgenic mice as described under "Experimental
Procedures." Cultures were maintained for 3 days. The cells were
further stimulated at the end of this period with fresh mitomycin
C-treated and T cell-depleted APCs and Ag for 8 or 24 h, and
nuclear extracts were prepared. The extracts were used in EMSAs as
described in the legend to Fig. 2. mut., mutant.
[View Larger Version of this Image (67K GIF file)]
76 and +24, which include the GATA site between
70 and 60 and the CLE0 element, but no other identifiable
transcription factor-binding sites, was also similarly activated by
coexpression of the sense (but not the antisense) GATA-3
expression vector in both cell types (data not shown). Also, as shown
in Fig. 4B, overexpression of the p65 subunit of NF-
B, a
potent transactivator, failed to up-regulate IL-5 promoter activity in
HeLa cells, demonstrating the specificity of GATA-3 in this
experimental setting. Thus, although Th1 cells and HeLa cells express
several transcription factors, the DNA-binding sites for a few of which
can be identified in the 1.7-kb IL-5 promoter, these cells can only
activate the promoter in the presence of GATA-3. This strongly suggests
that GATA-3 serves the role of a tissue-specific regulator of IL-5 gene
expression. Our studies do not rule out the involvement of additional
control elements that might be involved in the overall enhancement of
transcription of the IL-5 gene in Th2 cells.
Fig. 4.
Activation of the IL-5 promoter in A.E7 cells
and HeLa cells by ectopic expression of GATA-3. A, A.E7
cells were transfected by electroporation with 15 µg of DNA (5 µg
of reporter plasmid, 2 µg of cytomegalovirus--galactosidase
plasmid, and carrier plasmid with or without 5 µg of murine
GATA-3 sense or antisense expression plasmid). Cells were
either left uninduced or were induced with Bt2cAMP + PMA as
described in the legend to Fig. 1. Cells were harvested and assayed for
luciferase and -galactosidase activity. In each case, the results
represent an average of two independent experiments. B,
monolayer cultures of HeLa cells in 60-mm plates were transfected by
the calcium phosphate coprecipitation procedure as described previously
(33, 34) with 10 µg of DNA (2 µg of reporter plasmid, 2 µg of an
expression plasmid for murine GATA-3 sense or antisense RNA
expression or p65 RNA expression, 1 µg of
cytomegalovirus--galactosidase, and 5 µg of carrier plasmid). 16 h after transfection, the cells were washed and were either left unstimulated in serum-free medium or stimulated with
Bt2cAMP + PMA as described in the legend to Fig. 1. Cells
were harvested 6 h after stimulation and assayed for luciferase
and -galactosidase activity. Shown is a representative experiment of
three with <3% variation between experiments. S, sense;
AS, antisense; wt, wild-type.
[View Larger Version of this Image (21K GIF file)]
protein in culture supernatants after secondary stimulation
with Ag. As shown in Fig. 5A,
naive Thp cells were found to express low levels of GATA-3 mRNA. In cells differentiated along a Th2 pathway, there was a substantial increase in GATA-3 mRNA at 24 h after
stimulation, which continued to increase until 48 h and reached a
plateau thereafter. In contrast, no such induction was seen in Th1
cells, and there was actually a decrease in the level of
GATA-3 message at 24 h after stimulation, which reached
a minimum at 48 h post-stimulation, by which time a commitment of
the developing cells along the Th1/Th2 lineage has already occurred
(36). The loading of RNA was equivalent for the two sets of cells as
evident from hybridization of the same blot with
glyceraldehyde-3-phosphate dehydrogenase (data not shown). The cells
were restimulated after day 5 with fresh T cell-depleted and mitomycin
C-treated APCs and Ag for 48 h, and cytokine levels in the culture
supernatants were evaluated by ELISA (Fig. 5B). Taken
together, our experiments show that differentiation along the Th2
pathway results in a substantial increase in GATA-3 gene
expression, whereas that along the Th1 pathway leads to a decrease in
GATA-3 gene expression.
Fig. 5.
Up-regulation of GATA-3 gene
expression in developing Th2 cells and down-regulation in developing
Th1 cells. Naive CD4+ T cells isolated from the
spleens of DO11.10 mice were allowed to differentiate along the Th1 or
Th2 pathway as described under "Experimental Procedures."
A, expression of GATA-3 mRNA in developing Th1 and Th2 cells. Total RNA was isolated from cells harvested at the
indicated time points and analyzed by Northern blotting techniques.
B, cytokine production by Th1 and Th2 cell populations. After 5 days in culture, cells were washed and restimulated with fresh
T cell-depleted and mitomycin C-treated APCs and Ag for 48 h.
Culture supernatants were assayed for cytokine production by ELISA.
mGATA-3, murine GATA-3.
[View Larger Version of this Image (29K GIF file)]
274 and 264 (which is very similar to the one in the IL-5
promoter located between 70 and 60) and a single GATA motif between
112 and 107. It will be interesting to examine the activity of a large promoter fragment of the IL-4 gene containing mutations in the
GATA sites and the effect of ectopically expressed GATA-3 on wild-type
promoter activity.
To whom correspondence should be addressed: Dept. of Internal
Medicine, Pulmonary and Critical Care Section, Yale University School
of Medicine, P. O. Box 208057, 333 Cedar St., New Haven, CT 06520. Tel.: 203-737-2705; Fax: 203-785-3826; E-mail:
Anuradha.Ray{at}qm.yale.edu.
1
The abbreviations used are: IL, interleukin;
IFN-, interferon-; Bt2cAMP, dibutyryl cyclic AMP;
EMSAs, electrophoretic mobility shift assays; bp, base pair; kb,
kilobase; TCR, T cell receptor; APCs, antigen-presenting cells; Ag,
antigen; ELISA, enzyme-linked immunosorbent assay; PMA, phorbol
12-myristate 13-acetate; Ab, antibody; TPA,
12-O-tetradecanoylphorbol-13-acetate.
2
D.-H. Zhang and A. Ray, unpublished
observations.
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  B. B. L. Pillemer, Z. Qi, B. Melgert, T. B. Oriss, P. Ray, and A. Ray STAT6 Activation Confers upon T Helper Cells Resistance to Suppression by Regulatory T Cells J. Immunol., July 1, 2009; 183(1): 155 - 163. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Dai, N. J. Megjugorac, G. E. Gallagher, R. Y. L. Yu, and G. Gallagher IFN-{lambda}1 (IL-29) inhibits GATA3 expression and suppresses Th2 responses in human naive and memory T cells Blood, June 4, 2009; 113(23): 5829 - 5838. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. N. Shukla, J. L. Rose, R. Ray, K. L. Lathrop, A. Ray, and P. Ray Hepatocyte Growth Factor Inhibits Epithelial to Myofibroblast Transition in Lung Cells via Smad7 Am. J. Respir. Cell Mol. Biol., June 1, 2009; 40(6): 643 - 653. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. C. Liberman, J. Druker, D. Refojo, F. Holsboer, and E. Arzt Glucocorticoids inhibit GATA-3 phosphorylation and activity in T cells FASEB J, May 1, 2009; 23(5): 1558 - 1571. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Zhu, T. S. Davidson, G. Wei, D. Jankovic, K. Cui, D. E. Schones, L. Guo, K. Zhao, E. M. Shevach, and W. E. Paul Down-regulation of Gfi-1 expression by TGF-{beta} is important for differentiation of Th17 and CD103+ inducible regulatory T cells J. Exp. Med., February 16, 2009; 206(2): 329 - 341. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. J. Scheinman and O. Avni Transcriptional Regulation of Gata3 in T Helper Cells by the Integrated Activities of Transcription Factors Downstream of the Interleukin-4 Receptor and T Cell Receptor J. Biol. Chem., January 30, 2009; 284(5): 3037 - 3048. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Ribeiro de Almeida, H. Heath, S. Krpic, G. M. Dingjan, J. P. van Hamburg, I. Bergen, S. van de Nobelen, F. Sleutels, F. Grosveld, N. Galjart, et al. Critical Role for the Transcription Regulator CCCTC-Binding Factor in the Control of Th2 Cytokine Expression J. Immunol., January 15, 2009; 182(2): 999 - 1010. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. L. Wurster and M. J. Pazin BRG1-Mediated Chromatin Remodeling Regulates Differentiation and Gene Expression of T Helper Cells Mol. Cell. Biol., December 15, 2008; 28(24): 7274 - 7285. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Klein-Hessling, T. Bopp, M. K. Jha, A. Schmidt, S. Miyatake, E. Schmitt, and E. Serfling Cyclic AMP-induced Chromatin Changes Support the NFATc-mediated Recruitment of GATA-3 to the Interleukin 5 Promoter J. Biol. Chem., November 7, 2008; 283(45): 31030 - 31037. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Shinnakasu, M. Yamashita, M. Kuwahara, H. Hosokawa, A. Hasegawa, S. Motohashi, and T. Nakayama Gfi1-mediated Stabilization of GATA3 Protein Is Required for Th2 Cell Differentiation J. Biol. Chem., October 17, 2008; 283(42): 28216 - 28225. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Zhu and W. E. Paul CD4 T cells: fates, functions, and faults Blood, September 1, 2008; 112(5): 1557 - 1569. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Okamoto, K. Takeda, A. Joetham, H. Ohnishi, H. Matsuda, C. H. Swasey, B. J. Swanson, K. Yasutomo, A. Dakhama, and E. W. Gelfand Essential role of Notch signaling in effector memory CD8+ T cell-mediated airway hyperresponsiveness and inflammation J. Exp. Med., May 12, 2008; 205(5): 1087 - 1097. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. L. Nelson, L. B. Wenzel, K. Osann, A. Dogan-Ates, N. Chantana, A. Reina-Patton, A. K. Laust, K. P. Nishimoto, A. Chicz-DeMet, N. du Pont, et al. Stress, Immunity, and Cervical Cancer: Biobehavioral Outcomes of a Randomized Clinical Trail Clin. Cancer Res., April 1, 2008; 14(7): 2111 - 2118. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-Y. Pai, B. Y. Kang, A. M. Sabadini, E. Parisini, M. L. Truitt, and I-C. Ho Distinct Structural Requirements of GATA-3 for the Regulation of Thymocyte and Th2 Cell Differentiation J. Immunol., January 15, 2008; 180(2): 1050 - 1059. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. H.-M. Tan, S. Y.-P. Goh, S.-C. Wong, and K.-P. Lam T Helper Cell-specific Regulation of Inducible Costimulator Expression via Distinct Mechanisms Mediated by T-bet and GATA-3 J. Biol. Chem., January 4, 2008; 283(1): 128 - 136. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Biswas, P. Banerjee, and T. Biswas Priming of CD4+ T cells with porin of Shigella dysenteriae activates the cells toward type 1 polarization Int. Immunol., January 1, 2008; 20(1): 81 - 88. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Barrera, F. Mendoza, J. Zuniga, A. Estrada, A. C. Zamora, E. I. Melendro, R. Ramirez, A. Pardo, and M. Selman Functional Diversity of T-Cell Subpopulations in Subacute and Chronic Hypersensitivity Pneumonitis Am. J. Respir. Crit. Care Med., January 1, 2008; 177(1): 44 - 55. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Matsuno, Y. Ishii, K. Yoh, Y. Morishima, N. Haraguchi, N. Kikuchi, T. Iizuka, T. Kiwamoto, S. Homma, A. Nomura, et al. Overexpression of GATA-3 Protects against the Development of Hypersensitivity Pneumonitis Am. J. Respir. Crit. Care Med., November 15, 2007; 176(10): 1015 - 1025. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Yoshimoto, T. Yoshimoto, K. Yasuda, J. Mizuguchi, and K. Nakanishi IL-27 Suppresses Th2 Cell Development and Th2 Cytokines Production from Polarized Th2 Cells: A Novel Therapeutic Way for Th2-Mediated Allergic Inflammation J. Immunol., October 1, 2007; 179(7): 4415 - 4423. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Atayar, A. van den Berg, T. Blokzijl, M. Boot, R. D Gascoyne, L. Visser, and S. Poppema Hodgkin's lymphoma associated T-cells exhibit a transcription factor profile consistent with distinct lymphoid compartments J. Clin. Pathol., October 1, 2007; 60(10): 1092 - 1097. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S.-J. Liu, J.-P. Tsai, C.-R. Shen, Y.-P. Sher, C.-L. Hsieh, Y.-C. Yeh, A.-H. Chou, S.-R. Chang, K.-N. Hsiao, F.-W. Yu, et al. Induction of a distinct CD8 Tnc17 subset by transforming growth factor-{beta} and interleukin-6 J. Leukoc. Biol., August 1, 2007; 82(2): 354 - 360. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
U. De Fanis, F. Mori, R. J. Kurnat, W. K. Lee, M. Bova, N. F. Adkinson, and V. Casolaro GATA3 up-regulation associated with surface expression of CD294/CRTH2: a unique feature of human Th cells Blood, May 15, 2007; 109(10): 4343 - 4350. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. J. Lund, M. Loytomaki, T. Naumanen, C. Dixon, Z. Chen, H. Ahlfors, S. Tuomela, J. Tahvanainen, J. Scheinin, T. Henttinen, et al. Genome-Wide Identification of Novel Genes Involved in Early Th1 and Th2 Cell Differentiation J. Immunol., March 15, 2007; 178(6): 3648 - 3660. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Chen, W. He, S. T. Kim, J. Tao, Y. Gao, H. Chi, A. M. Intlekofer, B. Harvey, S. L. Reiner, Z. Yin, et al. Epigenetic and Transcriptional Programs Lead to Default IFN-{gamma} Production by {gamma}{delta} T Cells J. Immunol., March 1, 2007; 178(5): 2730 - 2736. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Zhu, D. Jankovic, A. Grinberg, L. Guo, and W. E. Paul Gfi-1 plays an important role in IL-2-mediated Th2 cell expansion PNAS, November 28, 2006; 103(48): 18214 - 18219. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. J. Kim, S.-Y. Pai, M. Brigl, G. S. Besra, J. Gumperz, and I-C. Ho GATA-3 Regulates the Development and Function of Invariant NKT Cells J. Immunol., November 15, 2006; 177(10): 6650 - 6659. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Shinnakasu, M. Yamashita, K. Shinoda, Y. Endo, H. Hosokawa, A. Hasegawa, S. Ikemizu, and T. Nakayama Critical YxKxHxxxRP Motif in the C-Terminal Region of GATA3 for Its DNA Binding and Function J. Immunol., November 1, 2006; 177(9): 5801 - 5810. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Balic, Y. M. Harcus, M. D. Taylor, F. Brombacher, and R. M. Maizels IL-4R signaling is required to induce IL-10 for the establishment of Th2 dominance Int. Immunol., October 1, 2006; 18(10): 1421 - 1431. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Chen, M. Arora, M. Yarlagadda, T. B. Oriss, N. Krishnamoorthy, A. Ray, and P. Ray Distinct Responses of Lung and Spleen Dendritic Cells to the TLR9 Agonist CpG Oligodeoxynucleotide J. Immunol., August 15, 2006; 177(4): 2373 - 2383. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Kimura, Y. Ishii, K. Yoh, Y. Morishima, T. Iizuka, T. Kiwamoto, Y. Matsuno, S. Homma, A. Nomura, T. Sakamoto, et al. Overexpression of the Transcription Factor GATA-3 Enhances the Development of Pulmonary Fibrosis Am. J. Pathol., July 1, 2006; 169(1): 96 - 104. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Yamashita, H. Tashimo, H. Ishida, Y. Matsuo, H. Tamauchi, M. Terashima, I. Yoshiwara, S. Habu, and K. Ohta Involvement of GATA-3-dependent Th2 lymphocyte activation in airway hyperresponsiveness Am J Physiol Lung Cell Mol Physiol, June 1, 2006; 290(6): L1045 - L1051. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Arora, L. Chen, M. Paglia, I. Gallagher, J. E. Allen, Y. M. Vyas, A. Ray, and P. Ray Simvastatin promotes Th2-type responses through the induction of the chitinase family member Ym1 in dendritic cells PNAS, May 16, 2006; 103(20): 7777 - 7782. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. R. King, A. S. Ismail, L. S. Davis, and D. R. Karp Oxidative stress promotes polarization of human T cell differentiation toward a T helper 2 phenotype. J. Immunol., March 1, 2006; 176(5): 2765 - 2772. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Hasegawa, T. Miki, H. Hosokawa, M. B. Hossain, C. Shimizu, K. Hashimoto, M. Y. Kimura, M. Yamashita, and T. Nakayama Impaired GATA3-Dependent Chromatin Remodeling and Th2 Cell Differentiation Leading to Attenuated Allergic Airway Inflammation in Aging Mice J. Immunol., February 15, 2006; 176(4): 2546 - 2554. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Wang, M. F. Shannon, and I. G. Young A role for Ets1, synergizing with AP-1 and GATA-3 in the regulation of IL-5 transcription in mouse Th2 lymphocytes Int. Immunol., February 1, 2006; 18(2): 313 - 323. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Mikhalkevich, B. Becknell, M. A. Caligiuri, M. D. Bates, R. Harvey, and W.-p. Zheng Responsiveness of Naive CD4 T Cells to Polarizing Cytokine Determines the Ratio of Th1 and Th2 Cell Differentiation J. Immunol., February 1, 2006; 176(3): 1553 - 1560. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. N. Georas, J. Guo, U. De Fanis, and V. Casolaro T-helper cell type-2 regulation in allergic disease Eur. Respir. J., December 1, 2005; 26(6): 1119 - 1137. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. C. Lambert, E. M. Curran, B. M. Judy, G. N. Milligan, D. B. Lubahn, and D. M. Estes Estrogen Receptor {alpha} (ER{alpha}) Deficiency in Macrophages Results in Increased Stimulation of CD4+ T Cells while 17{beta}-Estradiol Acts through ER{alpha} to Increase IL-4 and GATA-3 Expression in CD4+ T Cells Independent of Antigen Presentation J. Immunol., November 1, 2005; 175(9): 5716 - 5723. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. S. Haring, V. P. Badovinac, M. R. Olson, S. M. Varga, and J. T. Harty In Vivo Generation of Pathogen-Specific Th1 Cells in the Absence of the IFN-{gamma} Receptor J. Immunol., September 1, 2005; 175(5): 3117 - 3122. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Yamashita, R. Shinnakasu, H. Asou, M. Kimura, A. Hasegawa, K. Hashimoto, N. Hatano, M. Ogata, and T. Nakayama Ras-ERK MAPK Cascade Regulates GATA3 Stability and Th2 Differentiation through Ubiquitin-Proteasome Pathway J. Biol. Chem., August 19, 2005; 280(33): 29409 - 29419. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. A. Corn, C. Hunter, H.-C. Liou, U. Siebenlist, and M. R. Boothby Opposing Roles for RelB and Bcl-3 in Regulation of T-Box Expressed in T Cells, GATA-3, and Th Effector Differentiation J. Immunol., August 15, 2005; 175(4): 2102 - 2110. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Tanaka, T. So, S. Lebedeva, M. Croft, and A. Altman Impaired IL-4 and c-Maf expression and enhanced Th1-cell development in Vav1-deficient mice Blood, August 15, 2005; 106(4): 1286 - 1295. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L.-O. Tykocinski, P. Hajkova, H.-D. Chang, T. Stamm, O. SOzeri, M. LOhning, J. Hu-Li, U. Niesner, S. Kreher, B. Friedrich, et al. A Critical Control Element for Interleukin-4 Memory Expression in T Helper Lymphocytes J. Biol. Chem., August 5, 2005; 280(31): 28177 - 28185. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. P. Harris, S. Goodrich, A. J. Gerth, S. L. Peng, and F. E. Lund Regulation of IFN-{gamma} Production by B Effector 1 Cells: Essential Roles for T-bet and the IFN-{gamma} Receptor J. Immunol., June 1, 2005; 174(11): 6781 - 6790. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Y. Kimura, H. Hosokawa, M. Yamashita, A. Hasegawa, C. Iwamura, H. Watarai, M. Taniguchi, T. Takagi, S. Ishii, and T. Nakayama Regulation of T helper type 2 cell differentiation by murine Schnurri-2 J. Exp. Med., February 7, 2005; 201(3): 397 - 408. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Sanchez-Guajardo, J. A. M. Borghans, M.-E. Marquez, S. Garcia, and A. A. Freitas Different Competitive Capacities of Stat4- and Stat6-Deficient CD4+ T Cells during Lymphophenia-Driven Proliferation J. Immunol., February 1, 2005; 174(3): 1178 - 1187. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Y. Kang, S.-C. Miaw, and I-C. Ho ROG Negatively Regulates T-Cell Activation but Is Dispensable for Th-Cell Differentiation Mol. Cell. Biol., January 15, 2005; 25(2): 554 - 562. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. B. Oriss, M. Ostroukhova, C. Seguin-Devaux, B. Dixon-McCarthy, D. B. Stolz, S. C. Watkins, B. Pillemer, P. Ray, and A. Ray Dynamics of Dendritic Cell Phenotype and Interactions with CD4+ T Cells in Airway Inflammation and Tolerance J. Immunol., January 15, 2005; 174(2): 854 - 863. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Brenner, D. Levanon, V. Negreanu, O. Golubkov, O. Fainaru, E. Woolf, and Y. Groner Loss of Runx3 function in leukocytes is associated with spontaneously developed colitis and gastric mucosal hyperplasia PNAS, November 9, 2004; 101(45): 16016 - 16021. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Mishan-Eisenberg, Z. Borovsky, M. C. Weber, R. Gazit, M. L. Tykocinski, and J. Rachmilewitz Differential Regulation of Th1/Th2 Cytokine Responses by Placental Protein 14 J. Immunol., November 1, 2004; 173(9): 5524 - 5530. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Katsumoto, M. Kimura, M. Yamashita, H. Hosokawa, K. Hashimoto, A. Hasegawa, M. Omori, T. Miyamoto, M. Taniguchi, and T. Nakayama STAT6-Dependent Differentiation and Production of IL-5 and IL-13 in Murine NK2 Cells J. Immunol., October 15, 2004; 173(8): 4967 - 4975. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Yamashita, R. Shinnakasu, Y. Nigo, M. Kimura, A. Hasegawa, M. Taniguchi, and T. Nakayama Interleukin (IL)-4-independent Maintenance of Histone Modification of the IL-4 Gene Loci in Memory Th2 Cells J. Biol. Chem., September 17, 2004; 279(38): 39454 - 39464. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Yamashita, M. Ukai-Tadenuma, T. Miyamoto, K. Sugaya, H. Hosokawa, A. Hasegawa, M. Kimura, M. Taniguchi, J. DeGregori, and T. Nakayama Essential Role of GATA3 for the Maintenance of Type 2 Helper T (Th2) Cytokine Production and Chromatin Remodeling at the Th2 Cytokine Gene Loci J. Biol. Chem., June 25, 2004; 279(26): 26983 - 26990. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Inami, M. Yamashita, Y. Tenda, A. Hasegawa, M. Kimura, K. Hashimoto, N. Seki, M. Taniguchi, and T. Nakayama CD28 Costimulation Controls Histone Hyperacetylation of the Interleukin 5 Gene Locus in Developing Th2 Cells J. Biol. Chem., May 28, 2004; 279(22): 23123 - 23133. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Wu, L. Rinaldi, K. A. Fortner, J. Q. Russell, J. Tschopp, C. Irvin, and R. C. Budd Cellular FLIP Long Form-Transgenic Mice Manifest a Th2 Cytokine Bias and Enhanced Allergic Airway Inflammation J. Immunol., April 15, 2004; 172(8): 4724 - 4732. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Diehl, T. Krahl, L. Rinaldi, R. Norton, C. G. Irvin, and M. Rincon Inhibition of NFAT Specifically in T Cells Prevents Allergic Pulmonary Inflammation J. Immunol., March 15, 2004; 172(6): 3597 - 3603. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-Y. Pai, M. L. Truitt, and I-C. Ho GATA-3 deficiency abrogates the development and maintenance of T helper type 2 cells PNAS, February 17, 2004; 101(7): 1993 - 1998. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Tamauchi, M. Terashima, M. Ito, H. Maruyama, N. Ikewaki, M. Inoue, X. Gao, K. Hozumi, and S. Habu Evidence of GATA-3-dependent Th2 commitment during the in vivo immune response Int. Immunol., January 1, 2004; 16(1): 179 - 187. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W.-p. Zheng, Q. Zhao, X. Zhao, B. Li, M. Hubank, D. G. Schatz, and R. A. Flavell Up-Regulation of Hlx in Immature Th Cells Induces IFN-{gamma} Expression J. Immunol., January 1, 2004; 172(1): 114 - 122. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Lucas, N. Ghilardi, J. Li, and F. J. de Sauvage IL-27 regulates IL-12 responsiveness of naive CD4+ T cells through Stat1-dependent and -independent mechanisms PNAS, December 9, 2003; 100(25): 15047 - 15052. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Lund, T. Aittokallio, O. Nevalainen, and R. Lahesmaa Identification of Novel Genes Regulated by IL-12, IL-4, or TGF-{beta} during the Early Polarization of CD4+ Lymphocytes J. Immunol., November 15, 2003; 171(10): 5328 - 5336. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. S. Sundrud, S. M. Grill, D. Ni, K. Nagata, S. S. Alkan, A. Subramaniam, and D. Unutmaz Genetic Reprogramming of Primary Human T Cells Reveals Functional Plasticity in Th Cell Differentiation J. Immunol., October 1, 2003; 171(7): 3542 - 3549. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Yoh, K. Shibuya, N. Morito, T. Nakano, K. Ishizaki, H. Shimohata, M. Nose, S. Izui, A. Shibuya, A. Koyama, et al. Transgenic Overexpression of GATA-3 in T Lymphocytes Improves Autoimmune Glomerulonephritis in Mice with a BXSB/MpJ-Yaa Genetic Background J. Am. Soc. Nephrol., October 1, 2003; 14(10): 2494 - 2502. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. K. Kaufman, P. Zhou, H. A. Pasolli, M. Rendl, D. Bolotin, K.-C. Lim, X. Dai, M.-L. Alegre, and E. Fuchs GATA-3: an unexpected regulator of cell lineage determination in skin Genes & Dev., September 1, 2003; 17(17): 2108 - 2122. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. A. Corn, M. A. Aronica, F. Zhang, Y. Tong, S. A. Stanley, S. R. A. Kim, L. Stephenson, B. Enerson, S. McCarthy, A. Mora, et al. T Cell-Intrinsic Requirement for NF-{kappa}B Induction in Postdifferentiation IFN-{gamma} Production and Clonal Expansion in a Th1 Response J. Immunol., August 15, 2003; 171(4): 1816 - 1824. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C.-H. Chen, C. Seguin-Devaux, N. A. Burke, T. B. Oriss, S. C. Watkins, N. Clipstone, and A. Ray Transforming Growth Factor {beta} Blocks Tec Kinase Phosphorylation, Ca2+ Influx, and NFATc Translocation Causing Inhibition of T Cell Differentiation J. Exp. Med., June 16, 2003; 197(12): 1689 - 1699. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Taha, Q. Hamid, L. Cameron, and R. Olivenstein T Helper Type 2 Cytokine Receptors and Associated Transcription Factors GATA-3, c-MAF, and Signal Transducer and Activator of Transcription Factor-6 in Induced Sputum of Atopic Asthmatic Patients Chest, June 1, 2003; 123(6): 2074 - 2082. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Das, M. M. Augustine, J. Das, K. Bottomly, P. Ray, and A. Ray An important regulatory role for CD4+CD8alpha alpha T cells in the intestinal epithelial layer in the prevention of inflammatory bowel disease PNAS, April 29, 2003; 100(9): 5324 - 5329. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Klein-Hessling, M. K. Jha, B. Santner-Nanan, F. Berberich-Siebelt, T. Baumruker, A. Schimpl, and E. Serfling Protein Kinase A Regulates GATA-3-Dependent Activation of IL-5 Gene Expression in Th2 Cells J. Immunol., March 15, 2003; 170(6): 2956 - 2961. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. T. F. Schwenger, C. C. Kok, E. Arthaningtyas, M. A. Thomas, C. J. Sanderson, and V. A. Mordvinov Specific Activation of Human Interleukin-5 Depends on de Novo Synthesis of an AP-1 Complex J. Biol. Chem., November 27, 2002; 277(49): 47022 - 47027. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Yamashita, M. Ukai-Tadenuma, M. Kimura, M. Omori, M. Inami, M. Taniguchi, and T. Nakayama Identification of a Conserved GATA3 Response Element Upstream Proximal from the Interleukin-13 Gene Locus J. Biol. Chem., October 25, 2002; 277(44): 42399 - 42408. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Takemoto, K.-i. Arai, and S. Miyatake Cutting Edge: The Differential Involvement of the N-Finger of GATA-3 in Chromatin Remodeling and Transactivation During Th2 Development J. Immunol., October 15, 2002; 169(8): 4103 - 4107. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Kropf, S. Herath, R. Tewari, N. Syed, R. Klemenz, and I. Muller Identification of Two Distinct Subpopulations of Leishmania major-Specific T Helper 2 Cells Infect. Immun., October 1, 2002; 70(10): 5512 - 5520. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. A. Ritz, M. J. Cundall, B. U. Gajewska, D. Alvarez, J.-C. Gutierrez-Ramos, A. J. Coyle, A. N. J. McKenzie, M. R. Stampfli, and M. Jordana Granulocyte Macrophage Colony-Stimulating Factor-Driven Respiratory Mucosal Sensitization Induces Th2 Differentiation and Function Independently of Interleukin-4 Am. J. Respir. Cell Mol. Biol., October 1, 2002; 27(4): 428 - 435. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. S. Butler, M. M. Monick, T. O. Yarovinsky, L. S. Powers, and G. W. Hunninghake Altered IL-4 mRNA Stability Correlates with Th1 and Th2 Bias and Susceptibility to Hypersensitivity Pneumonitis in Two Inbred Strains of Mice J. Immunol., October 1, 2002; 169(7): 3700 - 3709. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Ahmadzadeh and D. L. Farber Functional plasticity of an antigen-specific memory CD4 T cell population PNAS, September 3, 2002; 99(18): 11802 - 11807. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Santangelo, D. J. Cousins, N. E. E. Winkelmann, and D. Z. Staynov DNA Methylation Changes at Human Th2 Cytokine Genes Coincide with DNase I Hypersensitive Site Formation During CD4+ T Cell Differentiation J. Immunol., August 15, 2002; 169(4): 1893 - 1903. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Arima, H. Toyama, H. Ichii, S. Kojima, S. Okada, M. Hatano, G. Cheng, M. Kubo, T. Fukuda, and T. Tokuhisa A Putative Silencer Element in the IL-5 Gene Recognized by Bcl6 J. Immunol., July 15, 2002; 169(2): 829 - 836. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Hofer, H. Nathansen, M. Lohning, A. Radbruch, and R. Heinrich GATA-3 transcriptional imprinting in Th2 lymphocytes: A mathematical model PNAS, July 9, 2002; 99(14): 9364 - 9368. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. S. Hwang, A. Choi, and I-C. Ho Transcriptional Regulation of GATA-3 by an Intronic Regulatory Region and Fetal Liver Zinc Finger Protein 1 J. Immunol., July 1, 2002; 169(1): 248 - 253. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Huber, C. Shi, and R. C. Budd {gamma}{delta} T Cells Promote a Th1 Response during Coxsackievirus B3 Infection In Vivo: Role of Fas and Fas Ligand J. Virol., June 5, 2002; 76(13): 6487 - 6494. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Gorelik, S. Constant, and R. A. Flavell Mechanism of Transforming Growth Factor {beta}-induced Inhibition of T Helper Type 1 Differentiation J. Exp. Med., June 3, 2002; 195(11): 1499 - 1505. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Kanoh, T. Uetani, H. Sakan, S. Maruyama, F. Liu, K. Sumita, and Y. Asano A two-step model of T cell subset commitment: antigen-independent commitment of T cells before encountering nominal antigen during pathogenic infections Int. Immunol., June 1, 2002; 14(6): 567 - 575. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Kurata, H.-J. Lee, T. McClanahan, R. L. Coffman, A. O'Garra, and N. Arai Friend of GATA Is Expressed in Naive Th Cells and Functions As a Repressor of GATA-3-Mediated Th2 Cell Development J. Immunol., May 1, 2002; 168(9): 4538 - 4545. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. L. Brogdon, D. Leitenberg, and K. Bottomly The Potency of TCR Signaling Differentially Regulates NFATc/p Activity and Early IL-4 Transcription in Naive CD4+ T Cells J. Immunol., April 15, 2002; 168(8): 3825 - 3832. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Yin, C. Chen, S. J. Szabo, L. H. Glimcher, A. Ray, and J. Craft T-Bet Expression and Failure of GATA-3 Cross-Regulation Lead to Default Production of IFN-{gamma} by {gamma}{delta} T Cells J. Immunol., February 15, 2002; 168(4): 1566 - 1571. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. P. Justice, M. T. Borchers, J. J. Lee, W. H. Rowan, Y. Shibata, and M. R. Van Scott Ragweed-induced expression of GATA-3, IL-4, and IL-5 by eosinophils in the lungs of allergic C57BL/6J mice Am J Physiol Lung Cell Mol Physiol, February 1, 2002; 282(2): L302 - L309. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Zhou, W. Ouyang, Q. Gong, S. G. Katz, J. M. White, S. H. Orkin, and K. M. Murphy Friend of GATA-1 Represses GATA-3-dependent Activity in CD4+ T Cells J. Exp. Med., November 12, 2001; 194(10): 1461 - 1471. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Kishikawa, J. Sun, A. Choi, S.-C. Miaw, and I-C. Ho The Cell Type-Specific Expression of the Murine IL-13 Gene Is Regulated by GATA-3 J. Immunol., October 15, 2001; 167(8): 4414 - 4420. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Chtanova, R. A. Kemp, A. P. R. Sutherland, F. Ronchese, and C. R. Mackay Gene Microarrays Reveal Extensive Differential Gene Expression in Both CD4+ and CD8+ Type 1 and Type 2 T Cells J. Immunol., September 15, 2001; 167(6): 3057 - 3063. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. C. Nawijn, R. Ferreira, G. M. Dingjan, O. Kahre, D. Drabek, A. Karis, F. Grosveld, and R. W. Hendriks Enforced Expression of GATA-3 During T Cell Development Inhibits Maturation of CD8 Single-Positive Cells and Induces Thymic Lymphoma in Transgenic Mice J. Immunol., July 15, 2001; 167(2): 715 - 723. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. C. Nawijn, G. M. Dingjan, R. Ferreira, B. N. Lambrecht, A. Karis, F. Grosveld, H. Savelkoul, and R. W. Hendriks Enforced Expression of GATA-3 in Transgenic Mice Inhibits Th1 Differentiation and Induces the Formation of a T1/ST2-Expressing Th2-Committed T Cell Compartment In Vivo J. Immunol., July 15, 2001; 167(2): 724 - 732. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Lieberson, K. A. Mowen, K. D. McBride, V. Leautaud, X. Zhang, W.-K. Suh, L. Wu, and L. H. Glimcher Tumor Necrosis Factor Receptor-associated Factor (TRAF)2 Represses the T Helper Cell Type 2 Response through Interaction with NFAT-interacting Protein (NIP45) J. Exp. Med., July 2, 2001; 194(1): 89 - 98. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Finotto, G. T. De Sanctis, H. A. Lehr, U. Herz, M. Buerke, M. Schipp, B. Bartsch, R. Atreya, E. Schmitt, P. R. Galle, et al. Treatment of Allergic Airway Inflammation and Hyperresponsiveness by Antisense-induced Local Blockade of GATA-3 Expression J. Exp. Med., May 29, 2001; 193(11): 1247 - 1260. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Ranganath and K. M. Murphy Structure and Specificity of GATA Proteins in Th2 Development Mol. Cell. Biol., April 15, 2001; 21(8): 2716 - 2725. [Abstract] [Full Text]
|
|
|
|
|
|
J. C. Keen, L. Sholl, M. Wills-Karp, and S. N. Georas Preferential Activation of Nuclear Factor of Activated T Cells c Correlates with Mouse Strain Susceptibility to Allergic Responses and Interleukin-4 Gene Expression Am. J. Respir. Cell Mol. Biol., January 1, 2001; 24(1): 58 - 65. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |