JBC Oz Biosciences

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kahn-Perlès, B.
Right arrow Articles by Imbert, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kahn-Perlès, B.
Right arrow Articles by Imbert, J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 35, Issue of August 29, 1997 pp. 21774-21783
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Temporal and Subunit-specific Modulations of the Rel/NF-kappa B Transcription Factors Through CD28 Costimulation*

(Received for publication, March 4, 1997, and in revised form, May 23, 1997)

Brigitte Kahn-Perlès Dagger §, Carol Lipcey Dagger , Patrick Lécine Dagger , Daniel Olive Dagger and Jean Imbert Dagger

From the Dagger  Unité de Cancérologie Expérimentale, U119 INSERM, 27 boulevard Leï Roure, 13009 Marseille, France

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES


ABSTRACT

Stimulation of highly purified primary T lymphocytes through CD2 and CD28 adhesion molecules induces a long-term proliferation, dependent on persistent autocrine secretion of interleukin 2 (IL-2), high and prolonged expression of inducible CD25/IL-2 receptor alpha  chain (IL-2Ralpha ), and secretion of growth factors such as the granulocyte-macrophage colony-stimulating factor (GM-CSF). CD28 costimulation appears to activate cytokine gene expression through conserved kappa B-related CD28 response (CD28RE) or cytokine 1 (CK-1) elements in addition to canonical NF-kappa B-binding sites. In this report, we assess: 1) the evolution of the expression, over an 8-day time period, of the Rel/NF-kappa B family of proteins in costimulated versus TcR/CD3-stimulated primary T cells; 2) the impact of changes on the in vitro occupancy of GM-CSF kappa B and CK-1, as well as IL-2Ralpha kappa B sites; and 3) the differential regulation of newly synthesized p65 and c-Rel by Ikappa B proteins. We show that CD2+CD28 stimulation specifically induces, at maximal T cell proliferation phase, sustained nuclear overexpression of NFKB2 p52 and c-Rel subunits which might rely on long-lasting processing of p100 precursor for p52 and increased neosynthesis of c-Rel. This up-regulation correlates with sustained occupancy of GM-CSF kappa B and CK-1 elements by both proteins. Conversely, these subunits do not appear to bind to the IL-2Ralpha kappa B site. Costimulation, but not TcR/CD3 stimulation, appears supported by sustained down-regulation of both Ikappa Balpha and -beta regulators. Furthermore, contrary to p65, c-Rel appears to display little affinity for p105, p100 and Ikappa Balpha regulators.


INTRODUCTION

Specific activation of T lymphocytes is initiated by the engagement of the clonotypic T cell receptor (TcR)1 by antigenic peptides presented by major histocompatibility complex molecules at the surface of antigen presenting cells. Monoclonal antibodies (mAbs) to TcR or to the receptor-associated CD3 molecule can mimic effects of antigen recognition in the presence of monocytes (1). However, proliferation of highly purified T cells requires a second signal, provided by the engagement of the T cell accessory molecule CD28 with its cognate ligand B7 expressed on antigen presenting cells (reviewed in Refs. 2-4). In addition to costimulating the antigen-dependent pathway, CD28 can act in concert with the CD2 adhesion molecule, which is present on nearly all T lymphocytes, to up-regulate T cell responsiveness. As for the CD28 pathway, T cell activation via CD2 can be mimicked by the in vitro use of mAbs (5, 6). The CD2 pathway, although not physically linked to the CD3·TcR complex, is metabolically related to it, in that modulation of the receptor complex abrogates the effects of anti-CD2 antibodies (7, 8). In combination with CD2, or with CD3 mAb, CD28 mAb induces a high-level, long-lasting, IL-2-dependent and monocyte-independent T cell stimulation which is sustained by persistent high-level expression of the IL-2 high-affinity receptor (9, 10). T cell proliferation is also associated with the prolonged secretion of high levels of various cytokines known to be normally synthesized by accessory cells, namely IL-1alpha , CSF-1, and GM-CSF (11). All these up-regulations correlate with increased levels of corresponding mRNA pools, resulting from increased mRNA stability and transcriptional activity (9, 12, 13).

CD28 costimulation is thought to activate lymphokine gene transcription through unique motifs, initially characterized as the CD28 response element (CD28RE) in the IL-2 promoter, and found conserved within several lymphokine genes (14, 15). The CD28RE motifs, also termed cytokine 1 (CK-1), are distinct from, but related to, kappa B elements in that they bind to, and can be activated by, proteins of the Rel/NF-kappa B family (16-19). Remarkably, the IL-2 promoter, as well as several other lymphokine or growth factor promoters including those of GM-CSF and CSF-1, contains a consensus kappa B site in the vicinity of the CD28RE. Although the enhancer role of this kappa B motif has been controversial, it seems that, in normal T cells, the kappa B and CD28RE sites are not a redundant pair since mutation of the kappa B site cannot be compensated for by a functional CD28RE (20). CD28 costimulation also activates transcription from the human immunodeficiency virus type 1 long-terminal repeat (21, 22) and the IL-2Ralpha gene promoter (10, 23, 24) through their respective kappa B elements. The predominant role of Rel/NF-kappa B factors in the regulation of the expression of genes crucial for immune functions has been further demonstrated by studies of knock-out mice lacking different functional Rel/NF-kappa B genes (reviewed in Ref. 25). Interestingly, mice deficient for the c-Rel protooncogene exhibited defects in production of IL-2, IL-3, GM-CSF, tumor necrosis factor-alpha , and interferon-gamma cytokines, but displayed unaltered expression of IL-2Ralpha , as well as a number of other cell surface receptors (26, 27).

In vertebrates, Rel/NF-kappa B proteins are homo- and heterodimers encoded by a small multigene family including NFKB1 (p50/p105), NFKB2 (p52/p100), RelA (p65), RelB, and c-Rel genes (reviewed in Refs. 25 and 28-30). Rel-related proteins share a conserved 300-amino acid amino-terminal domain (Rel homology domain) that encompasses sequences required for their dimerization, nuclear targeting, and binding to DNA and Ikappa B regulators. In addition, c-Rel, p65, and RelB all contain carboxyl-terminal transcriptional transactivation domains. The p50 and p52 proteins are derived from the NH2-terminal half of p105 and p100 precursors, respectively, by proteolytic cleavage. In most types of resting cells, the majority of Rel complexes are sequestered in the cytoplasm as inactive complexes associated with the Ikappa B family of ankyrin motif-rich inhibitory proteins (reviewed in Refs. 29, 31, and 32). The ankyrin domains appear to interact with Rel subunit dimerization domains, thus hindering the nuclear localizing sequence. Ikappa B proteins include Ikappa Balpha , -beta , -gamma , -epsilon , and -R proteins. p105 and p100 proteins, the COOH-terminal half of which also contains repeats of ankyrin domains, behave as Rel inhibitors as well. The molecular processes involved in the stimulation-induced release of Rel/NF-kappa B proteins have best been defined for Ikappa Balpha . Activators of NF-kappa B induce rapid phosphorylation of Ikappa Balpha followed by its ubiquitination and degradation by the proteasome complex. The Rel/NF-kappa B/Ikappa B system forms an interregulated network. Thus, following activation by inducers such as tumor necrosis factor-alpha , PMA, or IL-1, resynthesis of Ikappa Balpha , p105, and p100 proteins is up-regulated by the NF-kappa B factor, itself, via kappa B motifs present in the promoter of the Ikappa B genes (reviewed in Ref. 31). This ensures the transient activation of the factor and the replenishment of the cytoplasmic pools. CD28 costimulation appears to be distinct from the above stimuli in that it causes a sustained down-regulation of Ikappa Balpha (33, 34). It has been assumed that this continued down-regulation leads to CD28 enhanced nuclear translocation of c-Rel (35), which, in turn, causes sustained up-regulation of IL-2 gene expression. However, there has been no search for evidence of a physical association between Ikappa Balpha and c-Rel to validate this hypothesis.

In this study, using a combination of immunoblotting, metabolic labeling/coimmunoprecipitation, and EMSA analyses with a large panel of anti-Rel/NF-kappa B subunit antibodies, we have defined the major Rel complexes operating in resting human primary T lymphocytes, as well as in cells activated via CD2+CD28. We focused on the modifications specifically induced by costimulation, in comparison to those observed after CD3-mediated stimulation, and examined the consequences of these modifications on the in vitro binding activity of the corresponding complexes to the IL-2Ralpha and GM-CSF kappa B or CK-1 sites.


MATERIALS AND METHODS

T Cell Purification and Activation

T cell purification from peripheral blood and activation were performed as described previously (10). Primary T cells were maintained in RPMI, 10% fetal calf serum. Stimulations were performed with the following mAbs, used alone or in combination, at saturating concentrations. Anti-CD2 mAb 39C1.5 (rat IgG2a) and 6F10.3 (mouse IgG1) were used as purified mAbs at 10 µg/ml each. Anti-CD28 248 (mouse IgM) and anti-CD3 289 (mouse IgG2a) were obtained from Dr. A. Moretta (Cancer Institute, Genova, Italy) and were used as ascites fluid (1/400 dilution) or as purified mAb (10 µg/ml), respectively. CD3 mAb was used coated onto Petri tissue culture dishes (CD3c). T cell activation was controlled by proliferation assays and CD25/IL-2Ralpha expression.

T Cell Extracts

Cytosolic and nuclear extracts were prepared as described previously (10). Briefly cells were harvested and washed in cold Tris-buffered saline, then resuspended in 0.4 ml (per 107 cells) of buffer A (10 mM Hepes, pH 7.8, 10 mM KCl, 2 mM MgCl2, 1 mM dithiothreitol, 0.1 mM EDTA, 0.1 mM phenylmethylsulfonyl fluoride) supplemented with leupeptin (10 µg/ml; Sigma), and incubated on ice for 15 min. 25 µl of 10% Nonidet P-40 solution (Sigma) were next added, and cells were mixed vigorously for 15 s and then centrifuged (13,000 rpm, 15 s). Supernatants corresponding to the cytosolic fraction were used directly for immunoblotting. Pelleted nuclei were resuspended in 50 µl of buffer C (50 mM Hepes, pH 7.8, 50 mM KCl, 300 mM NaCl, 0.1 mM EDTA, 1 mM dithiothreitol, 0.1 mM phenylmethylsulfonyl, 10% (v/v) glycerol). After mixing for 20 min, the nuclei were centrifuged for 5 min at 13,000 rpm, and the supernatants containing the nuclear proteins were transferred to clean tubes. They were used, as such, for Western and EMSA analyses. Protein concentration was measured with a commercial kit (Bio-Rad) by the method of Bradford (36).

Antisera

Polyclonal rabbit antisera were raised against Rel/NF-kappa B peptides. They include: an anti-p52/100 NH2-terminal peptide (amino acids 4 to 16), that reacted in immunoblotting, immunoprecipitation, and EMSA; an anti-p50 nuclear localizing sequence peptide (amino acids 351 to 364), that reacted in immunoprecipitation and EMSA; an anti-p65 COOH-terminal peptide (amino acids 531 to 543), that reacted in immunoblotting, immunoprecipitation, and EMSA; and an anti-c-Rel peptide directed against both an internal (amino acids 151 to 165) and a COOH-terminal (amino acids 606 to 619) amino acid stretch, that reacted in immunoblotting and immunoprecipitation. Antisera against p50/105 NH2-terminal peptide were generous gifts from Michael Karin (San Diego School of Medicine, La Jolla, CA (37) and John Hiscott, Lady Davis institute, Montreal, Canada). Anti-c-Rel peptide 1135 was a kind gift from Nancy Rice (National Cancer Institute, Frederick, MD) (38). Polyclonal rabbit antisera p65H and Ikappa BH were raised against recombinant p65 and Ikappa B (6X His, Novagen, R & D System) and were immunoprecipitating. Purified anti-Ikappa Balpha COOH terminus (sc-371), anti-Sp1 (sc-59X) and -Sp3 (sc-644) antisera were purchased from Santa Cruz Biotechnology.

Metabolic Radiolabeling, Immunoprecipitations, and SDS-Polyacrylamide Gel Electrophoresis

Cells were washed twice, prepulsed for 45 min in methionine (Met) and cysteine (Cys)-free RPMI, 10% dialyzed fetal calf serum, and pulsed for 15 min in the above medium supplemented with a 1:1 mixture of [35S]Met and -Cys (2 mCi/ml/5.107 cells). Labeling was stopped by a 10-fold dilution of the samples in complete RPMI medium supplemented with 4 mM Met and Cys. Labeled cells were lysed (whole cell lysate) in modified RIPA lysis buffer R (25 mM Tris, pH 7.4, 50 mM NaCl, 0.5% deoxycholate, 0.5% Nonidet P-40, 0.1% SDS, and 2 mM EDTA) supplemented with protease (10 µg/ml pepstatin, antipain, and aprotinin and 0.5 mM phenylmethylsulfonyl fluoride) and phosphatase inhibitors (100 µM orthovanadate and molybdate). Cell extracts were first treated with protein A-Sepharose (50 µl sedimented beads) and normal rabbit serum (1/500 dilution), for 1 h at 4 °C. Precleared supernatants were treated with immunoprecipitating antibodies (1/500 dilution) overnight at 4 °C, followed by protein A-Sepharose (50 µl, 1 h at 4 °C). Immunoprecipitates were then washed four times in complete extraction buffer. For reprecipitations, washed immunoprecipitates were boiled in dissociating buffer R' (buffer R lacking SDS, supplemented with 1% SDS and 0.5% mercaptoethanol) for 3 min. Samples were next diluted 10 times in complete buffer R' supplemented with proteases and phosphatase inhibitors, and rapidly treated with protein A-Sepharose (50 µl, 30 min at 4 °C) to get rid of the first immunoprecipitating antibody. Supernatants were then treated with the second antibody (5 h at 4 °C), followed by protein A-Sepharose (50 µl, 1 h at 4 °C). Proteins bound to washed protein A-Sepharose beads were eluted and reduced by warming the samples at 95 °C for 3 min in sample buffer containing 5% mercaptoethanol. Samples were next cooled to room temperature before alkylation with 5 mM iodoacetamide and fractionation by SDS-polyacrylamide gel electrophoresis on a 7.5 to 12% acrylamide gradient gel. 14C-Methylated molecular weight markers (Amersham) were run in parallel. After electrophoresis, gels were treated with an intensifying solution (Amplify, Amersham) for fluorography. For quantifications, dried gels were analyzed with a Molecular ImagerTM PhosphorImaging System (Bio-Rad).

Immunoblotting Analysis

Cell extracts were boiled in reducing buffer for 3 min before loading onto a 10% SDS-polyacrylamide gel. An equal amount of proteins (15 µg) were loaded per well. Following electrophoresis, the gels were transferred onto an Immobilon-P membrane (Millipore) at 50 V for 18 h using a transblot apparatus (Bio-Rad). Residual binding sites were blocked by incubation for 2 h at room temperature in phosphate-buffered saline supplemented with 5% nonfat dry milk. After incubation with antiserum, filters were washed six times with phosphate-buffered saline, 0.1% Tween for 5 min at room temperature. Then peroxidase-labeled anti-rabbit serum from donkey preformed complex was added (1/10,000 dilution) and incubated at room temperature for 1 h. After washing as described above, filters were reacted 1 min with chemiluminescent substrate luminol (ECL kit; Amersham) and revealed by brief exposure (15 to 60 s) using autoradiography films (Kodak X-Omat). For quantification, films were scanned by densitometry using a BioImage whole band analyzer (Millipore Co.).

Oligonucleotides

The sequences of the oligonucleotides were as follows (kappa B or kappa B-like (CK-1) motifs are in boldface; the mutated (m) nucleotides used to disrupt the binding sites are underlined): IL-2Ralpha kappa B, CAACGGCAGGGGAATCTCCCTCTCCTT; IL-2Ralpha kappa Bm, CAACGGCAGCTCAATCTCCCTCTCCTT; GM-CSF kappa B/GC, GGGAGGCGGGGGAACTACCTGAGT; GM-CSF kappa B/GCm, GGGAGGCGGCTCAACTACCTGAGT; GM-CSF CK-1, AACTGTGGAATCTCCTGGCCC; GM-CSF CK-1m, AACTGCTCAATCTCCTGGCCC; SV40 Sp1/GC-box, CGATGGGCGGAGTTAGGGACGGGA.

Electrophoretic Mobility Shift Assay

Oligonucleotides were endlabeled using [gamma -32P]ATP and polynucleotide kinase, annealed, and purified on a chroma-spin column (CLONTECH) for isolation of double-stranded probes. Reactions with equal amounts of nuclear extracts (1 µg/reaction) were performed in a 20-µl final volume in buffer C containing 50,000 cpm probe, 0.25 µg of polydeoxyinosinic-deoxycytidylic acid, and 20 µg of bovine serum albumin, for 30 min at room temperature. Unlabeled double-stranded competitor, specific antiserum, or recombinant protein was preincubated with cell extracts 20 min prior to addition of the probe. Binding reaction mixtures were loaded on a 5% nondenaturing polyacrylamide gel in 0.25 × TBE (1 × TBE, 89 mM Tris, 89 mM boric acid, 1 mM EDTA). After electrophoresis, dried gels were exposed at -80 °C or room temperature, with or without intensifying screen, according to the intensity of the radioactive signals.


RESULTS

Costimulation through CD2+CD28 Induces the Sustained Overexpression of Nuclear c-Rel and NFKB2 p52 Proteins at Maximal T Cell Proliferation

We previously observed that the stimulation of primary T lymphocytes with CD2+CD28 mAbs induces a high level of proliferation and IL-2 secretion as compared with stimulation by the association of CD28 plus coated-CD3 (CD3c) mAbs (10). Both proliferative responses lasted for more than 14 days. The two combined stimuli induced high level expression of IL-2Ralpha chain, but CD2+CD28 activation induced the most sustained phenotype. In sharp contrast, CD3 alone induced a much weaker and shorter proliferative response. Costimulation of primary T lymphocytes by CD2+CD28 mAbs was chosen, therefore, as a model for activation and long-term maintenance of proliferation. As an initial insight into the physiological role of NF-kappa B, we demonstrated that the increased expression of IL-2Ralpha transcription is associated with the long-term persistence in the nucleus of two inducible IL-2Ralpha kappa B motif binding complexes, namely NF-kappa B p50/p65 as well as an ill-defined protein-DNA complex, and of constitutive (p50)2 homodimers. NF-kappa B up-regulation was correlated with an increase in the level of the nuclear p50 subunit (23). Using an enlarged set of serological tools, we have now extended our analysis to all four human Rel proteins and have compared their nuclear levels in the course of CD2+CD28 versus CD3 stimulation.

Immunoblots using polyclonal antipeptides directed against p52/100N, p50/105N, p65C, and c-Rel are shown in Fig. 1A. In addition to constitutive nuclear expression of the p50 subunit, a low level of p65 and c-Rel subunit(s) was detected in nuclei from unstimulated T cells. This low level of detection, which as previously been observed in some cases (39), and not in others (17, 35), might reflect the presence of non-truly resting cells in some purified T cell populations. Activation of T lymphocytes through either CD2+CD28 or CD3 led to an increase in the level of all of the subunits peaking at 5 to 16 h for p65 and 96 h for p52, p50, and c-Rel. However, overexpression was more sustained after costimulation. This is particularly striking for p52 and c-Rel, the amounts of which were still strongly increased at day 8. Moreover, maximal induction of these two subunits was higher than that obtained after CD3 stimulation alone. To assess whether the general decrease of Rel nuclear proteins in long-term CD3-stimulated lymphocytes reflected some mechanism of down-regulation or an overall decrease in the rate of the cellular metabolism, each corresponding cytosolic pool was examined. As shown in Fig. 1B, sustained overexpression of p100 and p105 precursors was observed, while the level of p65 subunit remained constant. These profiles favor a model by which nuclear down-expression is post-translationally regulated. It has been proposed that CD28 costimulation induces sustained down-regulation of Ikappa Balpha (33) and Ikappa Bbeta (34, 40), leading to enhanced translocation of c-Rel. Our data support this hypothesis (Fig. 1C, lanes 1-7). Conversely, the transient character of nuclear c-Rel in CD3-stimulated cells could rely on the replenishment of Ikappa Bs cytosolic pools, as suggested by the unchanged level of both inhibitors compared with costimulation by CD2+CD28 (Fig. 1C, lanes 8-13). Examination of cytosolic profiles in CD3-stimulated cells (Fig. 1B) revealed, however, that the premature decay of nuclear c-Rel results from decreased neosynthesis rather than increased cytosolic retention. Finally, comparison of cytosolic and nuclear profiles from both CD3- and CD2+CD28-stimulated cells indicated an increase with a similar time course of c-Rel and p52 suggesting that their up-regulation is neosynthesis-mediated (this figure and data not shown). This possibility is reinforced by our finding of a correlated increase in protein neosynthesis, as assessed by pulse-radiolabeling (data not shown).


Fig. 1. Time course modulation of Rel/Ikappa B subunits in CD2+CD28- or CD3-stimulated primary T cells. Purified primary human T lymphocytes were stimulated with either anti-CD2 (39C1.5+6F10.3; 10 µg/ml each) plus anti-CD28 (248; ascites 1/400 dilution) or coated anti-CD3 (289; 10 µg/ml) for the times indicated above the lanes and separated into nuclear and cytosolic fractions, as described under "Materials and Methods." After transfer to an Immunobilon-P membrane, these extracts (15 µg/lane) were probed with anti-peptides directed against p100/p52(N), p105/p50(N), p65(C), c-Rel (1135), and Ikappa Balpha (sc-371). A, Rel proteins in nuclear extracts from CD2+CD28- or CD3-stimulated T cells; p105, p100, and Ikappa Balpha proteins were not detected. B, Rel proteins in cytolosic extracts from CD3c-stimulated T cells. C, Ikappa B proteins in cytosolic extracts from CD2+CD28- or CD3-stimulated T cells. p65 was also revealed as invariable reference. D, quantifications of T cell proliferative response and of Rel-subunit nuclear expression. Proliferative response was assessed, at each activation time, by the amount of [3H]thymidine incorporated for 6 h in 1 × 105 cells and was reported, as percent of the incorporation value obtained in unstimulated cells. Autoradiography films corresponding to nuclear immunoblots were quantified by densitometry. Value of each band is reported as percent of the value obtained from unstimulated cell extracts.
[View Larger Version of this Image (47K GIF file)]

Increased nuclear expression of p50, p65, and c-Rel proteins after costimulation with anti-CD28 mAb has been reported by others in a similar model system (17, 35). However, in the previous studies, the time period analyzed did not exceed 21 h and, therefore, precluded a comparison between Rel protein up-regulation and the onset of active proliferation of the cells, which occurs later. The increased detection of nuclear p52, p50, and c-Rel at a time when cells started dividing, led us perform this comparison. The rate of proliferation of T lymphocytes was measured by [3H]thymidine incorporation and compared with the amount of Rel/NF-kappa B subunits quantified by densitometry scanning of the gels. Fig. 1D shows a striking correlation between maximal T cell proliferation and maximal p52, p50, and c-Rel nuclear expression.

Newly Synthesized p65 and c-Rel Proteins Differentially Interact with Ikappa B Proteins

Given the time course of subunit modifications detected in nuclei from T lymphocytes stimulated by anti-CD2+CD28 mAbs, we analyzed Rel protein interactions in resting or proliferating T cells. Steady-state labeling of the cells, followed by extraction of cytosolic and nuclear fractions and exhaustive immunoprecipitations with various antisera directed at Rel/Ikappa B subunits revealed many changes upon activation (data not shown). Hence, in resting cells, the vast majority of Rel proteins detected corresponded to p65 subunits retained in the cytosol through interactions with p105, p100, and Ikappa B proteins. Some nuclear Rel proteins became detectable following activation, likely corresponding to p50 and c-Rel homodimers and p50/p65 heterodimers. However, even in activated T cells, a major proportion of the factors appeared sequestered in the cytosol.

To validate our first conclusions on the composition of Rel/NF-kappa B complexes in CD2+CD28-activated T lymphocytes and evaluate the contribution of Ikappa B proteins, we performed a double immunoprecipitation analysis. Activated T cells, at day 6, were pulse-labeled with [35S]methionine and -cysteine for 15 min to detect newly formed interactions. A whole cell lysate was prepared using a modified RIPA solution of lower stringency. It was immunoprecipitated by either pooled anti-p65 (C and H) or anti-c-Rel antibodies (IP1). Washed precipitates were dissociated from protein A-Sepharose beads by boiling in 1% SDS and reprecipitated by all of the other anti-subunits reagents (IP2). Results in Fig. 2 indicate that some newly synthesized p65 subunits indeed associate with either p100 or p105 as well as, to a large extent, with Ikappa Balpha proteins (Fig. 2, lanes 3, 4, and 6, respectively). Similarly to p65, subpopulations of newly synthesized c-Rel proteins appeared to interact with either of the three Ikappa B proteins (Fig. 2, lanes 9, 10, and 12), although little association was detected, in particular with p105 and Ikappa Balpha , compared with p65. The slightly higher relative labeling of c-Rel, due to greater (1.4-fold) methionine and cysteine content compared with p65, cannot alone account for the major differences in codetection. Rather, the present data suggest that newly synthesized p65 proteins are predominantly sequestrated by p105 and Ikappa Balpha inhibitors, whereas c-Rel subunits display a much lower affinity for these proteins. Similar conclusions could be drawn from the IP1 profiles of resting T lymphocytes (result not shown), although double immunoprecipitations could not be carried out because of limiting c-Rel detection. Results in Fig. 2 also provide evidence for a subpopulation of p65/c-Rel heterodimers, as shown by the anti-c-Rel or anti-p65 IP2 profiles (Fig. 2, lanes 5 and 11). Since p65 protein was reproducibly detected in the anti-c-Rel IP2 precipitate, the two subunits might display a high affinity for each other and thus, either incompletely dissociate in SDS or reassociate in the course of the IP2.


Fig. 2. Characterization of p65 and c-Rel Rel/Ikappa B partners. Purified primary human T lymphocytes, that had been activated for 6 days via CD2+CD28, were pulse-labeled with a 1:1 mixture of [35S]Met and Cys and lysed in modified RIPA buffer, as described under "Materials and Methods." Precleared whole cell extracts (5 × 107 cell equivalents) were immunoprecipitated overnight with either pooled p65 (C and H) or c-Rel antibodies (IP1) and washed coprecipitates were disrupted in SDS and reprecipitated with the antibodies indicated above the lanes (IP2), as described under "Materials and Methods." Washed precipitates were analyzed by SDS-polyacrylamide gel electrophoresis and autoradiography (lanes 1 and 7, 6 days exposure; other lanes, 3 weeks exposure).
[View Larger Version of this Image (83K GIF file)]

Costimulation through CD2+CD28 Induces Sustained in Vitro Occupancy of GM-CSF kappa B and CK-1 Sites Compared with Stimulation through CD3 Alone

The functional consequences of the major changes in the composition and regulation of Rel complexes were analyzed at the level of Rel protein DNA binding to GM-CSF kappa B and CK-1, as well as IL-2Ralpha kappa B sites. Results were compared with those obtained after single stimulation of the cells with coated anti-CD3 antibodies. kappa B-binding proteins present in nuclear extracts were detected by EMSA with relevant synthetic oligonucleotide probes. Note that the GM-CSF kappa B probe encompasses a consensus decameric kappa B site overlapping GC-rich and CK-2 (CLE-2) elements and, therefore, is a potential target for Rel/NF-kappa B, Sp1, and CREB·activating transcription factor proteins (41). However, our EMSA conditions, set-up to detect Rel/NF-kappa B-DNA complexes, were not optimized for CREB·activating transcription factor complex formation (42).

As illustrated in Fig. 3, clear differences were observed in the occupancy of the GM-CSF sites by nuclear proteins from CD2+CD28- versus CD3-stimulated cells. EMSAs performed with the kappa B/GC motif and nuclear extracts from unstimulated T lymphocytes gave three major retarded bands (A, C, and D). Both stimuli led to the early appearance (30 min) of a fourth DNA-protein complex (B). However, this induced binding activity was more sustained after costimulation. No strong occupancy of the CK-1 site was detected in resting cells. A major retarded band (E), together with a weaker band (F), was detected 5 h after activation by both stimuli. However, whereas this DNA binding activity appeared transient in the case of CD3 stimulation, a second wave was observed (from day 4 to 6) after CD2+CD28 costimulation. Conversely, as observed earlier (10), both stimuli induced a comparable long-lasting binding to the IL-2Ralpha kappa B site. Hence, a similar pattern of constitutive (A and D) and inducible (B) retarded bands was obtained.


Fig. 3. In vitro occupancy of GM-CSF (kappa B/GC and CK-1) and IL-2Ralpha kappa B sites by nuclear proteins from resting, and CD2+CD28- or CD3-stimulated primary T cells. Purified primary human T lymphocytes were stimulated by anti-CD2+CD28 or coated anti-CD3 antibodies, as for Fig. 1. At the times indicated above the lanes, nuclear extracts were prepared and subjected to EMSA using constant amounts of proteins (1 µg/reaction) and labeled GM-CSF kappa B or CK-1 and IL-2Ralpha probes, as described under "Materials and Methods." Only the upper parts of the gels containing the retarded complexes are represented. A-F, retarded complexes. Similar complexes (as characterized in Figs. 5, 6, 7) are tentatively given the same letter.
[View Larger Version of this Image (59K GIF file)]

We performed competition experiments with sets of specific, wild-type and mutated, or nonspecific, unlabeled oligonucleotides to determine the DNA binding specificity of the complexes binding to each of the probes. As shown in Fig. 4, upper panel, a 100-fold excess of unlabeled oligonucleotides corresponding to wild-type GM-CSF kappa B/GC (lane 2) or IL-2Ralpha kappa B (lane 4) totally abrogated bands B and D, whereas the intensities of bands A and C were only partially diminished. A similar excess of GM-CSF kappa B/GC oligonucleotide mutated in the kappa B motif had no effect on the four bands (Fig. 4, lane 3). An Sp1/GC-box oligonucleotide totally abrogated bands A and C (Fig. 4, lane 5). Altogether, these data indicate that bands B and D correspond to kappa B-binding complexes and bands A and C to GC-box binding ones. They suggest, in addition, that the efficiency of binding of the latter complexes might in part be influenced by nearby kappa B binding complexes. Results in the middle panel show that an excess of unlabeled oligonucleotides corresponding to wild-type GM-CSF CK-1 (lane 2) or IL-2Ralpha (lane 4) motifs totally abrogated bands E and F, whereas CK-1 site mutated in the kappa B-like sequence (lane 2) or Sp1 site (lane 5) had no effect. Bands A and B correspond, therefore, to complexes specific for the kappa B-like sequence. Finally, results in the lower panel show that an excess of wild-type IL-2Ralpha (lane 2) or GM-CSF kappa B/GC (lane 4) oligonucleotides totally suppressed bands B and D and partially diminished band A, whereas IL-2Ralpha oligonucleotide mutated in the kappa B consensus had no effect (lane 3). Of note is the fact that, although the IL-2Ralpha motif competed for protein binding to GM-CSF CK-1 probe, GM-CSF CK-1 motif did not compete for the binding to IL-2Ralpha probe (result not shown). This asymmetry is likely due to the weak affinity of Rel proteins for CK-1 sites (16). Unexpectedly, although the IL-2Ralpha kappa B site does not contain a prototypical GC-box, our Sp1 consensus oligonucleotide totally abrogated band A (lane 5), but left bands B and C intact. Altogether, these inhibition patterns suggest that complexes B and D contain kappa B-specific proteins and complex A, proteins of the GC-box binding family. We found, in addition, that recombinant Sp1 proteins comigrated with band A and, therefore, directly recognize the IL-2Ralpha motif (lane 6).


Fig. 4. DNA-binding specificity of the protein complexes binding to GM-CSF (kappa B/GC and CK-1) and IL-2Ralpha kappa B sites. Cell activation, nuclear extraction, and EMSA were performed as above. For competition, nuclear extracts were incubated for 30 min (room temperature) with excess cold oligonucleotides (indicated above the lanes), before the addition of labeled probe. Recombinant Sp1 (rSp1) protein (2 ng, Promega) was added together with labeled probe (lane 6, lower panel). Upper panel, nuclear extracts from resting T cells; middle and lower panels, nuclear extracts from CD2+CD28-stimulated T cells, at day 6.
[View Larger Version of this Image (41K GIF file)]

Costimulation through CD2+CD28 Induces the Specific in Vitro Occupancy of GM-CSF kappa B and CK-1 Sites by c-Rel and NFKB2 p52 Proteins

DNA-protein complexes were next characterized by including different anti-NF-kappa B or -Sp protein antisera in binding reaction mixtures. Fig. 5 reports the analysis of the specific complexes formed with a GM-CSF kappa B probe and nuclear extracts from unstimulated T lymphocytes, or cells in the early (30 min) or late (day 6) activation phase following either CD2+CD28 or CD3 triggering. Constitutive complexes D and A supershifted in the presence of anti-p50 (Fig. 5, lane 2, all panels) and anti-Sp1 (Fig. 5, lane 10, all panels) antisera, respectively, but were unaffected by all of the other anti-Rel/NF-kappa B reagents (Fig. 5, lanes 4, 7, and 8, panels 1-5). Therefore, they likely contain p50 homodimers and Sp1 protein, respectively. Constitutive complex C contains Sp3 proteins since it was abrogated in the presence of anti-Sp3 antiserum (data not shown). From 30 min on to day 6 following activation by both stimuli, inducible band B was diminished, or abrogated and supershifted, with anti-p50 or anti-p65 antisera, respectively (Fig. 5, lanes 2 and 4, panels 2-5) and, thus, contained p50/p65 heterodimers. In addition, band B was greatly diminished when anti-c-Rel was added to nuclear extracts of costimulated cells, at day 6 of activation (Fig. 5, lane 8, panel 4), suggesting the formation of c-Rel containing DNA-binding complexes in the proliferation phase. A parallel induction of p52 containing complexes is supported by the supershift of band C' upon addition of anti-p52 antibody (Fig. 5, lane 7, panel 4).


Fig. 5. Characterization of GM-CSF kappa B/GC-binding proteins from resting and CD2+CD28- or CD3-activated primary T cells. Cell activation, nuclear extraction, and EMSA were performed as above. Nuclear extracts were incubated for 20 min, at 4 °C, with preimmune and corresponding polyclonal antisera (in case of our own reagents) or with antisera alone (in case of purchased reagents), as indicated on above the lanes, before the addition of labeled probe. Left: ns, DNA binding activity contributed by rabbit antisera; A, B, C, C', and D, kappa B/GC-specific complexes. Symbols at right, identified protein-DNA complexes (open) and corresponding supershifted bands (filled): circles, p50; squares, p65; upright triangle, c-Rel; inverted triangles; p52; arrowheads, Sp1.
[View Larger Version of this Image (85K GIF file)]

Proteins specifically binding to the GM-CSF CK-1 site are analyzed in Fig. 6. Major complex E, induced after a 5-h stimulation of the cells with either anti-CD2+CD28 (panel 1) or -CD3c (panel 2) antibodies, was supershifted or greatly diminished when anti-p52 (Fig. 6, lane 3) or anti-c-Rel (Fig. 6, lane 4) antibodies were added to the cell extracts. None of the other anti-Rel/NF-kappa B reagents affected complex E migration, suggesting that it mostly contains p52/c-Rel heterodimers. Similar conclusions could be drawn on complex E formed in the presence of nuclear extracts from costimulated cells at day 6 (Fig. 6, panel 3, lanes 3 and 4). Although minor complex F contains kappa B-binding proteins (Fig. 4), none of our antisera had a clear effect on its migration. More reagents, recognizing a larger set of epitopes, might thus be needed to delineate its composition.


Fig. 6. Characterization of GM-CSF CK-1-binding proteins from CD2+CD28- or CD3-activated T cells. Cell activation, nuclear extraction, and serological characterization of DNA-binding protein complexes by EMSA was performed as for Fig. 7. Left: ns, DNA binding activity contributed by antisera; E and F, CK-1-binding complexes; symbols at right, identified protein-DNA complexes (open) and corresponding supershifted bands (filled): upright triangle, c-Rel; inverted triangles, p52; ×, unidentified complex.
[View Larger Version of this Image (58K GIF file)]

Proteins specifically binding to the IL-2Ralpha kappa B site were next analyzed (Fig. 7). Constitutive complex A, retarded similarly to Sp1 complex (Fig. 4), was supershifted when nuclear extracts were mixed with anti-Sp1 antibody and indeed contained Sp1 proteins (data not shown). Constitutive complex D was supershifted by anti-p50 but not by other anti-Rel/NF-kappa B reagents (Fig. 7, panels 1-5, compare lane 2 to lanes 4, 7, and 8), and, thus, likely contained p50 homodimers. From 30 min to 6 days following activation by both types of stimuli, inducible complex B was abrogated by both anti-p50 and anti-p65 antibodies (Fig. 7, panels 1-5, lanes 2 and 4, respectively) and thus contained p50/p65 heterodimers. Unlike the GM-CSF kappa B site, the IL-2Ralpha site did not seem to bind significant amounts of c-Rel or NFKB2 p52 proteins. This was unexpected in view of earlier reports on c-Rel binding to the IL-2Ralpha kappa B site (43, 44) and by the fact that this motif competed for the binding of p52/c-Rel complexes to the GM-CSF CK-1 probe (Fig. 4, middle panel). The latter discrepancy suggests that the IL-2Ralpha probe can bind minor undetected levels of p52/c-Rel proteins and displace, when in large excess, their binding to the low affinity CK-1 motif. Table I summarizes the composition of the DNA-protein complexes.


Fig. 7. Characterization of IL-2Ralpha kappa B-binding proteins from resting and CD2+CD28- or CD3-activated primary T cells. Cell activation, nuclear extraction, and serological characterization of DNA-binding protein complexes by EMSA were performed as for Fig. 6. Left: ns, DNA binding activity contributed by antisera; A, B, and D, kappa B-binding complexes; symbols at right, identified DNA-protein complexes (open) and corresponding supershifted band (filled): circles, p50; squares, p65; arrowhead, Sp1.
[View Larger Version of this Image (75K GIF file)]

Table I. Preferential Rel/NF-kappa B DNA-binding complexes in human primary T cells


Target gene Site Resting t0 CD3c
CD2+CD28
30 min Day 6 30 min Day 6 

IL-2Ralpha  kappa B (p50)2 (p50)2 (p50)2 (p50)2 (p50)2
p50/p65a p50/p65 p50/p65 p50/p65 p50/p65
 kappa B/GC (p50)2 (p50)2 (p50)2 (p50)2 (p50)2
p50/p65a p50/p65 p50/p65 p50/p65 p50/p65
p65/c-Relb
GM-CSF (p52)2>b
(p52/p65b
p52/c-Relb
CK-1 Undc Und Und Und p52/c-Relb

a Low level of NF-kappa B p50/p65 heterodimers detected in resting T cells.
b Tentative Rel/NF-kappa B complexes specifically induced through CD28 costimulation are in boldface.
c Und, undetected.


DISCUSSION

Induction of Rel Proteins in Primary Human T Lymphocytes Stimulated via TcR/CD3 or CD2+CD28 Pathways

Activators of Rel family factors are known to trigger an early nuclear translocation of NF-kappa B p50/p65 heterodimers from pre-existing cytosolic pools. The present EMSA analyses confirm that stimulation of primary human T cells through either TcR/CD3 or CD2+CD28 induces the rapid activation of this complex (23, 35, 39). It appears likely, as previously suggested by others (39), that these activation pathways only mobilize a minor pool of factors undetected in our immunoblot analysis. Also, we had no evidence for early acceleration of c-Rel translocation upon costimulation, as reported for Jurkat T cells stimulated with PMA plus anti-CD28 (33). These differences may relate to cell type or to the fact that anti-CD2 plus anti-CD28 costimuli are weaker c-Rel inducers than PMA plus anti-CD28 (35). Strikingly, all significant modifications, except RelA(p65) detection which peaked at 5 to 16 h, occurred in the late phase of activation. Hence, p50, p52, and c-Rel nuclear levels were maximal at day 4 after single or costimulation. These increases correlated with a similar delayed increase of cytosolic p105, p100, and c-Rel pools, suggesting that the up-regulation largely occurs via neosynthesis. Conversely, as described previously (35), no significant change in the level of cytosolic p65 was observed following either form of stimulation favoring a model of post-translational modification. These conclusions are reinforced by our finding of an increased rate of biosynthetic labeling of p105, p100, and c-Rel compared with p65 (data not shown). Increased neosynthesis of p50/105, p52/100, and c-Rel might result from increased transcription of NFKB1, NFKB2, and REL genes, which, unlike that encoding p65, are potential targets for positive Rel/NF-kappa B autoregulation (45-48). Late autoregulated transcription is probably indirectly induced following either form of stimulation, as reported for the TcR/CD3-mediated delayed increase in p50 and c-Rel mRNA levels through autocrine secretion of the NF-kappa B inducer, tumor necrosis factor-alpha (39, 49). Importantly, our data show that costimulation induced a more sustained nuclear expression of all Rel proteins than TcR/CD3-mediated stimulation. We conclude from comparison of cytosolic and nuclear pools that long-term up-regulation of Rel protein nuclear expression relies on several mechanisms. Sustained c-Rel nuclear expression appears to be supported mostly by sustained neosynthesis and might require cooperation of transcription factors that are specifically induced, either directly or indirectly, via CD28 costimulation. Alternatively, sustained c-Rel neosynthesis may result from CD28-induced stabilization of its mRNA, as observed for interleukin mRNAs (9, 12). In contrast, sustained p50, p52, and p65 nuclear expression appears to rely on post-translational regulation which is not maintained in CD3-stimulated cells.

Ikappa B Proteins May Differentially Modulate (RelA)p65 and c-Rel Nuclear Expression in CD28-costimulated Primary T Lymphocytes

Ikappa Balpha and Ikappa Bbeta are two major cytoplasmic inhibitors which exhibit regulatory properties toward p65 and c-Rel. Ikappa Balpha degradation appears to be induced by most stimuli and regulates the immediate activation of NF-kappa B. In contrast, Ikappa Bbeta degradation might require signals leading to persistent activation, such as lipopolysaccharide and IL-1 (50). The CD28 costimulatory signal has been shown to augment the activation of Rel factors by enhancing the degradation of Ikappa Balpha , as well as promoting a rapid degradation of Ikappa Bbeta (34). We show here that, similar to Ikappa Balpha (33), Ikappa Bbeta expression is also down-regulated for up to a week following CD28 costimulation. Two recent reports suggest that Ikappa Bbeta , rather than Ikappa Balpha , is the regulator of c-Rel nuclear translocation in T cells (51, 52). Our data on the physical interactions of newly synthesized p65 and c-Rel proteins with Rel/Ikappa B partners fit with this possibility. Thus, contrary to p65 which strongly interacted with Ikappa Balpha , c-Rel appeared to display little affinity for this inhibitor. In addition, c-Rel, unlike p65, only weakly interacted with the p105 or p100 precursors. Hence, similar to Ikappa Balpha and -beta , these inhibitors seem to mediate Rel/NF-kappa B cytosolic retention in a subunit-, as well as a cell- and stimulus-specific manner (53, 54).

CD28 Costimulation Specifically Induces and Sustains the in Vitro Binding of c-Rel and NFKB2 p52 Proteins to GM-CSF kappa B and CK-1 Sites

The CD28 pathway might specifically contribute to Rel-mediated gene activation by, nonexclusively: 1) amplifying or sustaining the binding of Rel/NF-kappa B factors induced by TcR/CD3 stimulation; 2) modifying the composition of Rel/NF-kappa B dimers that bind to sites targeted by TcR/CD3-derived signals; and 3) inducing the binding of new Rel/NF-kappa B factors to new kappa B (or kappa B-related) sites. The latter possibility was supported by the identification, in the promoter of the IL-2 gene, of the kappa B-like CD28-responsive element (CD28RE) (14-16) which involves CD28-up-regulated c-Rel protein in addition to NF-kappa B subunits (17). The unique relevance of CD28RE to the CD28 pathway has been questioned, however, by the finding that the formation of the CD28-responsive complex was not strictly induced by CD28 costimulation (35, 55) and, that the alteration of CD28RE did not abrogate the increased IL-2 transcription induced by CD28 natural ligands (20). Furthermore, recent independent data have brought to light uncertainties on the composition of CD28RC by providing evidence that NFAT, but not Rel/NF-kappa B proteins, bind to CD28RE upon up-regulation of T cells via CD28 or via Tax protein of human T cell leukemia virus type 1 (56, 57). The IL-2Ralpha kappa B site might be differentially occupied by Rel proteins upon single stimulation through TcR/CD3 or costimulation through CD28, as it was reported to mediate the activation of the IL-2Ralpha gene promoter via both NF-kappa B (10) and c-Rel (43, 44). However, one can question the implication of c-Rel, since IL-2Ralpha is normally expressed on T cells from c-Rel deficient mice (27). To clarify some of these issues, we examined the consequences of TcR/CD3- or CD2+CD28-induced Rel subunit modifications on the in vitro binding of these proteins to the kappa B and kappa B-like (CK-1) sites of the GM-CSF promoter (16, 41, 58), which resemble the kappa B/CD28RE sites of the IL-2 promoter. We also reinvestigated Rel protein binding to the kappa B site of the IL-2Ralpha promoter. Our data indicate that in resting primary T lymphocytes, the GM-CSF kappa B site is essentially bound by p50 homodimers, similar to the IL-2Ralpha kappa B site (Refs. 10 and 23, and this study). This finding is in line with the silencing role of p50 homodimers (24, 44, 59). Both TcR/CD3 and CD2+CD28 stimulation triggered the binding of NF-kappa B p50/p65 heterodimers to GM-CSF kappa B sites, from immediate (30 min) to late (day 6) activation phases. Only CD2+CD28 costimulation enabled binding of c-Rel and p52 proteins (likely as c-Rel/p52 and c-Rel/p65 heterodimers) at the late phase. CD2+CD28 long-term induction of Rel binding to the GM-CSF kappa B site resembles the induction mediated by HTLV-1 Tax protein. Hence, whereas stimulation of Jurkat T cells by PMA-Ca2+ ionophore only induced binding of p65 to this site, costimulation via Tax activated both p65 and c-Rel binding (41). Our results are in contrast with those that demonstrate the absence of c-Rel binding to the GM-CSF kappa B site after costimulation via CD28. (60). This discrepancy might reside in the origin of the cell, i.e. tumor cell line versus primary T cells, or, most importantly, the differences in time points of analysis, i.e. few hours versus several days post-stimulation. Unlike GM-CSF kappa B sites and similar to the related CD28RE site, the GM-CSF CK-1 site is unbound in resting T lymphocytes, a finding relevant to the lack of affinity of p50 homodimers for non-consensus kappa B-related sequences (17, 61). As expected for a CD28RE-related site (19), the GM-CSF CK-1 site did not bind NF-kappa B heterodimers from either TcR/CD3- or CD2+CD28-stimulated T cells. Strikingly, both types of stimulation initiated an early wave of binding (detected at 5 h time point) of c-Rel and p52 proteins (likely as c-Rel/p52 heterodimers) which correlates in time with, and might thus reflect, the transient autoregulated mRNA increases that we observed (data not shown). Here again, EMSAs appear to enable the detection of Rel nuclear changes that were not evident by immunoblotting. Costimulation, but not TcR/CD3 stimulation, induced a second wave of binding of c-Rel and p52 in late activation phase (day 6 time point). Altogether, our data suggest that costimulation of primary T cells via CD28 specifically sustains the nuclear expression of both proteins and induce their long-term binding to both GM-CSF kappa B and CK-I sites. The implication of c-Rel in GM-CSF gene up-regulation has best been suggested by the lack of secretion of this growth factor in Rel-/- T cells costimulated via CD28 (27). Little information, however, is available on a possible up-regulatory role of p52 protein. Although such a role should be substantiated by transcriptional activation assays, our finding that, similar to c-Rel, p52 nuclear overexpression parallels T cell proliferation, suggests that both proteins are involved in the up-regulation of growth regulating interleukin genes. In line with this possibility, p52 (NFKB2/lyt-10) has been implicated in proliferative diseases (62) and is overproduced in Tax expressing transformed cells (63). RelA(p65) has been reported as a strong transcriptional activator of CD28RE within the IL-2 promoter (18) and was shown to bind to the GM-CSF CK-1 site upon CD28-mediated costimulation (60). We had no indication on the binding of p65 to GM-CSF CK-1 site in our activation model, although a serological bias of detection cannot be ruled out. Thus, we could not elucidate the composition of the faster migrating inducible CK-1 complex, although competition assays indicated that it contains kappa B-binding proteins. Unlike the case of GM-CSF kappa B and CK-1 sites, we did not detect any specific effect of CD2+CD28 costimulation on Rel protein binding to the IL-2Ralpha kappa B site. As previously observed (10), both TcR/CD3 and costimulation induced an immediate and long-lasting binding of p50/p65 heterodimers, but neither significant c-Rel, nor p52 binding was detected. This contrasts with the reported activation by c-Rel of the IL-2Ralpha kappa B promoter in cotransfected cells (43, 44), but fits with the finding that Rel-/- mice express normal amounts of surface of IL-2Ralpha genes (27).

The GM-CSF kappa B site overlaps a poly(GC)-rich element, which is a potential target for GC-binding proteins. It was shown that within the murine promoter, the GC-box binds predominantly and constitutively Sp1 factor and is required for full stimulation of transcription elicited by PMA/A23187 treatment (58). In this report, we found a similar constitutive binding of Sp1 factor to the human kappa B/GC probe and detected, in addition, the binding of Sp3 at the resting and nonproliferating phase (data no shown). Given the reported repressor role of Sp3 (64), we hypothesize that a balance between Sp3 and Sp1 regulates the silencing or the activation of the GM-CSF promoter in conjunction with Rel factors.2 Surprisingly, our data also show constitutive and direct binding of Sp1 factor to the IL-2Ralpha kappa B probe, although this probe does not contain a consensus GC-box. Our preliminary observations suggest that, similar to the binding of serum response factor to the adjacent SRE/CArG box (not included in our probe) (24), the binding of Sp1 is impeded by the binding of p50 homodimers (data not shown). It has also been reported that Sp1 can repress IL-2Ralpha gene transcription (44), whereas we failed to detect any occupancy at the IL-2Ralpha promoter Sp1-binding site by genomic in vivo footprinting (24). Hence, the role of Sp1 in the regulation of the IL-2Ralpha gene is far from being elucidated. We are currently testing whether the Sp1 factor interacts physically and cooperates functionally with NF-kappa B and serum response factors to promote the transcription of the IL-2Ralpha gene.


FOOTNOTES

*   This work was supported in part by the Institut National de la Santé et de la Recherche Médicale and by grants from the Association pour la Recherche sur le Cancer, Ligue Nationale Contre le Cancer, Comité des Bouches-du-Rhône de la Ligue Nationale Contre le Cancer, and European Community Biomed 1 CT 93-1426 and CHRX CT 94-0537.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§   To whom correspondence should be addressed: INSERM U119, 27 boulevard Leï Roure, 13009 Marseille, France. Tel.: 33-491-75-84-04; Fax: 33-491-26-03-64.
   Supported by the Association pour la Recherche sur le Cancer.
1   The abbreviations used are: TcR, T cell receptor; mAb, monoclonal antibody; IL-2, interleukin-2; GM-CSF, granulocyte macrophage-colony-stimulating factor; CD28RE, CD28 response element; PMA, phorbol 12-myristate 13-acetate; EMSA, electrophoretic mobility shift assay.
2   B. Kahn-Perlès, C. Lipcey, P. Lécine, D. Olive, and J. Imbert, manuscript in preparation.

ACKNOWLEDGEMENTS

We thank C. Mawas and W. Hempel for critical reading of the manuscript.


REFERENCES

  1. Meuer, S. C., Hodgdon, J. C., Hussey, R. E., Protentis, J. P., Schlossman, S. F., and Reinherz, E. L. (1983) J. Exp. Med. 158, 988-993 [Abstract/Free Full Text]
  2. June, C. H., Bluestone, J. A., Nadler, L. M., and Thompson, C. B. (1994) Immunol. Today 15, 321-331 [CrossRef][Medline] [Order article via Infotrieve]
  3. Linsley, P. S., and Ledbetter, J. A. (1993) Annu. Rev. Immunol. 11, 191-212 [Medline] [Order article via Infotrieve]
  4. Schwartz, R. H. (1992) Cell 71, 1065-1068 [CrossRef][Medline] [Order article via Infotrieve]
  5. Pierres, A., Lopez, M., Cerdan, C., Nunes, J., Olive, D., and Mawas, C. (1988) Eur. J. Immunol. 18, 685-690 [Medline] [Order article via Infotrieve]
  6. Ledbetter, J. A., Rabinovitch, P. S., Hellstrom, I., Hellstrom, K. E., Grosmaire, L. S., and June, C. H. (1988) Eur. J. Immunol. 18, 1601-1608 [Medline] [Order article via Infotrieve]
  7. Meuer, S. C., Hussey, R. E., Fabbi, M., Fox, D., Acuto, O., Fitzgerald, K. A., Hodgdon, J. C., Protentis, J. P., Schlossman, S. F., and Reinherz, E. L. (1984) Cell 36, 897-906 [CrossRef][Medline] [Order article via Infotrieve]
  8. Brottier, P., Boumsell, L., Gelin, C., and Bernard, A. (1985) J. Immunol. 135, 1624-1631 [Abstract]
  9. Cerdan, C., Martin, Y., Courcoul, M., Brailly, H., Mawas, C., Birg, F., and Olive, D. (1992) J. Immunol. 149, 2255-2261 [Abstract]
  10. Costello, R., Lipcey, C., Algarte, M., Cerdan, C., Baeuerle, P. A., Olive, D., and Imbert, J. (1993) Cell Growth Differ. 4, 329-339 [Abstract]
  11. Costello, R., Cerdan, C., Pavon, C., Brailly, H., Hurpin, C., Mawas, C., and Olive, D. (1993) Eur. J. Immunol. 23, 608-613 [Medline] [Order article via Infotrieve]
  12. Lindstein, T., June, C. H., Ledbetter, J. A., Stella, G., and Thompson, C. B. (1989) Science 244, 339-343 [Abstract/Free Full Text]
  13. Linsley, P. S., Brady, W., Grosmaire, L., Aruffo, A., Damle, N. K., and Ledbetter, J. A. (1991) J. Exp. Med. 173, 721-730 [Abstract/Free Full Text]
  14. Fraser, J. D., Irving, B. A., Crabtree, G. R., and Weiss, A. (1991) Science 251, 313-316 [Abstract/Free Full Text]
  15. Verweij, C. L., Geerts, M., and Aarden, L. A. (1991) J. Biol. Chem. 266, 14179-14182 [Abstract/Free Full Text]
  16. Schreck, R., and Baeuerle, P. A. (1990) Mol. Cell. Biol. 10, 1281-1286 [Abstract/Free Full Text]
  17. Ghosh, P., Tan, T. H., Rice, N. R., Sica, A., and Young, H. A. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 1696-1700 [Abstract/Free Full Text]
  18. Lai, J. H., Horvath, G., Subleski, J., Bruder, J., Ghosh, P., and Tan, T. H. (1995) Mol. Cell. Biol. 15, 4260-4271 [Abstract]
  19. Parry, G. C. N., and Mackman, N. (1994) J. Biol. Chem. 269, 20823-20825 [Abstract/Free Full Text]
  20. Hughes, C. C. W., and Pober, J. S. (1996) J. Biol. Chem. 271, 5369-5377 [Abstract/Free Full Text]
  21. Gruters, R. A., Otto, S. A., Al, B. J., Verhoeven, A. J., Verweij, C. L., Van-Lier, R. A., and Miedema, F. (1991) Eur. J. Immunol. 21, 167-172 [Medline] [Order article via Infotrieve]
  22. Tong-Starksen, S. E., Luciw, P. A., and Peterlin, B. M. (1989) J. Immunol. 142, 702-707 [Abstract]
  23. Costello, R., Cerdan, C., Lipcey, C., Algarte, M., Martin, Y., Baeuerle, P. A., Olive, D., and Imbert, J. (1993) Cell Growth Differ. 4, 947-954 [Abstract]
  24. Algarte, M., Lecine, P., Costello, R., Plet, A., Olive, D., and Imbert, J. (1995) EMBO J. 14, 5060-5072 [Medline] [Order article via Infotrieve]
  25. Baeuerle, P. A., and Baltimore, D. (1996) Cell 87, 13-20