Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhan, X.
Right arrow Articles by Crouch, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhan, X.
Right arrow Articles by Crouch, R. J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 35, Issue of August 29, 1997 pp. 22023-22029
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

The Isolated RNase H Domain of Murine Leukemia Virus Reverse Transcriptase
RETENTION OF ACTIVITY WITH CONCOMITANT LOSS OF SPECIFICITY*

(Received for publication, October 21, 1996, and in revised form, June 25, 1997)

Xinyi Zhan and Robert J. Crouch Dagger

From the Laboratory of Molecular Genetics, NICHD, National Institutes of Health, Bethesda, Maryland 20892

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES


ABSTRACT

Retroviral RNases H are similar in sequence and structure to Escherichia coli RNase HI and yet have differences in substrate specificities, metal ion requirements, and specific activities. Separation of reverse transcriptase (RT) into polymerase and RNase H domains yields an active RNase H from murine leukemia virus (MuLV) but an inactive human immunodeficiency virus (HIV) RNase H. The "handle region" present in E. coli RNase HI but absent in HIV RNase H contributes to the binding to its substrate and when inserted into HIV RNase H results in an active enzyme retaining some degree of specificity. Here, we show MuLV protein containing the C-terminal 175 amino acids with its own handle region or that of E. coli RNase HI has the same specific activity as the RNase H of RT, retains a preference for Mn2+ as the cation required for activity, and has association rate (KA) 10% that of E. coli RNase HI. However, with model substrates, specificities for removal of the tRNAPro primer and polypurine tract stability are lost, indicating specificity of RNase H of MuLV requires the remainder of the RT. Differences in KA, while significant, appear insufficient to account for the differences in specific activities of the bacterial and viral RNases H.


INTRODUCTION

Reverse transcriptases (RT)1 are enzymes responsible for copying the retroviral genomic RNA into double-stranded DNA by a process involving both the polymerase and RNase H of the RT (1). For human immunodeficiency virus type 1 (HIV-1), RT comprises a heterodimeric protein consisting of p66 and p51 subunits (2-4). The p51 polypeptide is derived from p66 by proteolysis, removing the C-terminal (p15) RNase H domain. Both polymerase and RNase H catalytic sites are contributed by p66, with p51 acting primarily as a structural polypeptide (5, 6). Isolated p51 protein has very poor polymerase activity and, of course, no RNase H activity. Linker-scanning mutations in HIV-1 RT (7), as well as the structure determined by x-ray crystallography (8, 9), show an intermingling of polymerase and RNase H regions, with one activity relying on other portions of the protein for activity (10). The RT of murine leukemia virus (MuLV) differs from that of HIV-1 RT in that it is isolated as a single polypeptide chain of 76 kDa (11), which appears to form dimers when bound to nucleic acids (12, 13). Furthermore, MuLV RT can be divided into two separate polypeptides; the N-terminal two-thirds portion of the protein has very good polymerase activity and a protein from the C-terminal one-third is reported to be an active RNase H (14).

RNase H activity is essential for retroviral replication (15, 16) and is involved in several steps of replication including the following: removal of tRNA, which functions as a primer for minus-strand DNA synthesis (17); generation of polypurine tract (PPT), the primer for second strand DNA and its subsequent removal (18, 19); and degradation of the viral RNA genome (20-23). In vivo studies demonstrate that inactivation of RNase H results in production of noninfectious virions (24-26).

Amino acid sequence comparison shows that HIV and MuLV retroviral RNases H share about 25% of their sequence with Escherichia coli RNase HI (27). Much greater similarity is found when comparing the three-dimensional structures of E. coli RNase HI (28, 29) and the RNase H of HIV-1 reverse transcriptase in the complete RT (8, 9) or in the p15 (C-terminal domain) (30). A significant exception to the structural similarity is the presence of an additional handle region in E. coli RNase HI (helices alpha B, alpha C, and alpha D) not found in the corresponding region of HIV-1 p15, which contains only helices alpha B and alpha D. Several studies demonstrate that alpha C is rich in basic amino acids and contributes significantly to binding to RNA-DNA hybrids (31, 32). One construct of E. coli RNase HI was made in which the handle region is missing and in which enzymatic activity is lost due, in part, to a decrease in binding to RNA-DNA hybrids by more than 3 orders of magnitude (32). In another case, an E. coli RNase HI protein with a different connection of the alpha B and alpha D helices retains some enzymatic activity but only in the presence of Mn2+ ions (33). A protein containing only the p15 domain has no RNase H activity (34-36) but acquires activity by the following: (i) mixing with the HIV-1 polymerase domain (p51) (36) or part of the connection region (37); (ii) adding a His6-tag to the RNase H domain (37-39); and (iii) inserting the alpha C region from the E. coli RNase HI (39, 40). One somewhat surprising result obtained with the active HIV-1 RNase H proteins is their ability to cleave model tRNA primer substrates at the same site as intact RT, suggesting that at least some of the specificity elements for cleavage are present in these polymerase minus RNases H (37-40).

The three-dimensional structure of MuLV RNase H has not yet been elucidated, but amino acid sequence alignment predicts that this RNase H has a handle region, consisting of alpha B, alpha C, and alpha D, similar to E. coli RNase HI (28, 29). Compared with E. coli RNase HI, MuLV reverse transcriptase-associated RNase H activity is very low, whether associated with the polymerase domain or not. Furthermore, the RNase H activity of MuLV RT prefers Mn2+, and MuLV RT cleaves replication intermediates essential for retroviral replication at specific sites that are different from those E. coli RNase HI cleaves (21-22). Little is known about the biochemical properties of the C-terminal RNase H of MuLV RT.

To further our understanding of retroviral RNases H, we have examined the C-terminal 175 amino acid portion of MuLV RT (C175-AKR-RNase H) for its activity, its binding to RNA-DNA hybrids, and its specificity of cleavage. For specificity studies, we have used a model tRNA primer site, the polypurine tract (PPT), a fragment of mRNA for ovalbumin annealed to a complementary DNA oligonucleotide, and a homopolymeric poly(rA)·poly(dT).


EXPERIMENTAL PROCEDURES

Materials

The E. coli strain MIC1066 (rnhA-339::cat recB270(TS)) (41) was used to over-produce the C175-AKR-RNase H (AKR is the strain of mice from which the virus was isolated), AEA (C175-AKR-RNase H with the E. coli RNase HI "handle region"), in addition to E. coli RNase HI. Bacterially expressed AKR-MuLV reverse transcriptase and a polyclonal antibody against N-terminal AKR-MuLV RNase H were kind gifts from Dr. Judith Levin at NICHD, National Institutes of Health (42). The Mega RNA transcription kit was from Ambion. Expression vectors pET15b(+) and pET21a(+), biotinylated protease thrombin, streptavidin-agarose, and His-Bind® resin were from Novagen. The Western LightTM chemiluminescent detection system was from Tropix, Inc. RNA36 oligonucleotide (5')-biotin-GGGAUCAGUGGUUCCCAUAUCCCGGACGAGCCCCCA-(3') was synthesized by Oligos Etc. Inc. A partially complementary DNA36 (TGGGGGCTCTGCCGGGATATGGGAACCACTGATCCC) was from BioServe. The ultrapure Sequagel sequencing system was from National Diagnostics, and 6 and 8% gel mix were from Life Technologies, Inc. The sensor chip CM5, Tween P20, and amine coupling kit were from Pharmacia Biotech Inc. Streptavidin and biotin were from Pierce.

Construction of Plasmids

The DNA segment encoding Met1 to Val155 of E. coli RNase HI and Leu496 to Leu671 of the pol gene of AKR-MuLV (11) was modified by adding restriction sites (NdeI and EspI) and cloned either into the pET15b(+) vector, which expresses a His6-tag at the N terminus of the target proteins, or into the pET21a(+) vector for expression of proteins without His6-tag. The AEA plasmid carries the DNA of AKR-MuLV encoding amino acids Leu496 to Tyr581, the E. coli RNase HI sequence for Thr69 to His114, followed by AKR-MuLV Arg629 to Leu671.

Expression and Purification

Four-liter cultures of MIC1066 harboring the C175-AKR-RNase H, chimeric RNase H (AEA), or E. coli RNase HI plasmids were grown at 32 °C to an A600 value about 0.8 and then induced with 1 mM isopropyl-beta -D-thiogalactopyranoside for 3 h at 32 °C. Cells were harvested and sonicated in loading buffer (5 mM imidazole, 0.1% Nonidet P-40, 0.5 M NaCl, and 20 mM Tris-HCl, pH 7.9). After centrifugation at 10,000 rpm for 30 min, the supernatants were filtered through a 0.45-micron filter and loaded on a 1-ml His-Bind® resin. The column was washed with 10 ml of loading buffer and 10 ml of washing buffer (60 mM imidazole, 0.5 M NaCl, and 20 mM Tris-HCl, pH 7.9). The His6-tagged C175-AKR-RNase H, AEA, and E. coli RNase HI were eluted with 0.5 M imidazole, 0.5 M NaCl, and 20 mM Tris-HCl, pH 7.9. After dialysis against buffer A (50 mM Tris-HCl, pH 7.9, 1 mM dithiothreitol, 50 mM NaCl, 10% glycerol, 0.5 mM EDTA, and 1 mM phenylmethylsulfonyl fluoride), samples were applied to consecutively connected high performance liquid chromatography columns of TSK gels DEAE-5PW (7.5 × 75 mm) and SP-5PW (7.5 × 75 mm). The His6-tagged C175-AKR-RNase H was present in the flow-through fraction, and the His6-tagged E. coli RNase HI bound to the SP column, eluting at about 150 mM NaCl from a 50 mM to 1 M NaCl gradient, and the chimeric AEA RNase H bound to the SP column, eluting in a manner similar to the E. coli protein. The proteins of interest were pooled and concentrated by centrifugation at 5,000 rpm in a filtron device (cutoff, 10 kDa). Enzymes were stored at -70 °C in a solution containing 45% glycerol, 25 mM Tris-HCl, pH 7.9, 0.5 mM dithiothreitol, 25 mM NaCl, 0.25 mM EDTA, and 0.5 mM phenylmethylsulfonyl fluoride.

Protease Treatment

Removal of His6tag was performed by treating 100 µg of His6-tagged proteins with 1 unit of biotinylated thrombin protease at 25 °C for several hours. His-Bind® resin was added to the reaction mixture and mixed for 30 min at room temperature. After spinning, the supernatant containing the protein without His6-tag was further mixed with 100 µl of streptavidin-agarose slurry for another 30 min at room temperature. After centrifugation, the supernatant was collected and dialyzed overnight at 4 °C against buffer A.

RNase H Activity Assay

RNase H activity with alpha -32P-labeled poly(rA)·poly(dT) as substrate was determined essentially as described (43) by measuring trichloroacetic acid-soluble radioactivity. In situ renaturation gel assays were performed as described (44).

Four different substrates were used to determine differences in products generated by the various enzymes. Details of the conditions of the assays are given in the figure legends for each substrate. Polyacrylamide gel analysis of the products was performed according to Zhan et al. (45). The substrate for minus-strand primer removal assay was prepared according to Smith and Roth (38) and Stahl et al. (39). The uniformly [alpha -32P]CTP-labeled polypurine substrate was synthesized according to Guo et al. (13) and uniformly [alpha -32P]CTP-labeled ovalbumin mRNA160 was prepared as described by Oyama et al. (46) and Post et al. (42). The final products were visualized after electrophoresis on a 6 or 8% sequencing gel by autoradiography with Kodak X-Omat film or were exposed to a phosphor screen and quantified using the ImageQuant program (Molecular Dynamics).

BIAcoreTM Analysis

The 5'-biotinylated RNA36 oligonucleotide was annealed to its complementary DNA36 oligonucleotide at a ratio 1:20 in the diethyl pyrocarbonate-treated HBS buffer (20 mM HEPES, pH 7.5, 150 mM NaCl, 0.5 mM EDTA, 0.05% Tween P20, a non-ionic detergent). A sensor chip with streptavidin-modified surface was first immobilized with 20 µl of RNA-DNA hybrid and then blocked with biotin (for details see Ref. 32). 45 µl of four different concentrations of RNase H, which were dialyzed against to HBS buffer before analysis, were injected onto the RNA-DNA surface at 20 µl/min. The surface was regenerated with one injection of 10 µl of 2 M NaCl. The sensorgrams were analyzed by subtracting sensorgrams obtained from the control surface, in which a sensor chip is loaded with streptavidin followed by biotin but not with RNA-DNA. Kinetic constants were calculated using BIAcoreTM evaluation software (see also Ref. 32 for details).


RESULTS

E. coli RNase HI, C175-AKR-RNase H, and Chimeric AEA RNase H: Protein Purification

RNases H of E. coli, C175-AKR-RNase H, and chimeric AEA were purified from E. coli MIC1066 (rnhA-339::cat recB270(TS)) to ensure that only the overexpressed proteins contribute to the activity observed. Versions of both proteins with or without an N-terminal His6-tag were studied. Purification of the His6-tagged proteins was facilitated by affinity chromatography using nickel nitrilotriacetic acid-agarose columns. Results of analysis of the purified proteins by SDS-polyacrylamide gel electrophoresis are shown in Fig. 1 as follows: a shows a Coomassie-stained gel, and b shows a renaturation gel assay for RNase H activity. E. coli RNase H labeled with the His6-tag purified essentially as it would without the His6-tag. Expression of the C175-AKR-RNase H enzyme is relatively poor, and therefore, we purified the His6-tagged version of this protein and, in some studies, removed the His6-tag by proteolysis with thrombin. C175-AKR-RNase H is found in the flow-through of both DEAE and SP columns, in contrast to the E. coli protein, which flows through the DEAE column but binds to the SP column, eluting at around 150 mM NaCl. Some preparations of the C175-AKR-RNase H contain small amounts of a 12-kDa protein corresponding to the N-terminal portion of C175-AKR-RNase H, as judged by its binding to nickel nitrilotriacetic acid-agarose and its interaction with antisera directed against the N-terminal portion of the RNase H region. This fragment probably results from cleavage at a site previously shown to be susceptible to proteolysis in E. coli when AKR-MuLV reverse transcriptase is expressed and purified (47). We could not detect any contribution of this AKR-MuLV fragment to RNase H activity or to binding to RNA-DNA hybrids. The chimeric AEA RNase H purifies in a similar manner to C175-AKR-RNase H and appears to be homogeneous (data not shown). For simplicity in the presentation in the figures, the C175-AKR-RNase H is designated as A, E. coli RNase HI as E, and the chimeric RNase H as AEA.


Fig. 1. Analysis of activity and purity of the RNases H. a, Coomassie staining, SDS-denaturing gradient polyacrylamide gels (10-20%) were electrophoresed and stained with Coomassie Blue; b, in situ RNase H activity gel analysis (15% SDS-polyacrylamide gels containing 107 cpm alpha -32P-labeled poly(rA)· poly(dT) with a specific activity about 4 × 104 cpm/pmol in a total volume of 30 ml) renatured for about 60 h in a buffer containing 50 mM Tris-HCl, pH 7.9, 50 mM NaCl, 10 mM mercaptoethanol, and 2 mM MnCl2. Lane 1 is His6-tagged C175-AKR-RNase (designated as A); lane 2, C175-AKR-RNase H A; lane 3 N-terminal His6-tagged E. coli RNase HI; and lane 4, E. coli RNase HI. Each lane contained approximately 3 µg of protein.
[View Larger Version of this Image (37K GIF file)]

Catalytic Activity of the C175-AKR-RNase H

Previous studies of MuLV RNase H have been more qualitative than quantitative but demonstrate clearly that this domain has RNase H activity (14). One rather novel feature of MuLV reverse transcriptase is a strong preference for Mn2+ (2.5 mM) rather than Mg2+ (5 mM) as the divalent cation when assaying for either polymerization or RNase H activity. To examine activity and metal ion preference, we assayed the C175-AKR-RNase H using poly(rA)·poly(dT) as substrate. The purified soluble C175-AKR-RNase H degrades RNA, preferring Mn2+ over Mg2+ as the divalent cation (Table I and Fig. 2). Products of C175-AKR-RNase H digestion of poly(rA)·poly(dT) were analyzed by gel electrophoresis and quantified using Molecular Dynamics PhosphorImager and ImageQuant (Table I). The specific activity of the C175-AKR-RNase H is very similar to MuLV reverse transcriptase-associated RNase H activity with a preference for Mn2+ over Mg2+ (about 10-20-fold) but differs significantly from that of E. coli RNase HI, which prefers Mg2+ over Mn2+ more than 150-fold.

Table I. Specific activities using magnesium and manganese

RNase H activity was assayed in 20 µl using 5 pmol 32P-labeled poly(rA)·poly(dT) at 37 °C for 10 min in the presence of either 5 mM Mg2+ or 2.5 mM Mn2+. Products were analyzed on a 15% polyacrylamide gel and quantified using ImageQuant. Specific activities are nmol of product migrating at <20 nt/mg of RNase H in 10 min.

Enzyme Mg2+ Mn2+ Mg2+/Mn2+

E. coli RNase HI 7.25 × 104 401 180
C175-AKR RNase H 28.9 520 0.06
AKR MuLV RT 26 192 0.14


Fig. 2. Product analysis with alpha -32P-labeled poly(rA)·poly(dT) as substrate. RNase H activity was assayed with 5 pmol of alpha -32P-labeled poly(rA)·poly(dT) in 20 µl in the presence of 5 mM MgCl2 or 2.5 mM MnCl2 at 37 °C. Aliquots of 5 µl were taken at the following times: lanes 1, 0 min; lanes 2, 10 min; lanes 3, 30 min; and lanes 4, 150 min by adding stop solution (80% formamide, 20 mM EDTA, 0.02% bromphenol blue). The products were visualized after electrophoresis on a 15% polyacrylamide, 8 M urea gel followed by autoradiography or PhosphorImaging. Marker mononucleotide [32P]pA and dinucleotides [32P]pApA are as indicated.
[View Larger Version of this Image (59K GIF file)]

The size distribution of products obtained with poly(rA)· poly(dT) as substrate differs markedly depending on the enzyme (Fig. 2). Since the specific activity of each enzyme is different, various amounts of RNase H were added, and the samples were removed at various times and products analyzed on polyacrylamide gels. The distribution of products in either Mg2+ or Mn2+ is very similar when AKR-MuLV RT provides the RNase H activity with the most abundant products at 10 min being 17- and 18-mer. At later times, when little or no initial substrate remains, smaller products accumulate. E. coli RNase HI products are significantly smaller than those seen with AKR-MuLV RT using Mg2+ as cation and are even smaller when Mn2+ is present in the reaction. C175-AKR-RNase H (A in Fig. 2) generates a very different set of products from RT in the presence of Mg2+ or Mn2+ with a long ladder of oligomers of increasing length at 30 min (lane 3) and products ranging from monomers to 14-mers at 150 min (lane 4). In contrast to E. coli RNase HI, C175-AKR-RNase H gives larger products in the presence of Mn2+, almost as large as those seen with AKR-MuLV RT (lanes 4).

Products of Cleavage Using a Synthetic mRNA-d20-mer Hybrid

To examine cleavage of a well characterized mRNA substrate for E. coli and MuLV RNases H, we used a portion of the ovalbumin mRNA (RNA160) annealed to a 20-mer DNA primer, which starts 2 nt away from the 3'-end of the RNA (Fig. 3). Experiments performed with this and subsequent substrates used Mg2+ as the divalent cation, since it is thought to be the relevant ion in vivo. From previous studies (42, 46), it is known that cleavage of RNA160 is due to binding of the polymerase active site at the 3'-OH of the d20-mer, placing the RNase H active site 15 base pairs from the 3'-OH giving an RNA product of 153 nucleotides (5- and 10-min time points for RT in Fig. 3). Incubation for longer times yielded additional products resulting from 3'-OH-independent cleavages (40-min RT in Fig. 3). E. coli RNase HI degrades this substrate very differently from RT-RNase H with some products arising from hydrolysis as close as three base pairs from the 3'-OH of the d20-mer. C175-AKR-RNase H gives products very similar to E. coli RNase HI; particularly notable is the absence of the 153-nt product seen with RT.


Fig. 3. Cleavage assay with ovalbumin RNA160 substrate. The reaction was similar to that shown in Fig. 4 but was carried out using 5 mM MgCl2 in the presence of 0.05 pmol of uniformly 32P-labeled ovalbumin RNA160 (42, 46) annealed to a 20-nt DNA primer (reaction volume, 20 µl). 2.5 ng of AKR reverse transcriptase, 2.5 ng of His6-tagged C175-AKR-RNase H, and 0.007 pg of E. coli RNase HI were used. Samples were removed at 5, 10, and 40 min. a, the final products were analyzed on an 8% polyacrylamide, 8 M urea gel. A, C175-AKR-RNase H; RT, AKR reverse transcriptase; E, E. coli RNase HI. Sizes of RNAs (nucleotides) are marked on the right side. b, a schematic of the RNA160 substrate. Arrows above mark the sites of cleavage by E. coli RNase HI. Arrows below mark the sites of cleavage of C175-AKR RNase H.
[View Larger Version of this Image (39K GIF file)]

tRNA-primer Substrate Cleavage

The primer of minus-strand DNA of RT of MuLV is from a tRNAPro annealed to a site some 145 nt from the 5'-end of the genomic RNA of MuLV. Synthesis of the first strand of DNA is followed by initiation of plus-strand DNA synthesis at the polypurine tract (PPT). Replication of the tRNAPro-primer yields an RNA-DNA hybrid that is cleaved by RT-RNase H removing the tRNAPro. To test for C175-AKR-RNase H specificity, we used a model substrate tRNAPro, similar to those used by Smith and Roth (38) and Stahl et al. (39), to analyze tRNALys3 removal by the RNase H of HIV-1. This substrate is a synthetic d69-mer with a primer binding site sequence (PBS) at its 3'-terminus to which is annealed an 18-mer RNA containing the 3'-terminal tRNAPro sequence complementary to the PBS. The Klenow fragment of E. coli DNA polymerase I is used to synthesize and label (using [alpha -32P]dGTP) the model substrate (Fig. 4). This defined substrate has an RNA-DNA hybrid with an RNA-DNA covalent junction similar to the natural in vivo substrate. RNase H of MuLV reverse transcriptase cleaves similar substrates to produce two products, one with a single ribonucleotide A attached to the DNA and a second which has the ribonucleotide A removed, resulting from hydrolysis at the RNA-DNA junction (48). We find AKR-MuLV RT yields two products, one whose size is consistent with cleavage at the RNA-DNA junction and the other leaving the ribonucleotide A attached to the DNA (marked by the arrow in Fig. 4). E. coli RNase HI rarely cleaves at an RNA-DNA junction (38-40, 42) but generates the products shown in Fig. 4 resulting from hydrolysis at a point 3 to 4 nt from the RNA-DNA junction. C175-AKR-RNase H products are very similar to those derived with the E. coli enzyme, and only after extensive degradation (A at 20 min in Fig. 4) is there even a small amount of product containing a single ribonucleotide A.


Fig. 4. Specific cleavage analysis using the tRNApro model substrate removal assay. RNase H activity was assayed as described under "Experimental Procedures" in a 20-µl reaction containing 0.1 pmol of PBS substrate (37, 39) in the presence of 5 mM MgCl2 at 37 °C. As a control, the RNA moiety was completely removed from the substrate by treating with 0.1 N NaOH for 2 h at 65 °C. About 10 ng of C175-AKR RNase H, 50 ng of AKR MuLV reverse transcriptase, and 0.35 ng of E. coli RNase HI were used. a, the final products were analyzed on an 8% polyacrylamide, 8 M urea gel. A, RT, and E are the same as Fig. 3. b, gives the sequences of the RNA and DNA. The boxed sequence is RNA.
[View Larger Version of this Image (41K GIF file)]

PPT Substrate

For initiation of plus strand synthesis, RNase H of RT cleaves genomic RNA, avoiding degradation within the PPT sequence to yield specific short RNA primers (18-20). E. coli RNase HI has no sequence specificity and cleaves within the PPT. We investigated cleavages of substrates containing PPT RNA by annealing any of four d40-mers to a synthetic 32P-labeled RNA containing the PPT sequence. Each d40-mer positions the PPT different distances from the 3'- and 5'-ends of the DNA oligomer. Previous studies (13, 49, 50) demonstrate that processing of these PPT RNA substrates depends on the RNA-DNA hybridized region. As seen in Fig. 5 for substrate I, RT cleaves mainly 18 nt from the 3'-OH and generates two primary products (211 and 256 nts). In contrast, E. coli RNase HI cleaves throughout the d40-mer region producing fragments much smaller than those seen with RT (about 196 and 236 nts). The pattern of products for C175-AKR-RNase H is very similar to that seen with E. coli RNase HI which is true for all of the PPT substrates (Fig. 5).


Fig. 5. Cleavage assay with PPT RNA substrates. The assay (13) was performed in 20 µl at 37 °C for 30 min in the presence of 5 mM MgCl2, 1 ng of His6-tagged C175-AKR RNase H, 5 ng of AKR MuLV reverse transcriptase, and 0.035 pg of His6-tagged E. coli RNase HI were used in the presence of 0.01 pmol of PPT RNA annealed to DNA primers I-IV, respectively. a, the final products were analyzed on a 6% polyacrylamide, 8 M urea gel. Sizes of products are noted with 3' and 5' fragments being marked. b, schematic representation of the four PPT substrates (see Ref. 45).
[View Larger Version of this Image (44K GIF file)]

In the case of the RNase H domain of AKR-MuLV reverse transcriptase, the cleavage pattern is basically similar to that of E. coli RNase HI. With substrate II, as analyzed by Guo et al. (13), the cleavage is somewhat 3'-OH-dependent, i.e. the reverse transcriptase was positioned about 18 nt from the 3'-terminus of the DNA strand and, thus, in the PPT region, resulting in degradation in this region. As expected, the cleavages catalyzed by the C175-AKR-RNase H again are similar to those seen with E. coli RNase HI, which does not display a 3'-OH dependence and whose 5' products are much smaller (about 4 nt from 3'-terminus of the DNA strand). With substrate III and IV, reverse transcriptase produces larger 5' products, in contrast to E. coli RNase HI and C175-AKR-RNase H, which accumulate smaller 5' products.

Examination of Alterations in the MuLV RNase H on Specificity, Specific Activity, and Divalent Metal Ion Requirements

The N terminus of the RNase H protein used in the preceding experiments has six consecutive histidine residues and a thrombin cleavage site between the His6-tag and the RNase H. The possibility exists that the His6-tag may affect activity and cleavage specificity (38). When we treated His6-tagged proteins with thrombin or when we used purified proteins expressed without the additional N-terminal amino acids, no differences were seen in specific activity or cleavage specificity for any of the substrates tested (data not shown). Hence, the N-terminal His6-tag and thrombin cleavage site do not alter the cleavage patterns. From product analysis with either nonspecific substrates such as poly(rA)·poly(dT) and ovalbumin RNA160 or specific substrates, such as the PBS sequence and PPT sequence, the altered cleavage specificity appears to be an intrinsic property of the isolated C175-AKR-RNase H.

Previously, we have shown that the HIV-1 RNase H domain protein can be converted from an inactive protein to an active enzyme by inserting the alpha C region of E. coli RNase HI into the homologous region on the HIV-1 protein (39). To determine if replacement of the basic protrusion (alpha B, alpha C, and alpha D) of the C175-AKR-RNase H alters any of its enzymatic properties, we constructed a gene that produces a chimeric RNase H with the amino portion derived from MuLV, the basic protrusion corresponding to that of E. coli RNase HI, and the C-terminal part coming from the MuLV protein (we designate this RNase H as AEA). No significant differences were found between the C175-AKR-RNase H and the AEA enzyme for (i) divalent cation preference, (ii) specific activity, or (iii) any of the products generated using all of the substrates described earlier.

Measurement of Rates of Binding to RNA-DNA Hybrids

As reported elsewhere (32), we have shown that E. coli RNase HI has fast association and dissociation rates when interacting with RNA-DNA hybrids. It was also possible to demonstrate that an E. coli RNase HI lacking a significant portion of the basic protrusion has no enzymatic activity and a dramatically lower on-rate compared with the wild-type protein. Furthermore, a point mutation changing a highly conserved Asp residue to Ala results in a protein that has no RNase H activity but retains the ability to interact with RNA-DNA at rates similar, if not identical, to the wild-type enzyme. To determine the binding properties of the C175-AKR-RNase H and the AEA-RNase H, we used the BIAcore instrument to determine kinetic parameters. Results of experiments in which we immobilized a 36-base pair RNA-DNA hybrid via a streptavidin-biotin linkage (see "Experimental Procedures") to the sensor chip and passed solutions of purified RNases H over the sensor surface are shown in Fig. 6 . Table II summarizes the kinetic parameters obtained from these experiments which show that both versions of the MuLV RNases H bind with an association rate (KA) of about 10% and a dissociation rate (KD) approximately half that of E. coli RNase HI. This is in contrast to a 103 difference in KA between that of native E. coli RNase HI and that of E. coli RNase HI whose basic protrusion region had been deleted (32). Thus, the 10-fold difference in binding of MuLV RNase H and E. coli RNase HI can account for some of the difference in specific activities of the two enzymes, but most of the difference must be due to difference in catalysis rates.


Fig. 6. Sensorgram of C175-AKR-RNase H binding to a 36-base pair RNA-DNA hybrid. C175-AKR-RNase H (191, 287, 382, and 478 nM) was injected (45 µl at a flow rate of 20 µl/min) onto a surface, on which RNA-DNA hybrid had been immobilized. Dissociation was started by injecting buffer lacking RNase HI as indicated by an arrowhead. This sensorgram is a representative of BIAcoreTM measurements of the interaction between C175-AKR-RNase H and its substrate.
[View Larger Version of this Image (14K GIF file)]

Table II. Summary of rate constants estimated from surface plasmon resonance


Enzyme KA KD

Ms-1 s-1
AEA His 0.18  ± 0.16 × 106 4.1  ± 2.8 × 10-3
AEA 0.10  ± 0.07 × 106 4.2  ± 2.0 × 10-3
E. coli RNase HI-His 0.87  ± 0.14 × 106 4.2  ± 0.19 × 10-3
E. coli RNase HI 1.15  ± 0.31 × 106 8.8  ± 3.8 × 10-3
C175-AKR RNase H 0.12  ± 0.04 × 106 0.8  ± 0.6 × 10-3


DISCUSSION

Here we present evidence that a protein comprising the RNase H domain of MuLV RT has RNase H activity comparable to the RNase H of AKR-MuLV RT, and it maintains a preference for Mn2+ rather than Mg2+. Thus, most or all of the determinants necessary for RNase H activity reside in the C-terminal 175 amino acids of RT. This retention of activity is in marked contrast to similar RNase H domain proteins derived from HIV-1 RT which has no RNase H activity (34-36). By adding either a His6-tag to the HIV-1 RNase H protein (38) or by inserting the alpha C region of E. coli RNase HI (39, 40), which is normally absent from HIV-1 RNase H, enzymatic activity can be restored. Interestingly, these HIV-1 RNases H retain specificity for cleavage of a tRNALys3 model substrate (38-40).

In contrast, we show here that the C175-AKR-RNase H cleaves several substrates in a very different manner from AKR-MuLV RT, suggesting that specificity of hydrolysis by the retroviral RNase H is dictated by the remainder (non-RNase H domain) of the protein (polymerase and connection regions). In addition, substitution of the basic protrusion region of MuLV RNase H by the homologous region from E. coli RNase HI does not alter any of the properties of the RNase H that we tested. Except when using poly(rA)·poly(dT) as substrate (Fig. 2), C175-AKR-RNase H yields products similar to E. coli RNase HI from the tested substrates. Even with the poly(rA)·poly(dT) substrate, products formed in the presence of Mg2+ resemble those found for the E. coli enzyme, although the size of the final products tends to be slightly larger for the C175-AKR-RNase H than for E. coli RNase HI. When the divalent cation in the reaction is Mn2+, oligonucleotide A of 11-16 nt are the most abundant products, more closely resembling the fragments produced from the same substrate by RT.

E. coli RNase HI, MuLV RNase H, and HIV-1 RNase H all probably have similar three-dimensional structures, but HIV-1 lacks the alpha C loop of E. coli RNase HI. Mutations in the alpha C-loop, including a deletion (31, 32), provide evidence that this region is involved in substrate binding. Lack of RNase H activity of the HIV-1 RNase H protein results from its poor ability to bind to the substrate, as suggested by recovery of activity when a His6-tag is added at the N or C terminus of the protein or when the alpha C-loop of E. coli RNase HI is inserted into the HIV-1 RNase H protein. Activity of these HIV-1 RNases H is highest when Mn2+ is present in the reaction mixture, with less than 0.1% activity being detected with Mg2+ (38-40). Studies using surface plasmon resonance (Fig. 6 and Table II) indicate that the binding of the C175-AKR-RNase H is similar to AEA but only 10% that of E. coli RNase HI. Although this difference in binding is significant, it seems unlikely to account for 104 differences between the specific activities of the E. coli and MuLV enzymes (42). However, the loss of specificity described here is remarkable only when compared with the HIV-1 RNase H results.

The physical arrangement of the two catalytic sites suggests that polymerase and RNase H are coupled during reverse transcription (8, 9, 46). A number of experiments underscore the strong influence of polymerase on RNase H activity, sometimes directing the RNase H not to cleave (e.g. at the PPT) and sometimes dictating the site of cleavage. Palaniappan et al. found (49) that nevirapine, an inhibitor of the DNA polymerase activity of HIV-1 reverse transcriptase, alters the cleavage specificity of the RNase H. These authors propose that interruption of binding of the polymerase domain to nucleic acids permits reverse transcriptase to move away from the 3'-terminus of the DNA strand, resulting in random cleavages. The nucleocapsid protein NCp7 facilitates delivery of RNA-DNA into the active site of the RNase H domain of HIV-1 reverse transcriptase, thereby altering the rate and, to a slight extent, the pattern of cleavage (50). The results with NCp7 are also explained in terms of restricting the RT to its RNase H activity. Thus, AKR-MuLV RNase H has different specificity when free of the constraints imposed when it is attached to the polymerase domain. This is another example of the important role of the polymerase region for RNase H activity documented in the literature.

Judging from the specificity of cleavage of RNase H of RT, and from the strong influence of the polymerase domain on RNase H activity, it is not surprising that the site of cleavage is dictated by the non-RNase H region. What remains unexplained is how HIV-1 RNase H domain proteins, whose RNase H activity has been restored by adding a His-tag or insertion of the E. coli RNase HI handle region, retain the ability to correctly cleave a model tRNALys3 substrate. E. coli RNase HI has no known cleavage specificity, has a very high specific activity, and has a strong preference for Mg2+. During evolution, the RNase H domain of HIV-1 may have lost the handle region that greatly affects the binding properties of the E. coli enzyme to its substrate, whereas the MuLV RNase H retains this basic loop and, as a result, binds with an association rate that is 10% that of the E. coli protein. The amino acids and structures responsible for the differences in these biochemical properties remain to be defined.


FOOTNOTES

*   This work was supported in part by the National Institutes of Health Intramural AIDS Targeted Antiviral Program.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Dagger    To whom correspondence and requests for reprints should be addressed. Tel.: 301-496-4082; Fax: 301-496-0243; E-mail: robert_crouch{at}nih.gov.
1   The abbreviations used are: RT, reverse transcriptase(s); AKR-MuLV: murine leukemia virus from the AKR strain of mice; HIV, human immunodeficiency virus; PPT, polypurine tract; nt, nucleotide(s); PBS, primer binding site; AEA, C-175-AkR-RNase H with E. coli handle region.

ACKNOWLEDGEMENTS

We thank Dr. Judith Levin and Dr. Jianhui Guo for AKR-MuLV reverse transcriptase as well as for valuable discussions.


REFERENCES

  1. Skalka, A. M., and Goff, S. P. (eds) (1993) Reverse Transcriptase, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  2. di Marzo Veronese, F., Copeland, T. D., DeVico, A. L., Rahman, R., Oroszlan, S., Gallo, R. C., and Sarngadharan, M. G. (1986) Science 231, 1289-1291 [Abstract/Free Full Text]
  3. Lightfoote, M. M., Coligan, J. E., Folks, T. M., Fauci, A. S., Martin, M. A., and Venkatesan, S. (1986) J. Virol. 60, 771-775 [Abstract/Free Full Text]
  4. Wondrak, E. M., Lower, J., and Kurth, R. (1986) J. Gen. Virol. 67, 2791-2797 [Abstract/Free Full Text]
  5. Le Grice, S. F., Naas, T., Wohlgensinger, B., and Schatz, O. (1991) EMBO J. 10, 3905-3911 [Medline] [Order article via Infotrieve]
  6. Hostomsky, Z., Hostomska, Z., Fu, T. B., and Taylor, J. (1992) J. Virol. 66, 3179-3182 [Abstract/Free Full Text]
  7. Prasad, V. R., and Goff, S. P. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 3104-3108 [Abstract/Free Full Text]
  8. Kohlstaedt, L. A., Wang, J., Friedman, J. M., Rice, P. A., and Steitz, T. A. (1992) Science 256, 1783-1790 [Abstract/Free Full Text]
  9. Jacobo-Molina, A., Ding, J., Nanni, R. G., Clark, A. D., Lu, X., Tantillo, C., Williams, R. L., Kamer, G., Ferris, A. L., Clark, P., Hizi, A., Hughes, S. H., and Arnold, E. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 6320-6324 [Abstract/Free Full Text]
  10. Blain, S. W., and Goff, S. P. (1995) J. Virol. 69, 4440-4452 [Abstract]
  11. Herr, W. (1984) J. Virol. 49, 471-478 [Abstract/Free Full Text]
  12. Telesnitsky, A., and Goff, S. P. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 1276-1280 [Abstract/Free Full Text]
  13. Guo, J., Wu, W., Yuan, Z. Y., Post, K., Crouch, R. J., and Levin, J. G. (1995) Biochemistry 34, 5018-5029 [CrossRef][Medline] [Order article via Infotrieve]
  14. Tanese, N., and Goff, S. P. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 1777-1781 [Abstract/Free Full Text]
  15. Mizrahi, V., Usdin, M. T., Harington, A., and Dudding, L. R. (1990) Nucleic Acids Res. 18, 5359-5363 [Abstract/Free Full Text]
  16. Mizrahi, V., Brooksbank, R. L., and Nkabinde, N. C. (1994) J. Biol. Chem. 269, 19245-19249 [Abstract/Free Full Text]
  17. Omer, C. A., and Faras, A. J. (1982) Cell 30, 797-805 [CrossRef][Medline] [Order article via Infotrieve]
  18. Finston, W. I., and Champoux, J. J. (1984) J. Virol. 51, 26-33 [Abstract/Free Full Text]
  19. Rattray, A. J., and Champoux, J. J. (1987) J. Virol. 61, 2843-2851 [Abstract/Free Full Text]
  20. Resnick, R., Omer, C. A., and Faras, A. J. (1984) J. Virol. 51, 813-821 [Abstract/Free Full Text]
  21. Champoux, J. J., Gilboa, E., and Baltimore, D. (1984) J. Virol. 49, 686-691 [Abstract/Free Full Text]
  22. Smith, J. K., Cywinski, A., and Taylor, J. M. (1984) J. Virol. 52, 314-319 [Abstract/Free Full Text]
  23. Smith, J. K., Cywinski, A., and Taylor, J. M. (1984) J. Virol. 48, 200-204
  24. Repaske, R., Hartley, J. W., Kavlick, M. F., O'Neill, R. R., and Austin, J. B. (1989) J. Virol. 63, 1460-1464 [Abstract/Free Full Text]
  25. Schatz, O., Cromme, F., Naas, T., Lindemann, D., Mous, J., and Le Grice, S. F. J. (1989) FESB Lett. 257, 311-314 [CrossRef][Medline] [Order article via Infotrieve]
  26. Tisdale, M., Schultze, T., Larder, B. A., and Moelling, K. (1991) J. Gen. Virol. 72, 59-66 [Abstract/Free Full Text]
  27. Johnson, M. S., McClure, M. A., Feng, D.-F., Gary, J., and Doolittle, R. J. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 7648-76527 [Abstract/Free Full Text]
  28. Yang, W., Hendrickson, W. A., Crouch, R. J., and Satow, Y. (1990) Science 249, 1398-1405 [Abstract/Free Full Text]
  29. Katayanagi, K., Miyagawa, M., Matsushima, M., Ishikawa, M., Kanaya, S., Ikehara, M., Matsuzaki, T., and Morikawa, K. (1990) Nature 347, 306-309 [CrossRef][Medline] [Order article via Infotrieve]
  30. Davies, J. F., Hostomska, Z., Hostomsky, Z., Jordan, S., and Mathews, D. A. (1991) Science 252, 88-95 [Abstract/Free Full Text]
  31. Kanaya, S., Katsuda-Nakai, C., and Ikehara, M. (1991) J. Biol. Chem. 266, 11621-11627 [Abstract/Free Full Text]
  32. Haruki, M., Noguchi, E., Kanaya, S., and Crouch, R. J. (1997) J. Biol. Chem. 272, 22015-22022 [Abstract/Free Full Text]
  33. Keck, J. L., and Marqusee, S. (1996) J. Biol. Chem. 271, 19883-19887 [Abstract/Free Full Text]
  34. Becerra, S. P., Clore, G. M., Gronenborn, A. R., Karlstorm, S. J., Stahl, S. J., Wilson, S. H., and Wingfield, P. T. (1990) FEBS Lett. 270, 76-80 [CrossRef][Medline] [Order article via Infotrieve]
  35. Schatz, O., Mous, J., and Le Grice, S. F. J. (1990) EMBO J. 9, 1171-1176 [Medline] [Order article via Infotrieve]
  36. Hostomsky, Z., Hostomska, Z., Hudson, G. O., Moomaw, W. W., and Nodes, B. R. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 1148-1152 [Abstract/Free Full Text]
  37. Smith, J. S., Gritsman, K., and Roth, R. M. J. (1994) J. Virol. 68, 5721-5729 [Abstract/Free Full Text]
  38. Smith, J. S., and Roth, M. J. (1993) J. Virol. 67, 4037-4049 [Abstract/Free Full Text]
  39. Stahl, S. J., Kaufman, J. D., Vikic-Topic, S., Crouch, R. J., and Wingfield, P. T. (1994) Protein Eng. 7, 1103-1108 [Abstract/Free Full Text]
  40. Keck, J. L., and Marqusee, S. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 2740-2744 [Abstract/Free Full Text]
  41. Cerritelli, S. M., Shin, D. Y., Chen, H. C., Gonzales, M., and Crouch, R. J. (1993) Biochimie (Paris) 75, 107-111 [Medline] [Order article via Infotrieve]
  42. Post, K., Guo, J., Kalman, E., Uchida, T., Crouch, R. J., and Levin, J. G. (1993) Biochemistry 32, 5508-5517 [CrossRef][Medline] [Order article via Infotrieve]
  43. Dirksen, M.-L., and Crouch, R. J. (1981) J. Biol. Chem. 256, 11569-11573 [Abstract/Free Full Text]
  44. Carl, P. L., Bloom, L., and Crouch, R. J. (1980) J. Bacteriol. 144, 28-35 [Abstract/Free Full Text]
  45. Zhan, X., Tan, C.-K., Scott, W. A., Mian, A. M., Downey, K. M., and So, A. G. (1994) Biochemistry 33, 1366-1372 [CrossRef][Medline] [Order article via Infotrieve]
  46. Oyama, F., Kikuchi, R., Crouch, R. J., and Uchida, T. (1989) J. Biol. Chem. 264, 18808-18817 [Abstract/Free Full Text]
  47. Levin, J. G., Crouch, R. J., Post, K., Hu, S. C., McKelvin, D., Zweig, M., Court, D., and Gerwin, B. (1988) J. Virol. 62, 4376-4380 [Abstract/Free Full Text]
  48. Schultz, S. J., Whiting, S. H., and Champoux, J. J. (1995) J. Biol. Chem. 270, 24135-24145 [Abstract/Free Full Text]
  49. Palaniappan, C., Fay, P. J., and Bambara, R. A. (1995) J. Biol. Chem. 270, 4861-4869 [Abstract/Free Full Text]
  50. Peliska, J. A., Balasubramanian, S., Giedroc, D. P., and Benkovic, S. J. (1994) Biochemistry 33, 13817-13823 [CrossRef][Medline] [Order article via Infotrieve]

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Virol.Home page
K. W. Chang, J. G. Julias, W. G. Alvord, J. Oh, and S. H. Hughes
Alternate Polypurine Tracts (PPTs) Affect the Rous Sarcoma Virus RNase H Cleavage Specificity and Reveal a Preferential Cleavage following a GA Dinucleotide Sequence at the PPT-U3 Junction
J. Virol., November 1, 2005; 79(21): 13694 - 13704.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. A. Gaidamakov, I. I. Gorshkova, P. Schuck, P. J. Steinbach, H. Yamada, R. J. Crouch, and S. M. Cerritelli
Eukaryotic RNases H1 act processively by interactions through the duplex RNA-binding domain
Nucleic Acids Res., April 14, 2005; 33(7): 2166 - 2175.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Olivares, J. L. Garcia-Perez, M. C. Thomas, S. R. Heras, and M. C. Lopez
The Non-LTR (Long Terminal Repeat) Retrotransposon L1Tc from Trypanosoma cruzi Codes for a Protein with RNase H Activity
J. Biol. Chem., July 26, 2002; 277(31): 28025 - 28030.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C. S. Snyder and M. J. Roth
Comparison of Second-Strand Transfer Requirements and RNase H Cleavages Catalyzed by Human Immunodeficiency Virus Type 1 Reverse Transcriptase (RT) and E478Q RT
J. Virol., October 15, 2000; 74(20): 9668 - 9679.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
S. J. Schultz, M. Zhang, C. D. Kelleher, and J. J. Champoux
Polypurine Tract Primer Generation and Utilization by Moloney Murine Leukemia Virus Reverse Transcriptase
J. Biol. Chem., December 3, 1999; 274(49): 34547 - 34555.
[Abstract] [Full Text] [PDF]


Home page
Protein Eng Des SelHome page
E. R. Goedken and S. Marqusee
Metal binding and activation of the ribonuclease H domain from Moloney murine leukemia virus
Protein Eng. Des. Sel., November 1, 1999; 12(11): 975 - 980.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. D. Powell, W. A. Beard, K. Bebenek, K. J. Howard, S. F. J. Le Grice, T. A. Darden, T. A. Kunkel, S. H. Wilson, and J. G. Levin
Residues in the alpha H and alpha I Helices of the HIV-1 Reverse Transcriptase Thumb Subdomain Required for the Specificity of RNase H-catalyzed Removal of the Polypurine Tract Primer
J. Biol. Chem., July 9, 1999; 274(28): 19885 - 19893.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
T. Wu, J. Guo, J. Bess, L. E. Henderson, and J. G. Levin
Molecular Requirements for Human Immunodeficiency Virus Type 1 Plus-Strand Transfer: Analysis in Reconstituted and Endogenous Reverse Transcription Systems
J. Virol., June 1, 1999; 73(6): 4794 - 4805.
[Abstract] [Full Text]


Home page
J. Virol.Home page
C. M. Smith, O. Leon, J. S. Smith, and M. J. Roth
Sequence Requirements for Removal of tRNA by an Isolated Human Immunodeficiency Virus Type 1 RNase H Domain
J. Virol., August 1, 1998; 72(8): 6805 - 6812.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Haruki, E. Noguchi, S. Kanaya, and R. J. Crouch
Kinetic and Stoichiometric Analysis for the Binding of Escherichia coli Ribonuclease HI to RNA-DNA Hybrids Using Surface Plasmon Resonance
J. Biol. Chem., August 29, 1997; 272(35): 22015 - 22022.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. J. Schultz, M. Zhang, C. D. Kelleher, and J. J. Champoux
Analysis of Plus-strand Primer Selection, Removal, and Reutilization by Retroviral Reverse Transcriptases
J. Biol. Chem., October 6, 2000; 275(41): 32299 - 32309.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhan, X.
Right arrow Articles by Crouch, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhan, X.
Right arrow Articles by Crouch, R. J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1997 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement