Volume 272, Number 36,
Issue of September 5, 1997
pp. 22913-22923
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.
Regulation of Inosine-5
-monophosphate Dehydrogenase Type II Gene
Expression in Human T Cells
ROLE FOR A NOVEL 5
PALINDROMIC OCTAMER SEQUENCE*
(Received for publication, February 18, 1997, and in revised form, June 18, 1997)
Albert G.
Zimmermann
,
Kenneth L.
Wright
§¶,
Jenny P.-Y.
Ting
§¶ and
Beverly S.
Mitchell
¶
From the Departments of
Pharmacology,
§ Microbiology and Immunology, and
Internal Medicine,
School of Medicine, and the ¶ Lineberger Comprehensive Cancer
Center, University of North Carolina,
Chapel Hill, North Carolina 27599
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES
ABSTRACT
Expression of the gene encoding human inosine-
5
-monophosphate dehydrogenase (IMPDH) type II, an enzyme catalyzing
the rate-limiting step in the generation of guanine nucleotides, is
increased more than 10-fold in activated peripheral blood T lymphocytes
and is required for T cell activation. We have examined the
5
-regulatory sequences that are important for the transcriptional
regulation of this gene in T cells. DNase I mapping of genomic DNA
identified a hypersensitive element near the transcription initiation
site. Fine mapping by in vivo footprinting demonstrated
five transcription factor binding sites that are occupied in both
resting and activated peripheral blood T lymphocytes; these are tandem
CRE motifs, a Sp1 site, an overlapping Egr-1/Sp1 site, and a novel
palindromic octamer sequence (POS). The tandem CRE and POS sites are of
major functional importance as judged by mutational and electrophoretic mobility shift analyses. These data provide evidence that expression of
the human IMPDH type II gene is predominantly regulated by the nuclear
factors ATF-2 and an as yet unidentified POS-binding protein.
Additional major protein-DNA interactions do not occur within the
promoter region after T lymphocyte activation, indicating a requirement
for additional protein-protein interactions and/or post-translational
modifications of pre-bound transcription factors to account for the
observed increase in IMPDH type II gene expression.
INTRODUCTION
Cellular inosine-5
-monophosphate dehydrogenase
(IMPDH,1 EC 1.1.1.205)
enzymatic activity is the result of the expression of two independent
genes, IMPDH type I and type II, that encode proteins with identical
catalytic activities (1-5). IMPDH catalyzes the
NAD-dependent oxidation of inosine 5
-monophosphate to
xanthosine 5
-monophosphate in the de novo synthesis of
guanine deoxy- and ribonucleotides required for DNA and RNA
biosynthesis, respectively. Increased IMPDH activity has been
correlated with both cellular proliferation and malignant
transformation (6, 7). The IMPDH type II mRNA transcript is the
predominant of the two species in most normal cells and tissues and is
expressed at significantly increased levels in replicating and
neoplastic cells and upon T lymphocyte activation (8-11). The pivotal
role that this increase in enzymatic activity and concomitant increase
in guanine nucleotide biosynthesis plays in T lymphocyte activation is
illustrated by the ability of selective IMPDH inhibitors, such as
mycophenolic acid and mizoribine, to abrogate T lymphocyte responses
both in vitro and in vivo (12-14). These agents
also induce cell differentiation in a number of cultured leukemic cell
lines (15-18) and in primary leukemic cells from patients with blast
crisis of chronic myelocytic leukemia (13). Such inhibitors are in
current clinical use as immunosuppressive drugs in the prevention of
allograft rejection (19, 20).
We have recently shown that the human IMPDH type II gene located on
chromosome 3p21.2
24.2 (3) is approximately 5.8 kb in length and
consists of 14 exons varying in size from 49 to 207 bp (21). The
transcription initiation site was located by primer extension analysis
and RNase protection to a position 50 bp upstream of the translation
initiation codon. The 5
-flanking region of the type II gene previously
identified as containing promoter activity consists of 463 base pairs
upstream of and including the translation initiation site. Transfection
of a chloramphenicol acetyltransferase reporter gene construct
containing this DNA sequence into human peripheral blood T lymphocytes
resulted in a significant increase in expression over base line after
activation of the cells with phorbol ester and ionomycin, suggesting
that it contains the regulatory elements necessary for the activation associated increase in gene expression. In vitro DNase I
footprinting analysis using Jurkat T cell nuclear extract identified
four protected regions in the promoter that coincided with consensus
transcription factor binding sites including AP2, tandem CREs, an
overlapping Egr-1/Sp1 site, and an Nm23 motif, but the functional
significance of these sites remained a subject of speculation (21).
In view of the important role of IMPDH type II gene expression in both
T lymphocyte activation and neoplasia, we have investigated the
molecular mechanisms governing the regulation of this gene in the most
physiologically relevant system, human primary T lymphocytes. To
identify the specific elements required for differential expression at
the transcriptional level, we have asked whether differential occupancy
of specific transcription factor binding sites occurs in
vivo as a consequence of T lymphocyte activation and have further examined the functional significance of these sites.
MATERIALS AND METHODS
Isolation of Peripheral Blood T Lymphocytes
Buffy coats
from normal donors were obtained from the American Red Cross
(Charlotte, NC), and the mononuclear cells were isolated by density
gradient centrifugation using Histopaque-1077 (Sigma). Cells at the
interface were removed, washed three times with phosphate-buffered saline (PBS) (350 × g, 37 °C), and resuspended in
RPMI 1640 medium containing 10% heat-inactivated fetal calf serum
(Hyclone Laboratories, Logan, UT). Monocytes were depleted by adherence
and B lymphocytes by maintaining cells in culture for 3 days prior to
stimulation. Flow cytometric analysis of the isolated T lymphocytes
with an anti-CD2+ marker revealed a greater than 95%
enrichment of CD2+ T cells. Cellular
[3H]thymidine incorporation into DNA from resting and
activated T lymphocytes was determined as a measure of proliferative
activity.
mRNA Stability
Peripheral blood T lymphocytes
(107 cells/sample) from a single donor were stimulated
consecutively with 1 µg/ml PHA (Sigma) and 10 units/ml IL-2 (Sigma)
for 48, 24, 3, and 0 h. At time 0 h, the cells were treated
with 5 µg/ml actinomycin D (Sigma) for 0, 2, 4, 6, 8, and 10 h.
Total cellular RNA was isolated with Tri-Reagent (MRC, Cincinnati, OH),
dissolved in Formazol (MRC), and 5 µg analyzed on denaturing
formaldehyde-agarose gels. The RNA was transferred to ZetaProbe GT
membranes (Bio-Rad) using Northern transfer solution (MRC). Membranes
were prehybridized and hybridized according to and using the high
efficiency hybridization system (MRC) and sequentially probed with
random-primed [
-32P]dCTP-labeled full-length IMPDH
type II cDNA (provided by Dr. F. Collart, Argonne National
Laboratory, Argonne, IL) and a [
-32P]ATP end-labeled
human 28 S rRNA-specific oligonucleotide
(5
-AAAACGATCAGAGTAGTGGTATTTCACCG-3
)(CLONTECH, Palo Alto, CA). mRNA levels were quantitated with a PhosphorImager (Molecular Dynamics, Sunnyvale, CA) after a 3-day exposure for the
IMPDH type II probe and a 4.5-h exposure for the 28 S rRNA probe.
IMPDH type II mRNA levels were normalized for 28 S rRNA loading,
and the values were plotted on a logarithmic scale.
DNase I-hypersensitive Site Analysis
The locations of DNase
I-hypersensitive sites were mapped according to the method of Wu (22).
Briefly, nuclei from 108 Jurkat T E6-1 cells (23) were
swollen on ice for 5 min by incubation in 50 ml of hypotonic
reticulocyte standard buffer (10 mM Tris, pH 7.4, 10 mM NaCl, 5 mM MgCl2), isolated by
centrifugation (500 × g, 4 °C, 5 min), and
subsequently lysed (4 °C, 5 min) in 25 ml of reticulocyte standard
buffer containing 0.5% Nonidet P-40. The nuclei were isolated by
centrifugation (500 × g, 4 °C, 5 min), resuspended
in 0.5 ml of DNase I digestion buffer (10 mM HEPES, pH 7.5, 10 mM NaCl, 5 mM MgCl2, 1 mM CaCl2), and digested with various
concentrations of DNase I (0, 0.05, 0.1, 0.25, 0.5, 0.75, 1, and 2 µg/ml) (Worthington) for 15 min at 37 °C. The reaction was
terminated with the addition of freshly prepared proteinase K (10 mg/ml) (Sigma) in stop solution (20 mM Tris-HCl, pH 7.4, 600 mM NaCl, 5 mM EDTA, 1% SDS). Following
overnight incubation at 37 °C, the DNA was extracted twice with
phenol/chloroform, once with chloroform and subsequently precipitated
with isopropyl alcohol in the presence of 2.5 M
NH4OAc. The DNA (15 µg) was digested overnight with
SacI and separated on a 1% agarose gel. The gel was
denatured in 0.5 M NaOH for 1 h, neutralized in 1 M Tris-HCl, pH 7.5, 1.5 M NaCl for 1 h,
and transferred overnight onto ZetaProbe GT membrane (Bio-Rad). The
blots were prehybridized (50% formamide, 0.12 M
Na2HPO4, pH 7.2, 0.25 M NaCl, 7%
SDS) for 1 h at 42 °C and hybridized overnight in high
efficiency hybridization system (MRC) with [
-32P]ATP
end-labeled probes obtained by PCR of exon 5 (forward primer, 5
-TTCATCACAGACCCTGTGGTCCTC-3
; reverse primer,
5
-CCAAGAAACAGTCATGTTCCTCCT-3
) and exons 6 and 7 (forward primer,
5
-AAGACTTGGTGGTAGCCCCTGC-3
; reverse primer,
5
-ACTTGTCATCCTCATGAGTGCC-3
), washed, and autoradiographed for 4 and 2 days, respectively.
In Vivo Footprinting
In vivo methylation and
isolation of DNA from T lymphocytes and Jurkat T E6-1 cells were
performed as described previously (24). Peripheral blood T lymphocytes
were cultured in the absence or presence of PHA-L (6 µg/ml) and IL-2
(10 units/ml) for 24, 48, and 72 h, respectively. Jurkat E6-1
cells were cultured in the absence or presence of PMA (10 ng/ml) for
3 h. IL-2 receptor expression in resting and activated T
lymphocytes was determined by flow cytometry using the CD25 antibody
M-A251 (Pharmingen, San Diego, CA). Cells (108) were
harvested by centrifugation, resuspended in 10 ml of RPMI 1640, and
methylated using 1 µl/ml dimethyl sulfate for 5 min at 37 °C. The
reaction was terminated by the addition of ice-cold PBS containing 60 mM Tris, pH 7.5. The cells were recovered by centrifugation
(900 × g, 4 °C, 2 min), washed in PBS/Tris, and lysed in 0.5 ml of lysis buffer (60 mM Tris, pH 7.5, 100 mM EDTA, 0.1% SDS, 500 µg/ml proteinase K) for 4 h
at room temperature. Genomic DNA was extracted by the addition of 1 ml
of phenol followed by an equal volume of chloroform:isoamyl alcohol
(24:1). The aqueous phase was removed and extracted with
chloroform:isoamyl alcohol. The DNA was spooled in the presence of
volume of 3 M NaOAc and 2.5 volumes of ethanol,
resuspended in 1 ml of 10 mM Tris, pH 8, 0.1 mM
EDTA, incubated overnight at 4 °C, and digested with 100 units of
HindIII restriction enzyme for 4 h at 37 °C. Digests
stored overnight (4 °C) were extracted as described above,
resuspended in 200 µl of 10 mM Tris, pH 8, 0.1 mM EDTA, and stored at 4 °C. Control DNA was methylated
in vitro with 1 µl of dimethyl sulfate for 15 s. The
reaction was terminated by the addition of 50 µl of 1.5 M
NaOAc, pH 7, 1 M
-mercaptoethanol, 100 µg/ml tRNA, and
the DNA was precipitated with 750 µl of ethanol. Piperidine diluted
1:10 (200 µl) was added to the pellet, and the samples were incubated
at 90 °C for 30 min, frozen, and lyophilized. Two additional
lyophilizations were performed from 100 and 50 µl of distilled
H2O volumes, respectively, and the DNA was diluted to 1.5 µg/µl in distilled H2O. The ligation-mediated PCR was
performed as described previously (25) with modifications (26). Two
primer sets were used to encompass the IMPDH type II 5
-flanking region
(bp
267 to
14) upper strand: P1(
333), 5
-TTTTGGGGAGGAGCCCG-3
(Tm = 60 °C); P2(
318),
5
-CGGCGGGACAGTAGAAGTAAACCCTTGC-3
(Tm = 65 °C);
P3(
318), 5
-CGGCGGGACAGTAGAAGTAAACCCTTGCCTG-3
(Tm = 67 °C), and lower strand: P1(83), 5
-TCTCCGCAGTTGAAGAGC-3
(Tm = 58 °C); P2(29),
5
-GTGCCCCCACTAATCAGGTAGTCGGC-3
(Tm = 65 °C);
P3(29), 5
-GTGCCCCCACTAATCAGGTAGTCGGCCATG-3
(Tm = 67 °C).
Transient Transfections
Chloramphenicol acetyltransferase
(CAT) reporter constructs (10 µg) were transfected into
107 exponentially growing Jurkat T E6-1 cells.
Promoter-deletion CAT constructs were transfected in equimolar ratios
adjusted for promoter insert size. Cells were maintained in RPMI 1640 medium supplemented with 2 mM L-glutamine, 100 units/ml penicillin, 100 µg/ml streptomycin, and 10% fetal calf
serum (Hyclone Laboratories) and cultured at 37 °C in a humidified
atmosphere in the presence of 5% CO2. Electroporations
were performed at room temperature in the presence of RPMI 1640 lacking
Ca2+ using a Bio-Rad Gene Pulser with settings at 250 V/960
microfarads. The transfected cells were cultured for 48 h,
harvested, washed three times with PBS, resuspended in 150 µl of 0.25 M Tris-HCl, pH 8.0, and extracted with three cycles of
freeze-thawing. Aliquots were heated to 60 °C for 10 min and
centrifuged at 16,000 × g for 10 min. The supernatants
were assayed with 0.1 µCi of [14C]chloramphenicol and
25 µg of n-butyryl coenzyme A for 2 h, extracted with
xylenes according to the Promega CAT Enzyme Assay System (Madison, WI),
and analyzed by liquid scintillation counting. Protein concentrations
were determined with the Micro BCA Protein Assay Reagent Kit
(Pierce).
Nuclear Extracts
Nuclear extracts from control and PMA (10 ng/ml)-treated Jurkat T E6-1 cells and peripheral blood T lymphocytes
cultured in the absence or presence of PHA-L (1 µg/ml) (Sigma) and
IL-2 (10 units/ml) (Life Technologies, Inc.) for 3, 6, 12, and 24 h, respectively, were prepared according to the method of Dignam
et al. (27) with modifications (28). The nuclear extraction
was performed at 4 °C. Cells were washed twice with 50 ml of PBS and
resuspended in 5 pellet volumes of buffer A (10 mM HEPES,
pH 7.9, 0.75 mM spermidine, 0.15 mM spermine,
10 mM KCl, 0.1 mM EDTA, 0.1 mM
EGTA, 1 mM DTT, 1 mM PMSF), incubated for 5 min, homogenized with a B pestle in a Dounce homogenizer, and
centrifuged at 30,000 × g for 30 s. The nuclei
were resuspended in 1 pellet volume of buffer C (20 mM
HEPES, pH 7.9, 0.75 mM spermidine, 0.15 mM
spermine, 0.2 mM EDTA, 2 mM EGTA, 2 mM DTT, 1 mM PMSF, 20% glycerol), the NaCl
concentration adjusted to 0.4 M, the nuclei agitated for 20 min, and the nuclear extract subsequently obtained by pelleting the
nuclei at 30,000 × g for 60 min. Control Jurkat T cell
nuclear extract was subsequently dialyzed 2 × 90 min in buffer D
(20 mM HEPES, pH 7.9, 12.5 mM
MgCl2, 100 mM KCl, 0.2 mM EDTA, 0.2 mM EGTA, 2 mM DTT, 1 mM PMSF, 17%
glycerol). The extracts were aliquoted and stored at
70 °C.
Electrophoretic Mobility Shift Assays
Wild-type and mutant
double-stranded oligonucleotides were generated by annealing
complementary single-stranded oligonucleotides and either labeled by
fill-in using Klenow DNA polymerase or kinasing using T4 polynucleotide
kinase (Promega). Labeled double-stranded oligonucleotides were
purified on 1 ml of Sephadex G-50 (Sigma) columns. The flow-through was
precipitated with
volume of 3 M NaOAc and 3 volumes of ethanol, washed with 95% ethanol, and resuspended at 20,000 cpm/µl. For competition experiments, unlabeled wild-type and mutant
oligonucleotides were prepared by using unlabeled deoxynucleotides for
fill-in and precipitated as described above. One µl of probe
(approximately 0.1 ng of DNA) was incubated with 8 µg of nuclear
extract in the presence of 20 mM HEPES, pH 7.5, 0.5 mM DTT, 1 mM EDTA, 2 mM
MgCl2, 50 mM KCl, 12% glycerol, and 2 µg of
poly(dI-dC) (Sigma). Reactions were preincubated on ice for 10 min in
the presence of competitor or 30-60 min in the presence of antibodies.
Probe was added to the mixture, and the reaction was incubated at room
temperature for 20 min. The protein-DNA complexes were resolved on
native 4% polyacrylamide (30:1, acrylamide:bisacrylamide), 0.5 × Tris/borate/EDTA minigels at 100 V, dried, and autoradiographed.
Electrophoretic mobility shift analysis (EMSA) supershift experiments
were performed with 1 µg of each antibody as follows: the ATF-1
antibody (sc-270X) that cross-reacts with CREB-1 and CREM-1, and the
specific antibodies ATF-1 (sc-241X), ATF-2 (sc-187X), CREB-1 (sc-186X),
CREM-1 (sc-440X), Sp1 (sc-59X), and Egr-1 (sc-110X) (Santa Cruz
Biotechnology, Santa Cruz, CA).
Deletion Constructs
Promoter fragments were subcloned into
the Klenow DNA polymerase filled-in HindIII site of
pCATBasic unless stated otherwise. A 466-bp construct containing the
5
-flanking region extending from an EcoRI to an
NcoI site at the ATG initiation codon in the first exon (bp
463 to +3) was obtained by isolating the region from pGEM466 (21)
using the multiple cloning region (MCR)
HindIII/XbaI sites and subcloning the fragment
into the identical sites of pCATBasic. To remove the translation
initiation codon, a 461-bp promoter fragment was released by a
HindIII/MscI digest, the insert HindIII site filled in, and the fragment subcloned into
pCATBasic in the 5
3
orientation (pCATBasic461). A pCATBasic1027
promoter construct was obtained by cloning a 1029-bp NcoI 5
fragment containing the translation initiation site into pCATBasic in
5
3
orientation and removing the translation initiation site by
replacing the 3
region with the SphI fragment (bp
199 to
MCR) obtained from pCATBasic461. The SphI fragment was
subcloned into the pCATBasic MCR SphI in 5
3
orientation to obtain pCATBasic197. The SphI fragment was
digested with NlaIV (bp
143), treated with mung bean
nuclease (New England Biolabs, Beverly, MA), and the 3
region subcloned into pCATBasic to yield the 5
3
construct pCATBasic141. The constructs were sequenced, and the amount of transfected DNA was
normalized for promoter insert size.
Site-directed Mutagenesis
Transcription factor binding
sites in the promoter region were mutagenized according to the method
of Jones et al. (29). Primary and secondary PCR reactions
were performed using Pfu polymerase (Stratagene, La Jolla,
CA). The template for the site-directed mutagenesis consisted of the
4.8-kb genomic clone contained in pGEM7Zf(+) (21). The 22-bp forward
primer 5
-TGGGCTGACAGACTTTGCTGAC-3
annealing to position
716 to
695 bp and the 26-bp reverse complementary primer
5
-GTTGAAGAGCTGCTGTGCTGTGAGTC-3
annealing to position +49 to +75 bp
relative to the translation initiation site were used as the flanking
primers for the PCR-mediated mutagenesis. Sequences of oligonucleotides
used for the mutagenesis are shown in Table I. The mutated 461-bp
promoter fragments were released with an
EcoRI/MscI digest, filled-in with Klenow DNA
polymerase, gel-purified, subcloned into the filled-in
HindIII site of pCATBasic, and sequenced. A promoter
construct containing both CRE site mutations was generated and assayed
in transient transfection assays. This double mutation resulted in a
single cytosine-bp deletion in the CRE(B) site.
RESULTS
IMPDH Type II mRNA Stability in Resting and Activated T
Lymphocytes
To determine whether differential mRNA stability
could play a role in the increase in IMPDH type II expression, mRNA
levels were quantitated in resting and activated T lymphocytes
following actinomycin D treatment. IMPDH type II mRNA levels
increased in a time-dependent fashion upon T lymphocyte
stimulation with PHA and IL-2 (Fig.
1A). Levels increased 2-, 19-, and 15-fold over those in unstimulated T lymphocytes after 3, 24, and
48 h of stimulation, respectively, in the absence of actinomycin D
(time 0 h). The rate of decrease in IMPDH type II mRNA after
actinomycin D treatment was similar in resting and activated T
lymphocytes with t1/2 values of 6, 4.5, 5, and
5 h at 0, 3, 24, and 48 h of stimulation, respectively (Fig.
1B). The lack of an increase in mRNA stability in
activated T lymphocytes confirms our previous studies implicating a
primary role for transcriptional regulation in the increased expression of this gene (21). In addition, in a separate experiment, we quantitated the increase in IMPDH type II mRNA by Northern blot analysis in isolated CD4 and CD8 T lymphocyte subpopulations. IMPDH
type II mRNA levels increased 11-fold in CD4 and 5-fold in CD8
cells after 24 h, indicating up-regulation of gene expression on
activation of both lymphocyte populations (data not shown).
Fig. 1.
IMPDH type II mRNA half-life
determinations in resting and activated T lymphocytes. A,
resting (0 h) and activated (3, 24, and 48 h) peripheral blood T
lymphocytes were treated with 5 µg/ml actinomycin D for the indicated
time intervals. RNA was isolated, 5 µg run on denaturing gels,
blotted onto nylon membrane, and sequentially probed with IMPDH type II
cDNA and a 28 S rRNA-specific oligonucleotide. B, IMPDH
type II mRNA and 28 S rRNA levels were quantitated using a
Molecular Dynamics PhosphorImager and IMPDH type II mRNA expression
normalized for 28 S rRNA expression. [3H]Thymidine
uptake was increased 15-fold in the activated T lymphocytes after
48 h of stimulation.
[View Larger Version of this Image (50K GIF file)]
Mapping of DNase I-hypersensitive Elements at the IMPDH Type II
Locus
To define cis-acting regulatory regions in the
IMPDH type II gene, the chromatin structure of the gene and surrounding
regions encompassing approximately 11 kb were mapped for sites that are hypersensitive to digestion with DNase I (Fig.
2A). An exon 5 probe
corresponding to the 3
end of a 4.8-kb SacI genomic
fragment revealed a DNase I-hypersensitive element (I) that localizes
to the 5
-flanking region of the IMPDH type II gene previously
demonstrated to contain promoter activity and a cluster of potential
transcription factor binding motifs that include AP2, CRE, Egr-1, Nm23,
and Sp1 (21) (Fig. 2, A and B). An exon 6 probe
corresponding to the 5
end of a 6.4-kb SacI genomic
fragment identified a region containing two hypersensitive elements (II
and III) approximately 0.5 kb apart and located 2.5 and 3.0 kb 3
to
the end of the coding region (Fig. 2, A and C).
Further sequencing of this region demonstrated sequence identities with
several cDNA sequences (W01132, D61550, D81230, and N27626) in
GenBank. Alignment of these overlapping cDNA fragments with the
region 3
to the IMPDH type II gene identified a 2-kb gene that is
oriented tail-to-tail with respect to the IMPDH type II gene and
terminates 1 kb 3
to it. This gene contains 6 exons of 289, 113, 190, 67, 99, and 232 bp with corresponding introns of 80, 120, 161, 107, and
79 bp (Fig. 2A, shaded boxes). DNase I-hypersensitive sites
II and III are located at the 5
end of this gene, suggesting that they
may be involved in its regulation rather than in that of the IMPDH type
II gene.
Fig. 2.
DNase I-hypersensitive site analyses of the
IMPDH type II gene. A, SacI restriction map of
the IMPDH type II gene with the 14 exons denoted by open
boxes. The six exons of a downstream gene are represented by
shaded boxes and the upstream gene by a hatched
box. Nuclei from the human Jurkat T cell line were either untreated (0 and 37 °C) or treated with increasing concentrations of
DNase I (indicated by the wedges) prior to isolation of
genomic DNA, digestion with the restriction enzyme SacI, and
Southern blot analysis with an exon 5 (B) or exon 6/7
(C) probe. The 4.8- and 6.4-kb genomic SacI
fragments and the positions of the three DNase I-hypersensitive sites
are indicated on the schema of the IMPDH type II gene. Replicated DNA
size markers are shown to the left of B.
[View Larger Version of this Image (71K GIF file)]
Additional GenBank cDNA sequences (N51229, H56404, and H80241) were
found to be 100% identical to a 713-bp region extending 5
from bp
307 relative to the transcription initiation site of the IMPDH type
II gene (21) (Fig. 2A, hatched box). Similar
sequences were found at the same location upstream of the mouse IMPDH
type II coding region. From these data, it appears that the IMPDH type
II gene and another unidentified gene 5
to it are oriented
head-to-head to one another, raising the possibility that the
intergenic region could serve as a bidirectional promoter for both
genes. Indeed, our previous results demonstrated that a 466-bp IMPDH
type II promoter CAT construct was active in both the 5
3
and 3
5
orientations, with 7-fold less activity with the latter
construct (21). The identity and function of the proteins encoded by
the two genes closely flanking the IMPDH type II gene are currently
unknown.
Delineation of a Minimal IMPDH Type II Promoter
To define the
boundaries of the promoter region and the relevance of the specific
cis-acting elements that were previously identified by
in vitro footprinting (21), transient transfection assays
were performed with promoter-deletion CAT reporter constructs using
Jurkat T cells. Constructs containing 1027, 461, and 197 bp of
5
-flanking sequence terminating 2 bp upstream of the translation initiation site were examined for promoter activity and found to
increase CAT activity by 264, 326, and 278-fold over pCATBasic, respectively (Fig. 3A and
B). The differences in activities among these constructs in
three experiments were not significant, suggesting that the 197-bp
5
-flanking region (pCATBasic197) contains the elements required for
constitutive IMPDH type II promoter activity in this T cell line.
However, a further truncation of 56 bp (pCATBasic141) resulted in a
72% decrease in promoter activity, indicating that elements in this
region including the overlapping Egr-1/Sp1 site (bp
143 to
199)
contribute significantly to promoter activity. The pCATBasic141
construct that accounts for the residual 28% of promoter activity
contains binding sites for Sp1, the ATF/CREB family of transcription
factors, and TATA-binding protein (21).
Fig. 3.
Deletion analysis of the IMPDH type II
promoter. A, schematic representation of the IMPDH type II
gene's 5
-flanking region and the deletion constructs with the
position of transcription factor binding motifs shown relative to the
deleted regions and the transcription and translation initiation sites.
B, chloramphenicol acetyltransferase activities of the IMPDH
type II deletion constructs transiently transfected into Jurkat T
cells. Values represent the average of duplicate determinations in a
single experiment. Data from two additional experiments gave similar
results.
[View Larger Version of this Image (37K GIF file)]
In Vivo Footprinting
To clarify the in vivo
significance of putative regulatory regions in the promoter, we
performed in vivo footprinting experiments on DNA in resting
and activated peripheral blood T lymphocytes and control and
PMA-treated Jurkat T cells. Two primer sets were used to visualize the
regions between nucleotides
267 and
14 relative to the ATG
translation initiation site. Fig. 4
identifies a number of contact regions on both the upper and lower DNA
strands of this region in resting and activated T lymphocytes (Fig.
4, A plus inset and B, respectively).
Alignment of these protein-DNA contact sites with the promoter sequence
(Fig. 4C) identified clustering at several putative
transcription factor binding sites, including the tandem CRE motifs
(CRE(A)(
88 to
95) and CRE(B)(
114 to
121)), a Sp1 site (
133 to
142), and an overlapping Sp1/Egr-1 site (
162 to
172). In
addition, protein-DNA contacts were observed at a site we have termed
the "palindromic octamer sequence" or POS (CGCATGCG)(
193 to
200) that does not correspond with any known transcription factor
binding site identified in the Genetics Computer Group transcription
factor data base (Madison, WI). The detected binding sites were
similar, although not identical, in resting and activated T lymphocytes
and control and PMA-treated Jurkat T cells. The regions of minor change
in protein-DNA contacts observed upon T lymphocyte activation are
indicated by an asterisk in Fig. 4. The upper DNA strand
revealed an enhanced cleavage site at bp
42 adjacent to a consensus
AML1-binding site in resting T lymphocytes (Fig. 4A, lane
4). Extensions of the footprints at the POS site (bp
212 and
215) and TATA box (bp
83) were noted on the lower strand in T
lymphocytes treated with PHA and IL-2 for 24, 48, and 72 h (Fig.
4B, lanes 5-7). In addition, an enhanced cleavage site was
observed in PMA-treated Jurkat T cells and activated T lymphocytes at
the Egr-1/Sp1 site (bp
162) (Fig. 4B, lanes 2, 5-7). The
apparent protection observed on the lower DNA strand at the bottom of
Fig. 4B was not consistently observed in these experiments
and also could not be detected on longer gel runs of the upper DNA
strand (Fig. 4A). Together these findings suggest that
nuclear proteins are pre-bound at the CRE(A), CRE(B), Sp1, the
overlapping Egr-1/Sp1, and the POS sites in resting T lymphocytes and
that PHA and IL-2 stimulations, while perhaps modifying these proteins
or causing additional protein-protein interactions, do not result in
major additional protein-DNA interactions.
Fig. 4.
In vivo footprinting of protein-DNA
interactions in the IMPDH type II promoter by ligation-mediated PCR.
In vivo footprint analysis of the upper
(A) and lower (B) strands of the
proximal IMPDH type II promoter. Control DNA was methylated in
vitro (lane 3), and DNA from Jurkat T cells in the
absence and presence of PMA (lanes 1 and 2) and
resting and activated peripheral blood T lymphocytes (lanes
4-7) was methylated in vivo, as described under
"Materials and Methods." Stimulation of T lymphocytes resulted in
increases in [3H]thymidine uptake of 3-, 81-, 192-fold at
24, 48, and 72 h, respectively. IL-2 receptor expression increased
from 16% in resting cells to 89, 95, and 98% in the 24-, 48-, and
72-h activated T lymphocytes. Flow cytometric mean channel fluorescence
increased from 21 in the resting T lymphocytes to 140, 361, and 505 in
24-, 48-, and 72-h activated T lymphocytes, respectively. Open
arrows indicate protected sites and solid arrows sites
of enhanced DNA cleavage with shorter arrows indicating
reduced protection from or enhancement of DNA cleavage. The
vertical arrow indicates the location of the transcription
initiation site. C, sequence of the IMPDH type II promoter
and summary of the in vivo contact points. Transcription factor binding sites are indicated by shaded boxes. The
experiment was repeated three times on T lymphocytes and twice on
Jurkat T cells with similar results.
[View Larger Version of this Image (79K GIF file)]
Mutational Analysis of Transcription Factor Binding
Sites
Site-directed mutations were engineered at the Egr-1/Sp1,
CRE(B), CRE(A), and AML1 sites, as well as the POS site in the
pCATBasic461 construct (Table I). The
double-stranded oligonucleotides containing each mutation were shown
not to compete with their respective wild-type sequences for binding of
nuclear factors in EMSA (data not shown). Fig.
5 demonstrates that mutation of the
proximal CRE(A) motif (located between bp
88 and
95) and the POS
site (located between bp
193 and
200) reduced promoter activity by 65 and 39% relative to wild-type activity. Lesser reductions in promoter activity were observed with the CRE(B) (9%) and Egr-1/Sp1 (25%) mutations. In striking contrast, mutagenesis of both the CRE(A)
and CRE(B) sites resulted in an 83% decrease in CAT activity, establishing a dominant role for these tandem sites in overall promoter
function. Transfections of these constructs were also performed using
peripheral blood T lymphocytes activated with PHA and IL-2. However,
the levels of CAT activity were extremely low, and the data could not
be interpreted.
Fig. 5.
Effect of mutagenesis of transcription factor
binding sites on IMPDH type II promoter activity. Transcription
factor binding sites in the 461-bp promoter fragment were subjected to site-directed mutagenesis using the oligonucleotides outlined in Table
I and wild-type and mutant constructs transfected into Jurkat T cells.
Results are expressed relative to the activity of pCATBasic461 (100%)
and represent the mean and standard deviation of three experiments
performed in duplicate.
[View Larger Version of this Image (58K GIF file)]
The 5
-untranslated regions of the human and mouse IMPDH type II genes
contain identical 17-bp repeats that are represented once in the human
and twice in the mouse gene (21, 30). This sequence includes an
AML1-binding site (31) and is located at bp
28 to
44 relative to
the translation initiation site in the human gene and at bp
28 to
44 and
45 to
61 in the mouse gene, suggesting an important
functional role for this region in gene expression. To test this
hypothesis, mutations were introduced in the AML1-binding site.
Mutation of this site consistently resulted in increased promoter
activity (133%).
Characterization of Nuclear Protein Binding to Individual
cis-Acting Elements by EMSA
To address the role of the in
vivo footprinted elements in the binding of relevant proteins from
nuclear extracts, the transcription factor binding sites POS,
Egr-1/Sp1, CRE(B), CRE(A), and AML1 were analyzed by EMSA using
nuclear extracts derived from resting and activated peripheral blood T
lymphocytes and Jurkat T cells cultured in the absence and presence of
PMA. Competition experiments with wild-type and corresponding
mutant oligonucleotides confirmed the specificity of the interactions
at the sites examined (data not shown). Fig.
6 illustrates that factors present in
resting T lymphocyte nuclear extract bind to the Egr-1/Sp1, CRE(B),
CRE(A), and AML1 sites as well as the POS site. T lymphocyte nuclear
extract obtained at 3 and 6 h after activation resulted in
increased binding of the Egr-1/Sp1 probe (Fig. 6). Binding to the
Egr-1/Sp1 oligonucleotide was slightly reduced at 12 and 24 h of
activation, whereas binding to the CRE(A) and CRE(B) motifs
progressively increased up to 24 h of T lymphocyte activation. In
addition, binding of nuclear factors to the consensus CRE(B) element
(TGACGTCA) was found to be consistently stronger than binding to the
partial consensus CRE(A) element (TGACGAAA) (Fig. 6). Nuclear factor
binding to both the POS and the AML1 site demonstrated a lower mobility
shift following T lymphocyte activation (3, 6, 12, and 24 h),
possibly indicating the assembly of a higher-order complex upon T
lymphocyte activation (Fig. 6). These data, in conjunction with the
in vivo footprinting results, suggest that T lymphocyte
activation leads to increased protein-DNA binding activity in nuclear
extracts that does not per se coincide with additional
transcription factor binding to the Egr-1/Sp1, CRE(B), and CRE(A)
motifs, while resulting in the formation of higher order complexes at
the POS and AML1 sites. Preliminary UV cross-linking experiments on the
POS site have identified three proteins in the range of 35-45 kDa in
both the lower and upper protein-DNA complexes (Fig. 6; indicated by arrows) formed with resting and activated T lymphocyte
nuclear extract, respectively, suggesting the binding of a
multimeric protein complex at this site (data not shown).
Fig. 6.
Binding of nuclear factors to the POS,
Egr-1/Sp1, CRE(B), CRE(A), and AML1 sites. Nuclear extracts were
prepared from resting T lymphocytes and T lymphocytes stimulated with 1 µg/ml PHA and 10 units/ml IL-2 for 3, 6, 12, and 24 h and
control and PMA (10 ng/ml, 3 h)-treated Jurkat T cells.
[3H]Thymidine incorporation into DNA was determined for
the T lymphocytes as a measure of proliferative activity and was 4-, 2-, 10-, and 9-fold above unstimulated T lymphocytes for the 3-, 6-, 12-, and 24-h time points, respectively.
[View Larger Version of this Image (57K GIF file)]
Binding of nuclear factors in extracts obtained from Jurkat T cells did
not differ from that obtained from resting T lymphocytes, whereas
extracts obtained from PMA-stimulated Jurkat T cells exhibited binding
patterns at the POS, Egr-1/Sp1, CRE(B), CRE(A), and AML1 sites similar
to that observed in PHA and IL-2-stimulated T lymphocytes. Only at the
overlapping Egr-1/Sp1 site was a higher mobility complex observed with
nuclear extract from PMA-stimulated Jurkat T cells that was not
detected in control Jurkat T cell and resting or activated T lymphocyte
nuclear extract (Fig. 6, indicated by arrow). EMSA of the
Egr-1/Sp1-binding site in the presence of specific anti-Egr-1 and
anti-Sp1 antibodies and nuclear extracts from control and PMA-treated
Jurkat T cells revealed that the low mobility complex consists of the
Sp1 transcription factor, and the higher mobility complex of the Egr-1
nuclear factor (Fig. 7A). EMSA
in the presence of consensus binding sites for Egr-1 and Sp1 further revealed that Egr-1 binding is absent in control Jurkat T cell nuclear
extract and is rapidly induced upon PMA stimulation (Fig. 7B). The lack of a similar complex in activated peripheral
blood T lymphocytes (Fig. 6) suggests that the transcription factor Egr-1 is not required for the induced expression of the IMPDH type II
gene in these cells. Furthermore, although the Egr-1/Sp1 site
(CCGCCCCCGCC) exhibits a high degree of identity to a consensus AP2-binding site (CCGCCCGCG) (32), binding of AP2 was not detected using supershift analysis (data not shown).
Fig. 7.
Characterization of Egr-1 and Sp1 binding to
the overlapping consensus Egr-1/Sp1 sites. EMSA and supershift
assays were performed using nuclear extracts from control and PMA (10 ng/ml, 3 h) -treated Jurkat T cells. A, transcription
factor binding to the wild-type IMPDH type II oligonucleotide
(GCCAGCTCCGCCCCCGCCGCAGCGAG) in the absence and presence of anti-Sp1
and anti-Egr-1 antibodies. B, transcription factor binding
to consensus Sp1 (CTCGCCCCGCCCCGATCGAAT) and Egr-1
(TCGCCCCCGCTCGCCCCCGCTGGATCC) sites in the absence and presence of anti-Sp1 and anti-Egr-1 antibodies. The identity of EMSA
complexes for A and B are indicated on the
right side of B.
[View Larger Version of this Image (33K GIF file)]
To define the nature of the proteins binding to the CRE sites, we
performed EMSA with the consensus CRE(B) site (Fig.
8) in the presence of control Jurkat T
cell nuclear extract and an ATF-1 antibody (sc-270X) that recognizes
ATF-1-, CREB-1-, and CREM-1, and ATF-1 (sc-241X)-, ATF-2 (sc-187X)-,
CREB-1, and CREM-1 (sc-440X)-specific antibodies. The consensus CRE(B)
site was used in preference to the CRE(A) site since nuclear factor
binding was consistently found to be more pronounced, whereas the
qualitative results obtained with the CRE(A) and CRE(B) sites were
identical using Jurkat T cells and peripheral blood T lymphocyte
nuclear extract. Indeed, competition experiments between the two CRE
sites in the presence of control Jurkat T cell nuclear extract revealed
that each site completely competes with the other for protein binding,
although the CRE(A) site exhibits a 10-fold lower affinity than does
the CRE(B) site (data not shown). The addition of antibody sc-270X to
Jurkat T cell nuclear extract resulted in a supershift of the lower
complex (Fig. 8, indicated by *). A slight supershift was observed in
the presence of the ATF-1-specific antibody sc-241X that was visible
upon longer exposure (location indicated). Incubation with an
ATF-2-specific antibody (sc-187X) resulted in a partial supershift of
the CRE(B) complex to an upper band and a lower band that comigrates
with the sc-270X supershift (Fig. 8, indicated by *). Antibodies
specific for CREB-1 (sc-186X) and CREM-1 (sc-440X) did not result in a
supershift of the CRE(B) mobility shift, suggesting that these factors
are not represented in this complex (Fig. 8).
Fig. 8.
Identification of the nuclear factors that
bind to the consensus CRE(B) element. Mobility shift assays were
performed with Jurkat T cell nuclear extract in the absence or presence of the antibody ATF-1 (sc-270X; recognizes ATF-1, CREB-1, and CREM-1)
and specific antibodies for ATF-2 (sc-187X), ATF-1 (sc-241X), CREB-1
(sc-186X), and CREM-1 (sc-440X). Identical results were obtained with
the CRE(A) site. The identity of EMSA supershift complexes are
indicated on the right side of the panel.
[View Larger Version of this Image (37K GIF file)]
DISCUSSION
The de novo cellular synthesis of guanine nucleotides
provides necessary substrates for both DNA and RNA synthesis and is required for cell proliferation. Depletion of guanine nucleotides by a
variety of inhibitors of IMPDH enzymatic activity results in a block in
late G1 of the cell cycle that is reversible with the
addition of guanine (12) and also leads to the induction of
differentiation in a wide variety of cell types in vitro
(15-18). Although the specific molecular trigger for G1
arrest is not known, it has been demonstrated that the phosphorylation
of the Rb protein is inhibited under these
conditions,2 establishing the
importance of IMPDH enzymatic activity for cell cycle progression.
Inhibitors of IMPDH are also known to be very effective
immunosuppressive agents (19, 20), and previous studies have documented
the requirement for a 10-15-fold increase in IMPDH activity for normal
T lymphocyte activation (14, 33, 34). Although the IMPDH type II gene
is expressed in all cell types examined to date, the ability to
stimulate peripheral blood T lymphocytes from a resting to
proliferating state and the importance of IMPDH activity for the immune
response prompted us to use these non-transformed cells to examine the
regulation of IMPDH type II gene expression in response to growth
stimuli. Thus, the objectives of the present study were first to
confirm that the regulation of IMPDH type II expression was at the
level of transcription and second to define the specific components
involved in transcriptional activation.
The finding of identical IMPDH type II mRNA stabilities at
increasing time intervals following T lymphocyte activation complements our previous data demonstrating a transcriptional response of the
transfected IMPDH type II promoter region to cellular activation with
phorbol ester and ionomycin (21). Chromatin structure analysis identified DNase I-hypersensitive sites both 5
and 3
to the gene that
could be involved in the regulation of IMPDH type II gene expression.
However, more detailed sequence analysis and the demonstration of two
adjacent genes have made interpretation of these data more difficult.
The presumption that the two 3
-hypersensitive sites are associated
with the regulation of a relatively small downstream gene is a
reasonable one, although experimental data are needed to support this
hypothesis. The 5
region of the IMPDH type II gene (bp
286 to +46)
was independently isolated and found to contain a CpG island in a study
in which the rat chromosomal protein MeCP2 containing a methyl-CpG
binding domain was used to isolate such sequences (GenBank Z66268)
(35). These data, in conjunction with our prior sequence analysis and
transient transfection experiments, have confirmed the regulatory
potential of this region and led to the identification of specific
transcription factor binding sites, including an Egr-1 site, that were
candidate mediators of growth-related gene expression (21).
Previous studies on the IL-2 promoter in several cell lines using
in vivo footprinting have identified transcription factor binding sites that are occupied both constitutively and inducibly during T cell activation (36, 37). Our in vivo footprinting studies of the IMPDH type II promoter have defined five regions of
extensive protein-DNA contacts that colocalize with the following transcription factor binding motifs: tandem CRE sites, a Sp1 site, an
overlapping Egr-1/Sp1 site, and a previously uncharacterized, extensively protected POS. The pattern representative of proteins binding to these regions showed minor modifications at the AML1, Egr-1/Sp1, and POS sites, suggesting that the increase in IMPDH type II gene transcription in activated T lymphocytes may be related to
modifications of pre-bound transcription factors and/or to the
binding of additional nuclear regulatory protein(s) to pre-bound proteins at these sites rather than to additional protein-DNA interactions.
The significance of the Egr-1/Sp1 and POS sites are further established
by deletion experiments, where removal of a 56-bp region containing
these sites reduced promoter activity by more than 70%, as well as by
the site-directed mutagenesis data. The POS site (CGCATGCG) has not
been previously identified as important in nuclear protein binding
assays according to analysis of defined transcription factor binding
sites as contained in the Genetics Computer Group data base (Madison,
WI). EMSA analysis of the sequence demonstrated a shift in both resting
T lymphocytes and Jurkat T cells and the formation of a higher order
complex upon PHA and IL-2 stimulation and PMA treatment, respectively.
These data indicate that this sequence clearly binds nuclear protein in
resting T lymphocytes and further suggests that non-DNA binding
accessory protein(s) may bind following T lymphocyte activation and as
a consequence of PMA treatment of Jurkat T cells. UV cross-linking experiments at this site have consistently identified three distinct proteins in the range of 35-45 kDa in the high mobility complex that
predominates in resting T lymphocytes (data not shown). No additional
proteins were identified in the low mobility complex observed with
stimulated T lymphocyte nuclear extract, although a slight extension of
the POS footprint upon PHA and IL-2 stimulation suggests that such
binding may occur in vivo. Despite the fact that the
sequence surrounding and including the POS site (ATACGCATGCG) exhibits
some sequence similarity to the Oct-1 and Oct-2 transcription factor
binding sites (ATTTGCAT), the Oct-1 and Oct-2 proteins are of
significantly higher molecular mass (90 and 60 kDa, respectively) than
those observed in our UV cross-linking experiments (38, 39). The
further characterization of the proteins binding to the POS site may
lead to the identification of a novel transcription factor that will be
highly relevant to our overall understanding of IMPDH type II gene
transcription.
The overlapping Egr-1/Sp1-binding site binds Sp1 in unstimulated Jurkat
T cell nuclear extract and inducibly binds Egr-1 after phorbol ester
treatment. However, no equivalent shift in electrophoretic mobility was
found in PHA and IL-2-stimulated T lymphocytes, arguing that Egr-1 does
not play a role in the up-regulation of IMPDH type II gene expression
under these conditions. Although Egr-1 is expressed in PMA-treated
Jurkat T cell nuclear extract and can bind to its consensus site in
EMSA assays, the in vivo footprinting results do not reveal
a distinguishable difference in the contact sites at the overlapping
Egr-1/Sp1 site between stimulated Jurkat T cells and their T lymphocyte
counterparts. These findings suggest that Egr-1 is unable to compete
for Sp1 binding at this site in intact cells. Although Egr-1 has
previously been shown to be expressed in PMA-treated Jurkat T cells
(40), as well as transiently in rat T lymphocytes following IL-2 or
concanavalin A treatment (41), and has been implicated in the
transcriptional regulation of several genes including IL-2 and
thymidine kinase (40, 42), the recent demonstration that
Egr-1-deficient mice, although deficient in luteinizing hormone, have
no major developmental defects (43) suggests that Egr-1 is not
important for the regulation of growth-related genes such as IMPDH type
II. Based on our findings, we conclude that Sp1 and not Egr-1 binding
at the Egr-1/Sp1 site contributes to IMPDH type II gene expression.
Mutation of the proximal CRE(A) motif was associated with a profound
impairment of promoter activity, whereas loss of the CRE(B) site with
identical protein binding properties on EMSA had little effect.
However, simultaneous mutation of the CRE(A) and CRE(B) sites resulted
in an 83% decrease in promoter activity, demonstrating an important
role of the tandem elements for overall promoter function. This
functional importance is further supported by the observation that the
CRE(A) and CRE(B) sites are conserved at the same location relative to
the transcription start site in the mouse IMPDH type II
promoter.3 Supershift
analysis of both CRE motifs identified ATF-2 as the predominant protein
that binds from both resting and activated T lymphocyte and Jurkat T
cell nuclear extracts, with evidence that ATF-1 and/or another
unidentified member of the ATF/CRE family may also bind. Although, we
have been unable to demonstrate a quantitative increase in the levels
of ATF-2 (70 kDa) after T lymphocyte activation using Western blot
analysis (data not shown), ATF-2 is the most plausible candidate for
mediating both the basal and inducible transactivation of the IMPDH
type II gene. ATF-2 has recently been shown to be involved in the
expression of the tumor necrosis factor
gene in stimulated T cells
(44). In addition, transactivation by the human T cell leukemia virus
Tax (45) and adenovirus E1A proteins (46, 47) has been attributed to
ATF-2. Finally, as a target of the JNK signal transduction pathway
(48), this transcription factor may be integrally involved in
regulating the expression of a number of genes important for cell
proliferation and transformation.
In conclusion, our data provide evidence that ATF-2, Sp1, and a
POS-binding protein are important for the regulation of IMPDH type II
gene expression in vivo in peripheral blood T lymphocytes and, by extension, in the provision of guanine nucleotides required for
cell growth. The transcriptional up-regulation of the IMPDH type II
gene does not appear to require major additional protein binding
directly to the core promoter region but may well involve events such
as secondary protein-protein interactions and/or post-translational modifications of pre-bound transcription factors. The identification of
the novel POS should lead to its recognition in the sequences of other
promoters, and further delineation of the nature and availability of
proteins binding to it will enhance our understanding of the regulation
of IMPDH type II gene expression.
FOOTNOTES
*
This work was supported by National Institutes of Health
Grants CA64192 and CA34085.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) L39210.
**
To whom correspondence should be addressed: 1106 FLOB CB 7365, University of North Carolina, Chapel Hill, NC 27599-7365. Tel.: 919-966-4431; Fax: 919-966-5640.
1
The abbreviations used are: IMPDH,
inosine-5
-monophosphate dehydrogenase; bp, base pair; EMSA,
electrophoretic mobility shift analysis; CAT, chloramphenicol
acetyltransferase; CRE, cAMP response element; CREB, CRE binding
protein; CREM, CRE modulator; DTT, dithiothreitol; IL-2, interleukin-2;
kb, kilobase(s); MRC, molecular research center; PBS,
phosphate-buffered saline; PCR, polymerase chain reaction; PHA,
phytohemagglutinin; PMA, phorbol 12-myristate 13-acetate; PMSF,
phenylmethylsulfonyl fluoride; POS, palindromic octamer sequence; RPMI,
Roswell Park Memorial Institute.
2
J. Laliberté and B. S. Mitchell,
unpublished data.
3
A. P. A. Stegmann, unpublished data.
REFERENCES
-
Carr, S. F., Papp, E., Wu, J. C., and Natsumeda, Y.
(1993)
J. Biol. Chem.
268,
27286-27290
[Abstract/Free Full Text]
-
Collart, F. R., and Huberman, E.
(1988)
J. Biol. Chem.
263,
15769-15772
[Abstract/Free Full Text]
-
Glesne, D., Collart, F., Varkony, T., Drabkin, H., and Huberman, E.
(1993)
Genomics
16,
274-277
[CrossRef][Medline]
[Order article via Infotrieve]
-
Gu, J. J., Kaiser-Rogers, K., Rao, K., and Mitchell, B. S.
(1994)
Genomics
24,
179-181
[CrossRef][Medline]
[Order article via Infotrieve]
-
Natsumeda, Y., Ohno, S., Kawasaki, H., Konno, Y., Weber, G., and Suzuki, K.
(1990)
J. Biol. Chem.
265,
5292-5295
[Abstract/Free Full Text]
-
Jackson, R. C., and Weber, G.
(1975)
Nature
256,
331-333
[CrossRef][Medline]
[Order article via Infotrieve]
-
Weber, G.
(1983)
Cancer Res.
43,
3466-3492
[Free Full Text]
-
Collart, F. R., Chubb, C. B., Mirkin, B. L., and Huberman, E.
(1992)
Cancer Res.
52,
5826-5828
[Abstract/Free Full Text]
-
Konno, Y., Natsumeda, Y., Nagai, M., Yamaji, Y., Ohno, S., Suzuki, K., and Weber, G.
(1991)
J. Biol. Chem.
266,
506-509
[Abstract/Free Full Text]
-
Nagai, M., Natsumeda, Y., Konno, Y., Hoffman, R., Irino, S., and Weber, G.
(1991)
Cancer Res.
51,
3886-3890
[Abstract/Free Full Text]
-
Nagai, M., Natsumeda, Y., and Weber, G.
(1992)
Cancer Res.
52,
258-261
[Abstract/Free Full Text]
-
Dayton, J. S., Turka, L. A., Thompson, C. B., and Mitchell, B. S.
(1992)
Mol. Pharmacol.
41,
671-676
[Abstract]
-
Tricot, G. J., Jayaram, H. N., Lapis, E., Natsumeda, Y., Nichols, C. R., Kneebone, P., Heerema, N., Weber, G., and Hoffman, R.
(1989)
Cancer Res.
49,
3696-3701
[Abstract/Free Full Text]
-
Turka, L. A., Dayton, J., Sinclair, G., Thompson, C. B., and Mitchell, B. S.
(1991)
J. Clin. Invest.
87,
940-948
-
Kiguchi, K., Collart, F. R., Henning-Chubb, C., and Huberman, E.
(1990)
Cell Growth & Differ
1,
259-270
[Abstract]
-
Kiguchi, K., Collart, F. R., Henning-Chubb, C., and Huberman, E.
(1990)
Exp. Cell Res.
187,
47-53
[CrossRef][Medline]
[Order article via Infotrieve]
-
Olah, E., Natsumeda, Y., Ikegami, T., Kote, Z., Horanyi, M., Szelenyi, J., Paulik, E., Kremmer, T., Hollan, S. R., Sugar, J., and Weber, G.
(1988)
Proc. Natl. Acad. Sci. U. S. A.
85,
6533-6537
[Abstract/Free Full Text]
-
Sokoloski, J. A., Blair, O. C., and Sartorelli, A. C.
(1986)
Cancer Res.
46,
2314-2319
[Abstract/Free Full Text]
-
Danovitch, G., Deierhoi, M., Ferguson, R., Linna, J., Monroe, S., and Tomlanovich, S.
(1996)
Transplantation
61,
722-729
[CrossRef][Medline]
[Order article via Infotrieve]
-
Sollinger, H. W.
(1995)
Transplantation
60,
225-232
[Medline]
[Order article via Infotrieve]
-
Zimmermann, A. G., Spychala, J., and Mitchell, B. S.
(1995)
J. Biol. Chem.
270,
6808-6814
[Abstract/Free Full Text]
-
Wu, C.
(1980)
Nature
286,
854-860
[CrossRef][Medline]
[Order article via Infotrieve]
-
Weiss, A., Wiskocil, R. L., and Stobo, J. D.
(1984)
J. Immunol.
133,
123-128
[Abstract]
-
Pfeifer, G. P., Tanguay, R. L., Steigerwald, S. D., and Riggs, A. D.
(1990)
Genes Dev.
4,
1277-1287
[Abstract/Free Full Text]
-
Mueller, P. R., and Wold, B.
(1989)
Science
246,
780-786
[Abstract/Free Full Text]
-
Wright, K. L., and Ting, J. P.-Y.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
7601-7605
[Abstract/Free Full Text]
-
Dignam, J. D., Lebovitz, R. M., and Roeder, R. G.
(1983)
Nucleic Acids Res.
11,
1475-1489
[Abstract/Free Full Text]
-
Blake, M. C., Jambou, R. C., Swick, A. G., Kahn, J. W., and Azizkhan, J. C.
(1990)
Mol. Cell. Biol.
10,
6632-6641
[Abstract/Free Full Text]
-
Jones, D. H., and Howard, B. H.
(1991)
BioTechniques
10,
62-66
[Medline]
[Order article via Infotrieve]
-
Tiedeman, A. A., and Smith, J. M.
(1991)
Gene (Amst.)
97,
289-293
[CrossRef][Medline]
[Order article via Infotrieve]
-
Satake, M., Ibaraki, T., Yamaguchi, Y., and Ito, Y.
(1989)
J. Virol.
63,
3669-3677
[Abstract/Free Full Text]
-
Imagawa, M., Chiu, R., and Karin, M.
(1987)
Cell
51,
251-260
[CrossRef][Medline]
[Order article via Infotrieve]
-
Dayton, J. S., Lindsten, T., Thompson, C. B., and Mitchell, B. S.
(1994)
J. Immunol.
152,
984-991
[Abstract]
-
Fairbanks, L. D., Bofill, M., Ruckemann, K., and Simmonds, H. A.
(1995)
J. Biol. Chem.
270,
29682-29689
[Abstract/Free Full Text]
-
Cross, S. H., Charlton, J. A., Nan, X., and Bird, A. P.
(1994)
Nat. Genet.
6,
236-244
[CrossRef][Medline]
[Order article via Infotrieve]
-
Brunvand, M. W., Krumm, A., and Groudine, M.
(1993)
Nucleic Acids Res.
21,
4824-4829
[Abstract/Free Full Text]
-
Garrity, P. A., Chen, D., Rothenberg, E. V., and Wold, B. J.
(1994)
Mol. Cell. Biol.
14,
2159-2169
[Abstract/Free Full Text]
-
Fletcher, C., Heintz, N., and Roeder, R. G.
(1987)
Cell
51,
773-781
[CrossRef][Medline]
[Order article via Infotrieve]
-
Scheidereit, C., Heguy, A., and Roeder, R. G.
(1987)
Cell
51,
783-793
[CrossRef][Medline]
[Order article via Infotrieve]
-
Skerka, C., Decker, E. L., and Zipfel, P. F.
(1995)
J. Biol. Chem.
270,
22500-22506
[Abstract/Free Full Text]
-
Perez-Castillo, A., Pipaón, C., García, I., and Alemany, S.
(1993)
J. Biol. Chem.
268,
19445-19450
[Abstract/Free Full Text]
-
Molnar, G., Crozat, A., and Pardee, A. B.
(1994)
Mol. Cell. Biol.
14,
5242-5248
[Abstract/Free Full Text]
-
Lee, S. L., Sadovsky, Y., Swirnoff, A. H., Polish, J. A., Goda, P., Gavrilina, G., and Milbrandt, J.
(1996)
Science
273,
1219-1221
[Abstract]
-
Tsai, E. Y., Jain, J., Pesavento, P. A., Rao, A., and Goldfeld, A. E.
(1996)
Mol. Cell. Biol.
16,
459-467
[Abstract]
-
Franklin, A. A., Kubik, M. F., Uittenbogaard, M. N., Brauweiler, A., Utaisincharoen, P., Matthews, M.-A. H., Dynan, W. S., Hoeffler, J. P., and Nyborg, J. K.
(1993)
J. Biol. Chem.
268,
21225-21231
[Abstract/Free Full Text]
-
Liu, F., and Green, M. R.
(1990)
Cell
61,
1217-1224
[CrossRef][Medline]
[Order article via Infotrieve]
-
Liu, F., and Green, M. R.
(1994)
Nature
368,
520-525
[CrossRef][Medline]
[Order article via Infotrieve]