INTRODUCTION

Alzheimer's disease is a devastating neurological disorder and the most common cause of dementia. The genetics of this disorder suggests that multiple genes are involved. To date, mutations in four genes have been found to be associated with Alzheimer's disease phenotypes including the amyloid precursor protein gene on chromosome 21 (1, 2), the apolipoprotein E gene on chromosome 19 (3-5), the presenilin-1 (PS-1)¹ gene on chromosome 14 (6), and the presenilin-2 (PS-2) gene on chromosome 1 (7). Although an unknown gene on chromosome 12 appears to associate with a large percentage of late-onset Alzheimer's patients (8), the majority of familial Alzheimer's disease cases are associated with mutations in the PS-1 gene. To date, over 30 independent mutations in PS-1 have been described in unrelated Alzheimer's families displaying an early age-of-onset phenotype. Most of these mutations are missense mutations that result in single amino acid changes (6, 9-15). Deletions found in exon 4 and exon 9 cause additional mutations as do several truncations of the RNA transcripts arising through differential splicing (16). Although clustering of these mutations within the protein suggests the location of functionally important domains, the exact function of presenilin proteins is a matter of active investigation.

One approach to find gene function is to study the regulation of PS-1 gene expression. Using in situ hybridization, we and others demonstrate that PS-1 mRNA is most highly expressed in neurons of the brain (17).² Immunohistochemistry revealed that the PS-1 protein was abundant in neurons, but was also associated with amyloid plaques and some glial cell types (18, 19). In contrast, Sherrington et al. (6) reported that PS-1 mRNA is widely expressed in a variety of organs throughout the body. This raises the question why mutations in the PS-1 gene product appear to confer a disease state in familial Alzheimer's patients without apparent effect on their peripheral organs. The situation is further compounded because PS-1 mRNA and protein levels have not been reported thus leaving open the possibility that pathological regulation of PS-1 gene expression in familial Alzheimer's disease patients, compared with age-matched healthy controls, contributes to the disease state.

Mutations in the PS-1 gene's promoter and non-protein encoding regions are not known and reports on the gene's wild-type sequence are lacking. Similarly, no functional analysis of the gene's ability to promote transcription has been reported. Combined with recent reports that PS-1 knockout mice are embryonic lethal (20), knowledge of the PS-1 gene sequence and its transcriptional regulation may be important clues that help to identify PS-1 function in both normal and diseased states. To begin answering some of these questions, we now report a detailed sequence of the mouse PS-1 gene including its promoter, the entire protein encoding region, and ending in exon 12. In addition to the usefulness of this sequence in creating additional PS-1 knockout mice, we have defined the PS-1 promoter's transcriptional regulatory elements. Our data on promoter activity suggests that the presenilin-1 gene is preferentially expressed and transcribed in neurons.

EXPERIMENTAL PROCEDURES

Labeled oligonucleotides and polymerase chain reaction (PCR) products of the mouse PS-1 cDNA were used as probes to screen mouse libraries for genomic PS-1 clones. Based on the mouse PS-1 cDNA sequence (GenBank^TM accession no. L42177), an upstream primer of sequence 5-CGGAGAGAGAAGGAACCAAC-3 and a downstream primer of sequence 5-TCAGCTCTTCGTCTTCCTCCTCATC-3 were used, with Quick Clone Mouse Brain cDNA (CLONTECH) as template, to amplify a portion of the mouse PS-1 cDNA by PCR. Amplification reactions were performed in a 100-µl volume containing 1 × PCR buffer II (Perkin-Elmer), MgCl₂ (1.5 mM), dATP, dGTP, dCTP, and dTTP (0.2 mM each, Perkin-Elmer), DNA primers at 0.5 µM, 1 µl of cDNA template (0.1 ng), and Ampli-Taq DNA polymerase (5 units, Perkin-Elmer). The reaction cycle was 95 °C for 1 min, 50 °C for 1 min and 72 °C for 2 min for a total of 30 cycles. This PCR product was gel-purified and labeled with [-³²P]dCTP and a Random Primers DNA labeling system (Life Technologies, Inc.). Labeled probe was used to conventionally screen a mouse strain 129/SVJ genomic library in Lambda Fix-II vector (Stratagene) as described previously (21). Screening identified four independent phage clones designated Ph-1, Ph-2, Ph-3, and Ph-4 (see Fig. 2). Following digestion with NotI and/or EcoRI, restriction enzyme fragments were subcloned into pBluescript-II-KS(+) phagemid vector (Stratagene) using a DNA ligation kit (Stratagene). DNA sequence was determined using an Applied Biosystems model 373A automated DNA sequencer with dye terminator chemistry and protocols recommended by the manufacturer. Additional oligonucleotide probes from the 5-untranslated region of the mouse PS-1 cDNA were labeled with [³²P]ATP and T4-polynucleotide kinase and used to identify plasmid subclones by hybridization. Based on the partial sequence of phage clone Ph-2, the PCR primers 1C-US-for (GATCACAGTCTAGGTTGCTGGTGTG) and 1C-US-rev (TGGGGCAAGGGACACAAATAAG) were used to further screen a mouse ES-129/SVJ genomic library in a P1 vector (Genome Systems Inc.) by PCR. Of the three P1 clones identified, P1-10809 was digested with EcoRI or HindIII, and these restriction enzyme fragments were subcloned and sequenced as described above.

5-Rapid Amplification of cDNA Ends (RACE)

The 5 end of PS-1 cDNA was identified using mouse-brain, Marathon-Ready cDNA (male BALB/c, 9-11 weeks of age, CLONTECH). Briefly, a 50-µl PCR reaction containing a PS-1-specific reverse primer (TGGCTCAGGGTTGTCAAGTC, 0.2 µM), the CLONTECH AP1 adaptor primer (CCATCCTAATACGACTCACTATAGGGC, 0.2 µM), 2.5 ng of Marathon-Ready cDNA, 1 × PCR buffer (Life Technologies, Inc.), MgCl₂ (1.5 mM), dimethyl sulfoxide (5%), dATP, dGTP, dCTP, and dTTP (0.2 mM each), and Taq DNA polymerase (5 units, Life Technologies, Inc.) was used with a reaction cycle of 95 °C for 45 s, 55 °C for 30 s, and 72 °C for 90 s for a total of 30 cycles in the first amplification step. The 100-µl second PCR amplification step contained a mouse PS-1-specific reverse primer, 151-130-reverse (CAAACCTCTTGGGATTCTTTC, 0.5 µM) and the nested CLONTECH adaptor primer AP2 (ACTCACTATAGGGCTCGAGCGGC, 0.5 µM), 0.01 µl of the first PCR amplification, 1 × PCR buffer (Life Technologies, Inc.), MgCl₂ (1.5 mM), dimethyl sulfoxide (5%), dATP, dGTP, dCTP, and dTTP (0.2 mM each), and Taq DNA polymerase (5 units, Life Technologies, Inc.) with the same cycling parameters as in the first amplification step. In some second PCR reactions, the PS-1-specific reverse primer 101-80-reverse (AAGACCTCGAAGGGCTGCTGTC) was used. RACE amplification products were electrophoresed on 2% agarose gels run in TAE, visualized with ethidium bromide and ultraviolet light, extracted from the gel matrix with a Wizard PCR Preps DNA purification system (Promega), ligated into a pGEM-T vector (Promega), and transformed into competent DH5- bacterial cells (Life Technologies, Inc.). Ampicillin-resistant colonies were characterized by restriction enzyme digestion, PCR amplification with a variety of primer combinations, and DNA sequencing as above.

Comparison of the mouse PS-1 promoter with other eukaryotic promoter sequences was performed using the BLAST network service and the eukaryotic promoter data base Release 45 available from the National Center for Biotechnology Information.

Mouse genomic DNA fragments containing portions of the putative PS-1 promoter were subcloned upstream of the firefly luciferase gene into the promoterless pGL3-basic vector (Promega). Based on the sequence of genomic DNA, PCR primers were designed to incorporate XhoI sites into the forward primers and HindIII sites into the reverse primers. Corresponding to different locations in the genomic DNA (see Fig. 2), these primers were used to PCR amplify fragments which were purified with a Wizard purification system (Promega), digested with the appropriate restriction enzymes and repurified with the Wizard kit. Cleaved PCR products were ligated into pGL3 plasmid cleaved with the same restriction enzymes and transformed into competent bacteria, and clones containing plasmids with inserts were verified by DNA sequencing.

Mouse Neuro2a-neuroblastoma cells, mouse P19 embryonal carcinoma and mouse NIH/3T3 fibroblast cells were obtained from the American Type Culture Collection (ATCC). Neuro2a cells were routinely propagated in minimal essential medium with Earle's salt (Life Technologies, Inc.), 10% fetal calf serum (Hyclone), and 0.1 mM nonessential amino acids (Life Technologies, Inc.). P19 cells were routinely propagated in -minimal essential medium (Life Technologies, Inc.), 2.5% fetal calf serum, and 7.5% bovine serum (Hyclone). Differentiation of P19 cells to neuron-like cells followed treatment with 0.5 µM all-trans-retinoic acid (22). Differentiation of P19 cells to muscle-like cells followed treatment with 1% dimethyl sulfoxide (23). NIH/3T3 cells were routinely propagated in Dulbecco's modified Eagle's medium (Life Technologies, Inc.) plus 10% fetal calf serum.

For transient transfection, Neuro2a, P19, retinoic acid-treated-P19, dimethyl sulfoxide-treated P19, and NIH/3T3 cells were plated in six-well tissue culture dishes at 9 × 10⁴ cells/well and allowed to recover for 1 day. Cells containing PS-1-promoter/reporter constructs were then co-transfected with 0.3 pmol of one of the promoter firefly luciferase plasmid constructs, pGL3 basic vector or pGL3 promoter plasmid (which contains an SV40 promoter upstream of the firefly luciferase gene, Promega), and 0.3 pmol of pRL-TK plasmid (which contains a herpes simplex virus thymidine kinase promoter upstream of the renilla luciferase gene, Promega), using the Lipofectin procedure (Life Technologies, Inc.) as described in the manufacture's protocol.

Transfected cells were cultured for 24 h, washed twice with 2 ml of Ca²⁺- and Mg²⁺-free phosphate-buffered saline, and lysed with Passive lysis buffer (Promega). Firefly luciferase and renilla (sea pansy) luciferase activities were measured sequentially using a Dual-Luciferase Reporter assay system (Promega) and a model TD-20E Luminometer (Turner Design). After measuring the firefly luciferase signal (LA_F) and the renilla (sea pansy) luciferase signal (LA_R), the relative luciferase activity (RLA) was calculated as: RLA = LA_F/LA_R, where relative RLA was calculated as a percentage, i.e. %RLA = RLA/(RLA)_max. To compare the relative luciferase activity in one cell line with another, an index of relative luciferase activity was calculated as: IRLA = RLA/RLA_SV40, where RLA_SV40 is the ratio of firefly luciferase signal with an SV40 promoter in pGL3 divided by the renilla luciferase signal in pRL-TK.

RESULTS

As a prelude to cloning the PS-1 promoter, the exact 5-end of PS-1 mRNA from mouse brain was identified by the RACE technique. Using the antisense oligonucleotide "101-80-reverse" found in exon 2 of mouse PS-1, 5-RACE gives a major broad band of 210 bp and a minor band of 430 bp from single-stranded cDNA templates complementary to mouse brain mRNA (Marathon Ready cDNA, CLONTECH, data not shown). Each of these bands was isolated from agarose gels, subcloned into the pGEM-T vector (Promega) and sequenced. Sequencing revealed the presence of three different PS-1 transcripts which appear to derive from two unique transcriptional start sites (Fig. 1). This information suggests that the PS-1 gene may contain two promoters and that differential splicing of exons, should they exist in genomic DNA, might generate multiple transcripts.

A mouse genomic DNA library in Lambda FIX-II was screened with the 5-portion of the mouse PS-1 cDNA (Fig. 2A, probe A). Of the positively hybridizing phage clones, four were selected for restriction mapping with EcoRI and NotI as shown in Fig. 2B. Only one phage clone, Ph-2 hybridized to oligonucleotides from the 5-untranslated region of the mouse PS-1 cDNA. Primers from the phage arms allowed sequencing into the genomic DNA insert. The insert's sequence allowed the PCR primer pair "1C-US-forward and 1C-US-reverse" to be chosen and used to identify a P1 clone of the mouse PS-1 genomic DNA as shown in Fig. 2A. Clone P1-10809 was identified through a positive PCR reaction product with these primers and hybridization to the PS-1 cDNA fragment probe A (Fig. 2). P1-10809 was then restricted, mapped and its entire sequence subcloned into multiple pBluescript-II-KS-(+) plasmid vectors as shown by the thick lines in Fig. 2B. Each subclone was sequenced on an Applied Biosystems 373A automated DNA sequencing machine using protocols supplied by the manufacturer.

The sequence of almost 50 kbp of the P1-10809 clone was compared with the mouse PS-1 cDNA sequence and regions of homology aligned with the MacVector DNA analysis program (IBI, New Haven, CT). The first nucleotide on the 5 end of the RNA transcript is usually designated as nucleotide +1 of exon 1. In our case, PS-1 appears to have two different 5-end-sequences which are associated with three different length RNA transcripts (Fig. 1, transcript-A, transcript-B, and transcript-C). The alignment of transcript-A with genomic sequence shows that a "G," designated conventionally as position +1 in exon 1, corresponds to the transcription start site. The presenilin gene's exon 1A extends from position +1 to +141, which is spliced to exon 2, whose 5-end begins at gene position number +11,210, to give transcript A. The alignment of transcript B with genomic DNA shows that a "C" at position +411 corresponds to the alternative transcription start site. We define this second start site as beginning in exon 1B, which extends from position +411 to +781 and is spliced to exon 2 (gene position number +11,210) to give transcript B. The alignment of transcript C with genomic DNA shows the same "C" at position +411 as the alternative transcription start site followed by a shorter sequence alignment. We define exon 1C as extending from position +411 to +549 which is spliced to exon 2 (gene position number +11,210) to give transcript C. Thus, the 5-untranslated regions of PS-1 RNA transcripts include exon 1A, exon 1B, exon 1C, and exon 2 together with a portion of exon 3 (Fig. 2C and Table I). The protein-encoding portions of the gene begin with the ATG codon at gene position number +11,420 where translation initiates in exon 3 followed by exons encoding the remainder of the protein until stopping at a TAG codon in exon 12 (position +45,627). 983 bp downstream from this TAG stop codon lies the putative polyadenylation signal AATTAA at position +46,612. Interestingly, the Intron between exon 1 and exon 2 is about 10 kbp, between exon 3 and exon 4 is about 12 kbp and between exon 5 and exon 6 is about 8 kbp, whose sequences, together with the rest of the PS-1 exons and introns, can be found in GenBank^TM (accession no. AF007560).

Table I. Numbering scheme for the mouse PS-1 gene's exon-intron structure The positions of the 5-end and the 3-end of each exon were counted from the transcription start site of exon 1A being defined as position +1. Position Exon   1A 1-141   1B 411-781   1C 411-549    2 11210-11276    3 11367-11506    4 23849-24099    5 26311-26452    6 34555-34622    7 36060-36280    8 39773-39871    9 40245-40331   10 42082-42255   11 43217-43335   12 45459 -  A of ATG 11420 T of TAG 45627 AATTAA 46612

The DNA located upstream and surrounding the transcription initiation sites typically confers the gene's promoter activity. When the DNA surrounding the transcript A initiation of transcription site was compared with its human PS-1 genomic DNA counterpart (Fig. 3),³ the region of maximal similarity extends from positions 39 to +117 of the mouse PS-1 sequence. This region is rich in guanosine (G) and cytosine (C) residues containing the sequence motifs: GCCGGAAGT resembling an Ets 1-3 element (30) and GGGCGGG motif resembling an Sp-1 hexanucleotide element, which is commonly found in the promoters of other genes. The mouse sequences upstream of this region do not share similarity with the human sequence nor do they contain the most common eukaryotic promoter element, a TATA box (Fig. 4). Instead, this unique mouse sequence contains two CAAATA motifs, at positions 365 and 281, which resemble CAAT boxes found in other eukaryotic promoters. This region unique to mouse also contains an Ap-2 binding element at position 80 (CCCAGCCC) and a sequence similar to a heat shock inducible element at position 220 (CTCGAATCGCAG). Putative Sp-1 hexanucleotide binding sites with the sequence GGGCGG or CCGCCC are found downstream from the +1 site of transcription initiation with exon 1A containing two Sp1 motifs and the exon 1A/exon 1B intron containing five Sp1 motifs. Also downstream of the Cap (transcription initiation) site are two additional Ap-2 sites and another Ets 1-3 motif.

We employed a Dual-Luciferase reporter assay system (Promega) to test whether these elements function to promote transcription. In general, we assayed the promoter activity of DNAs flanking the transcription initiation site of PS-1 by inserting these DNA fragments in front of a basic, promoterless firefly luciferase reporter gene in plasmid pGL3. Constant amounts of pGL3 containing PS-1 promoter fragments and of pRL-TK plasmid containing a herpes simplex virus thymidine kinase promoter driving expression of sea pansy luciferase, were co-transfected into a constant number of cells. After 24 h, lysates of transfected cells were sequentially assayed for firefly luciferase (LA_F) and sea pansy luciferase activity (LA_R) so that a ratio of firefly to sea pansy activities could be calculated for each PS-1 promoter fragment as its relative luciferase activity or RLA. Of all the fragments tested, plasmid LUC 29 with the fragment 327 to +206 showed the greatest ratio of firefly to sea pansy activity (Fig. 5 and Table II), which we defined as 100% activity. Larger fragments in LUC 1 (2232 to +1436), LUC 3 (499 to +1171), and LUC 16 (276 to +519) display only a small percentage of the LUC 29 activity, suggesting the presence of negative elements that apparently reduce their activities. Interestingly, the high activity of LUC 29 is not found in its flanking fragments such as LUC 2 (2232 to 496) and LUC 23 (+188 to +519), which both lack significant promoter activity. The LUC 23 result is particularly interesting because the alternative transcription start site begins at position +411 of exon 1B/exon 1C and apparently lacks meaningful promoter activity.

Mouse presenilin-1 promoter-reporter constructs and their relative luciferase activity (%RLA). A, structural organization of PS-1 promoter. Top line represents the region of the PS-1 gene which was analyzed for promoter activity where boxes for exon 1A and exon 1B are labeled. Open boxes represent genomic DNA fragments corresponding to the mouse PS-1 gene (top line) which were cloned upstream of the firefly luciferase reporter gene in the plasmid pGL3-Basic (Promega). Open boxes are labeled on the left with the name of the promoter-reporter plasmid as LUC no. and with a nucleotide number of the 5-end of the fragment based on +1 being the "G" at the beginning of exon 1A. Letters above the open box refer to a restriction enzyme cleavage site. Numbers to the immediate right of the open box denote the 3-end of the promoter fragment. The numbers on the left-hand side are the percentage of relative luciferase activity calculated as described under "Experimental Procedures" followed by the number of times that construct has been transfected into cells and its activity measured, which is in parentheses. B, Fine structure map of the PS-1 promoter and promoter-reporter construct activity strategy. Top line represents the region of the PS-1 gene with putative promoter elements, exon 1A, exon 1B, and restriction enzyme site positions labeled. Open boxes of promoter-reporter constructs are as in A. Letters above the open box refer to the end of the promoter fragment shown in Fig. 3.

Table II. Neuron-preferred activity of total and core promoter regions of the mouse PS-1 gene LUC29 and LUC27 were transiently transfected into the cell lines to measure the activities of total- and core-promoter, respectively. An SV40-promoter driving firefly luciferase in pGL3-basic plasmid (Promega) was also transfected as a control. An IRLA was calculated for the total- and the core-promoter as IRLA = RLA/RLASV40. Promoter Cell linea N2a P19N P19 P19M NIH/3T3 RLA SV40 (control) 2.1 10.6 5.0 35.9 1.1 Total promoter 36.8 114.1 21.2 114.9 0.3 Core promoter 3.6 11.5 3.7 19.4 0.1 IRLA Total promoter 17.8 10.8 4.3 3.2 0.3 Core promoter 1.7 1.1 0.7 0.5 0.1   Total/Core 10.2 9.9 5.8 5.9 3.4 a Cell lines are defined in the legend to Fig. 6.

To more accurately define the minimal or core regions conferring promoter activity, we studied the 327 to +206 region of the PS-1 gene in greater detail. Sequence comparison showed this region to contain a CAAT box (281), a heat shock element (220), an AP2 site (80), a PEA-3 site (53), an Ets 1-3 site (7), and Sp1 sites (+25, +119, and +161). To find which of these elements and/or new elements were functionally active, we resected this region and tested smaller fragments for promoter activity. Since LUC 24 and LUC 23 lacked significant activity, we initially focused on the fragments from 440 to +91 as shown in Fig. 5. The CAAT box at 281 plays an active role in the PS-1 promoter because LUC 8 (261 to +91) has less activity than LUC 6 (327 to +91) which contains this CAAT box. A negative element must reside upstream of this CAAT box because the activity of LUC 4 (440 to +91) is about half that of LUC 6 (327 to +91). The heat shock element at 220 may not play a role in PS-1 promoter activity as fragments containing (LUC 8, 261 to +91) and lacking (LUC 10, 192 to +91) this element have similar activities. The AP2 site at 80 and/or the PEA-3 site at 53 appear to play positive roles in PS-1 promoter function as LUC 12 (87 to +91) has about 4-fold more activity than LUC 13 (32 to +91) which lacks these sites. Similarly, the Ets 1-3 site at position 7 plays a positive role as judged by the RLA activity of LUC 14 (9 to +91) at 7.9% and LUC 15 (+42 to +91) at 0.7%. While the Sp1 site at position +161 does not appear to contribute when LUC 17 (276 to +206) is compared with LUC 18 (276 to +148), the Sp1 sites at +25 and +119 appear to be very active in the PS-1 promoter as negative and positive elements, respectively, when LUC 26 (9 to +41) is compared with LUC 27 (9 to +16) and LUC 7 (276 to +91) is compared with LUC 18 (276 to +148).

Based on these experiments, we tested whether the region from 87 to +41 could contain the core promoter activity in two ways. First, LUC 25 (87 to +41) had an RLA promoter activity of 28%. Second, the deletion of this region to give LUC 30 (delete 87 to +41 from 327 to +206) decreased activity from 100% (LUC 29) to 0.2% (LUC 30). Taken together, these results strongly suggest that the Ap2, PEA-3, Ets 1-3, and Sp1 elements comprise the major functional elements of the PS-1 promoter in the region 87 to +41.

Using in situ hybridization to human brain slices, we found that PS-1 RNA was most abundant in neurons and below the limits of detection in other brain cells.² This result suggested that the PS-1 promoter may preferentially function in neurons. To test this idea further, we compared the activity of the promoter-fragment/reporter plasmids LUC 1, LUC 3, LUC 4, LUC 27, and LUC 29 in different cell types. As reported above, the mouse Neuro-2A cell line of neuroectodermal lineage supports more RLA promoter activity from LUC 29 and LUC 4 than from LUC 27, LUC 3, and LUC 1 (Fig. 6 and Table II). In contrast, the mouse NIH/3T3 fibroblast cell line supports only minimal promoter activity with each of these promoter/reporter constructs (LUC 29, LUC 27, LUC 4, LUC 3, or LUC 1). To further test the idea that the PS-1 promoter activity is great in neurons, we transfected the mouse embryonal carcinoma cell line P19 with these reporter constructs. P19 cells are uniquely differentiated by all-trans-retinoic acid treatment into a neuron-like phenotype (22) or by dimethyl sulfoxide treatment into a muscle-like phenotype (23). Retinoic acid-treated P19 cells support as much as 2.5-fold more relative luciferase activity from plasmid LUC 29 compared with untreated P19 cells. Untreated P19 cells support as much as 1.3-fold more relative luciferase activity compared with dimethyl sulfoxide-treated P19 cells. These results are consistent with the hypothesis in which PS-1 transcription is preferred in neuron-like cells.

DISCUSSION

From promoter to polyadenylation signal, the full sequence of the mouse presenilin-1 gene and its exon-intron structure set the stage to describe some of its unique functions. In contrast to the reported PS-1 cDNA sequence, 5-RACE surprised us by amplifying three different mRNA transcripts which share two unique transcription start sites. Sequence analysis showed that transcript A begins with exon 1A while transcript B and transcript C begin with exon 1B. Exon 1C is a fragment of exon 1B sharing its 5-end at position +411, but only extending to position +549. This example of alternative splicing in exon 1B versus exon 1C yields multiple RNA transcripts and has also been described for exon 9 in the human PS-1 gene (16). Two distinct transcription start sites, however, have been reported for only a few genes including human catechol-O-methyl transferase (24), mouse neurotrophin-3 (25), and rat aromatic L-amino acid decarboxylase (26). In these cases, each transcriptional start site was associated with a distinct promoter so that a stoichiometry of one promoter per transcription start site was observed.

Our characterization of promoter activities for the PS-1 gene, however, revealed a much different picture. Using a promoter-fragment coupled to the firefly luciferase reporter with sea pansy Renilla luciferase as an internal standard, we found that the 327 to +206 fragment (LUC 29) contains most of the PS-1 promoter activity. The known sequence motifs which apparently contain this activity are a CAAT box (281), an Ap2 site (80), a PEA-3 site (53), an Ets 1-3 site (7), and an Sp1 site (+25). While this region overlaps some of exon 1A, deletion of the 87 to +41 region in LUC 30 reduces promoter activity by 50-fold. To measure promoter activity around the alternative transcription start site, we tested LUC 23 (+118 to +519) containing Sp1, Ap2, and Ets 1-3 sites and found these exon 1B/exon 1C sequences to confer about 1% of the activity surrounding the exon 1A promoter. These results suggest to us that the region surrounding the +1 position of exon 1A may promote the expression of transcript A, transcript B, and transcript C. Alternatively, a weak promoter controlling transcription initiation at position +410 in exon 1B/exon 1C may amount to only 1% of the transcription initiation at position +1. By cloning all of the products of the 5-RACE into plasmid vectors and counting each clone carrying exon 1C, we estimate the abundance of transcript C to approach 30% of all of the PS-1 transcripts (data not shown), further supporting the idea that the major promoter at +1 functions to control transcription initiation from both the +1 and the +410 sites. Quantitative measurement of transcript A, transcript B, and transcript C levels will help to further resolve this issue. The high homology between human and mouse promoters combined with our description of multiple start sites and alternative splicing for the mouse PS-1 gene reasonably suggests how the human PS-1 promoter may function.

Recently, PS-1 was reported to be expressed predominantly in neurons of the central nervous system (17). This result matches our own data that PS-1 RNA, by in situ hybridization, is strongly expressed in neurons and at undetectable levels in other cell types.² Similarly, several immunohistochemical studies report primarily neuronal localization of PS-1 protein with weak staining of amyloid plaques and some glia surrounding those plaques. On the other hand, Sherrington et al. (6) showed that Northern blots of RNA from different organs all hybridized to a PS-1 cDNA probe, suggesting that PS-1 RNA is ubiquitously expressed. At present, these results can not be easily reconciled.

While not rigorous proof, our data clearly shows preferential promoter activity in neuron-like cells supporting a cell-type-specific pattern of PS-1 expression. We find the greatest amount of PS-1 promoter activity in the mouse Neuro2a neuroblastoma cell line, followed by the P19 embryonal carcinoma cell line and almost no activity in the mouse NIH/3T3 fibroblast cell line (Table II). To further confirm this finding, we employed the P19 mouse embryonal carcinoma cell line because of its unique ability to be differentiated into a muscle-like phenotype following dimethyl sulfoxide treatment or into a neuron-like phenotype (P19-RA-neuron) following all-trans-retinoic acid treatment (22, 23). If our hypothesis that PS-1 promoter activity is preferred in neuron-like cells, then we would predict that P19 cells differentiated with retinoic acid into neuron-like cells would display more PS-1 promoter activity than P19 cells differentiated with dimethyl sulfoxide into muscle-like cells. As clearly shown in Fig. 6 and Table II, P19-RA-neuron cells display the most PS-1 promoter activity followed by untreated P19 cells and the least activity in P19 dimethyl sulfoxide-treated muscle cells. These results, combined with the Neuro2a and NIH/3T3 results, indicate a clear pattern of PS-1 promoter activity which is preferred in neurons.

The mechanisms controlling neuron-specific promoter activity are poorly understood. The most direct mechanism would be for a positive regulator, that is only present in neuronal cells, to singularly activate the neuron-specific promoter. Alternatively, a negative regulator, that is only present in non-neuronal cells, could globally repress the neuron-specific promoter in all but neuronal cells. Depending upon the exact DNA elements within the promoter, some combination of positive and negative controls of transcriptional activity might also yield neuron-preferred promoter function. Going beyond our characterization of the regions conferring PS-1 promoter activity in Neuro2a cells, we may now look at the data to suggest which of the DNA elements might confer neuron-preferred promoter function. The region showing the highest activity in Neuro2a neuron-like cells extends from 329 to +206 (LUC 29) and contains a CAAT box at 281, a heat-shock inducible element at 218, an Ap2 site at 80, a PEA-3 site at 53, an Ets 1-3 site at 7, and an Sp1 site at +25. The CAAT box could be the source of about a third of the positive control of neuron-specific activity as its deletion reduces promoter activity by about a third when comparing LUC 6 (327 to +91) with LUC 8 (261 to +91, Fig. 4). The heat shock element probably does not contribute to neuron-specific activity as its deletion does not affect promoter activity when comparing LUC 8 (261 to +91) to LUC 10 (192 to +91, Fig. 4). Based on the 4-fold greater activity of LUC 12 (87 to +91) compared with LUC 13 (32 to +91), it appears that both the Ap2 site and the PEA-3 site are good candidates for the positive control of neuron-specific promoter function. Ap2 sites are reported to be most frequently found in promoters active in cells of neural crest lineage, and several examples exist of their involvement with neuron-specific activity (27-29). In contrast, the 5-fold less activity of LUC 26 (9 to +41) compared with LUC 27 (9 to +16) implicates the Sp1 site at +25 as a negative regulator of neuron-specific promoter function. These same data could also be interpreted as the Ets 1-3 site having a positive function, possibly as part of a core promoter element from 9 to +16. Direct measurement of LUC 27 (9 to +16) shows that Neuro2a and P19-RA-neuron cells have more activity than do P19 dimethyl sulfoxide-treated muscle or NIH/3T3 non-neuronal cells supporting the idea that this 25-bp region contributes to neuron-preferred promoter activity. The major transcription start site at position +1 is located in this proposed core promoter element. The ETS-1 transcription factor prefers binding to the Ets 1-3 binding site found in this core by a ratio of five to one over the PEA-3 binding site (30). This finding is particularly interesting as the ETS-1 transcription factor is thought to be specific for B cells and resting T cells of the immune system and not been previously described for neuronal cells. Sp1 binding sites appear to be ubiquitously distributed in all promoters of all cell types and their ability to function as negative elements appears to be novel.

In summary, we described a complete sequence of the mouse presenilin-1 gene from its tip to its tail. This sequence has shown us that there are two independent transcription start sites. Functional testing of the DNA regions surrounding these start sites showed that they both were apparently controlled by a single, major promoter that includes the +1 position of exon 1A. This promoter was also quite interesting because it is mostly active in neuron-like cells. Further characterization can now progress to a complete description of those positive and negative DNA elements and transcription factors which function to control presenilin-1 gene expression.