Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Langston, A. W.
Right arrow Articles by Gudas, L. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Langston, A. W.
Right arrow Articles by Gudas, L. J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 4, Issue of January 24, 1997 pp. 2167-2175
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Retinoic Acid-responsive Enhancers Located 3' of the Hox A and Hox B Homeobox Gene Clusters
FUNCTIONAL ANALYSIS*

(Received for publication, July 16, 1996, and in revised form, October 18, 1996)

Alexander W. Langston , James R. Thompson Dagger and Lorraine J. Gudas §

From the Department of Pharmacology, Cornell University Medical College, New York, New York 10021

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
Acknowledgments
REFERENCES


ABSTRACT

Homeobox genes control the spatial identity and differentiation of tissues in the developing vertebrate embryo. Retinoids are signaling molecules involved in the regulation of Hox genes. We previously identified a 3' enhancer called the RAIDR5, which contained a DR5 retinoic acid response element (RARE) and was responsible for the retinoic acid (RA)-associated expression of the murine Hoxa-1 gene in teratocarcinoma cells. We demonstrate that a similar enhancer, which contains a DR5 RARE, is located at a DNase I-hypersensitive site 3' of the murine Hoxb-1 gene. This enhancer, the Hoxb-1 RAIDR5, regulates the RA responsiveness of the Hoxb-1 gene and is different in location and sequence from the RA-regulated 3' Hoxb-1 enhancers previously described. Several DNA elements within the murine Hoxa-1 RA-inducible RAIDR5 enhancer, including the DR5 RARE, conserved element (CE) 1, and CE2, are conserved in the murine Hoxb-1 RAIDR5 enhancer, the human homolog of Hoxa-1, and in the chicken Hoxb-1 gene. Gel shifts show that the CE2 sequence TATTTACTCA binds an RA-inducible factor, while UV cross-linking indicates that a 170-kDa protein binds to this sequence. Thus, the Hoxa-1 and Hoxb-1 genes possess 3' enhancers with similar sequences through which their expression and responsiveness to endogenous retinoids are controlled.


INTRODUCTION

Genetic analysis of Drosophila melanogaster led to the identification of the homeotic genes, which specify the identity of body parts during embryonic development (for reviews, see Refs. 1-4). The vertebrate homologs of these genes, the homeobox or Hox1 genes, appear in structurally related chromosomal gene clusters known as the Hox A, B, C, and D clusters, which are thought to have arisen from a single ancestral cluster by repeated duplication. The expression domains of Hox genes during embryogenesis have been suggested to create a "code" that specifies the positional fate of cells in the embryo (5, 6). Consistent with this function, experiments have demonstrated that changes in the expression of Hox genes lead to corresponding changes in tissue identity (7-9). Hox genes encode homeodomain-containing transcription factors (10), and expression of a particular Hox protein, or a combination of proteins, is thought to specify a positional identity by creating a unique pattern of gene expression (for reviews, see Refs. 2 and 11).

There is considerable evidence that retinoids such as retinoic acid (RA) play an important role in regulating Hox genes. Retinoids are required for normal vertebrate embryogenesis; the offspring of animals deficient in vitamin A have numerous developmental defects (12, 13). The addition of exogenous retinoids during vertebrate embryogenesis also leads to developmental abnormalities in zebrafish (14), Xenopus (15-18), chickens (19), hamsters (20); mice (21-24), and humans (25). Most striking is the ability of locally applied retinoids to respecify positional identity during development or regeneration of the vertebrate limb (for reviews, see Refs. 9 and 26-28). Such observations have led to the hypothesis that retinoids function as morphogens in vertebrates, specifying positional identities in a concentration-dependent fashion.

The retinoic acid receptors (RARs alpha , beta , and gamma ) and retinoid X receptors (RXRs alpha , beta , and gamma ) are members of the steroid/thyroid/ retinoid gene family, which includes the steroid receptors, thyroid hormone receptors, the RARs, the RXRs, and the vitamin D receptor, and are ligand-inducible regulators of transcription (for review, see Ref. 29-31). In addition to all-trans-retinoic acid, 9-cis-retinoic acid (32, 33), 4-oxoretinoic acid (34), 3,4-didehydro-RA (35), 4-oxoretinaldehyde (36), and 4-oxoretinol (37) are activating ligands for the RARs and can affect pattern formation in vertebrates (for review, see Ref. 38). RAR-RXR heterodimers are thought to be the species which control the expression of RA-responsive genes (for review, see Refs. 30 and 39). There is evidence that these heterodimers bind either DR2 or DR5 retinoic acid-response elements (RAREs). These elements consist of two "direct repeat" (DR) sequences of AGGTCA separated by either two or five bases (for review, see Ref. 30). Animals that lack more than one normal RAR show developmental abnormalities that correspond to those seen in vitamin A deficiencies, definitely demonstrating the importance of signal transduction by the retinoic acid receptors in vertebrate development (40, 41).

Evidence that retinoids were involved in the regulation of homeobox genes initially came from cell culture studies (42-45). In both human and murine teratocarcinoma cells, retinoic acid can induce the expression of many homeobox genes. This retinoic acid inducibility, like the expression pattern of genes in the embryo, corresponds to the order of the genes in the cluster (46, 47). Thus, the 3' most genes in each chromosomal cluster, e.g. HOXA1 and HOXB1, are the first to be induced by RA. This induction is transient in that it is observed over a 12-24-h period, which is followed by a decline in expression (44-47). Co-linear RA responsiveness has also been demonstrated in mouse and Xenopus embryos (17, 48-50). These observations indicate that the expression of Hox genes is controlled in part by retinoic acid or by other retinoids that activate the retinoic acid receptors.

The murine Hoxa-1 gene is the 3' most homeobox gene in the "Hox a" chromosomal cluster on mouse chromosome 6 (51). Previously, we described the identification of a retinoic acid-responsive enhancer located approximately 4.5 kilobases 3' of the murine Hoxa-1 gene (formerly Hox 1.6; see Scott (52) for nomenclature). This enhancer, called the Hoxa-1 RAIDR5, was shown to be required for retinoic acid inducibility of Hoxa-1 in cultured F9 and P19 teratocarcinoma cells, and the ~300-bp enhancer functioned in either orientation when placed upstream of the basal TK promoter (53). Furthermore, this enhancer function was shown to require a DR5 RARE since point mutations within the RARE abolished RA inducibility (53). We now report the identification of very similar enhancers located 3' of the murine and chicken Hoxb-1 (formerly called Hox 2.9) genes. The murine Hoxb-1 gene is the 3' most homeobox gene in the "Hox b" chromosome cluster on mouse chromosome 11 (51). We also report the identification of a highly conserved 3' enhancer in the human HOXA1 gene. We demonstrate that these related RAIDR5 enhancers all mediate retinoic acid responsiveness in cultured cells and share common sequence elements, including a DR5 RARE.


EXPERIMENTAL PROCEDURES

Isolation of Genomic Clones

The human HOXA1 clones were isolated from a genomic library from human lymphocyte DNA in lambda EMBL3 obtained from Dr. Winnie Wong. Standard hybridization conditions were modified by reduction of formamide concentration to 25%, and the probe used was the PstI-EcoRI fragment containing the 3' RA-responsive enhancer from the murine Hoxa-1 gene (53). Hoxb-1 and Hoxd-1 genomic clones were isolated from lambda FIX (Stratagene) and lambda EMBL (constructed by Anton Berns) libraries containing 129SV genomic DNA. The Hoxb-1 cDNA probe was provided by Dr. Joseph Grippo. The chicken Hoxb-1 phage (54) was obtained from Dr. Gregor Eichele. Library screening, phage purification, and DNA isolation were by standard methods (55).

CAT Transfection Assays and beta -Galactosidase Assays

Standard methods were used to subclone DNA fragments from genomic phage into Bluescript, pBLCAT2 (56), or pGOTKCAT. The latter is a derivative of pGL2 (Promega) in which the luciferase gene is replaced by the TK minimal promoter and the CAT reporter from pBLCAT2 and includes a transcriptional terminator upstream of the polylinker to reduce background. Transient transfections, CAT assays, and beta -galactosidase assays were performed as described previously (53). Quantitation of CAT assays was carried out using a PhosphorImager (Molecular Dynamics). beta -Galactosidase units were calculated by the formula: beta -gal units = (A420) (100)/(volume of lysate per reaction) (time).

Mutagenesis of Conserved Elements

Conserved elements 1 and 2 were mutated by polymerase chain reaction amplification of subcloned enhancer fragments with the following oligonucleotides, paired with primers to flanking plasmid sequences: CE1, top strand: 5'-CTGAGGATCCCGGAGGCTATTCAGATGC-3'; CE1, bottom strand: 5'-GGGATCCTCAGCTCAAAGGTGAACCCAAAGC-3'; CE2, top strand: 5'-CGCTCTGCAGAACAGTCTGAAAGGGTTG3-'; and CE2, bottom strand: 5'-TGTTCTGCAGTTGATCGGTTTGAAT-3'. These oligomers are complementary to sequences adjacent to conserved elements 1 and 2, but their 3' tails are noncomplementary and contain unique restriction sites. Following polymerase chain reaction, products were cut with appropriate enzymes, purified, and ligated. Plasmid primers were then used to amplify the fragments containing disrupted CE1 or CE2. To generate an enhancer with mutations in both CE1 and CE2, the process was repeated with a fragment containing mutations in CE1, using the oligonucleotides to CE2. Products were sequenced to confirm that the mutations in the conserved elements were the only changes introduced. Mutated DNA fragments were then cloned into the Hoxa-1 (1.6) lacZ minigenes (see Fig. 5). These minigenes differ from the previously described constructs (53) in that the 3' end of the lacZ gene is joined to the PvuII site at bp 203 of the Hoxa-1 (1.6) cDNA. The resulting constructs include the constitutive intron of Hoxa-1, unlike the minigenes used in previous work (53) and lack only 44 base pairs of exon 1. 


Fig. 5. Structure of Hoxa-1 (1.6)-lacZ minigenes and activity in transiently transfected P19 cells. One µg of pGKCAT and 20 µg of each Hoxa-1 (1.6) lacZ minigene construct were used to transfect 2 × 106 P19 cells/150-cm2 gelatinized plate. Restriction enzyme sites are: B, BstII; E, EcoRI; C, ClaI; K, KpnI; S, SacI; X, XhoI. Structure of the wild type (WT) enhancer-containing minigene is indicated above. Dotted lines connect the 3' region to an expanded scale diagram of the Hoxa-1 RAIDR5 WT enhancer and those enhancers with mutations in the DR5 RARE (muRARE), CE1 (muCE1), CE2 (muCE2), and both CE1 and CE2 (muCE1 & CE2). The XX indicates the presence of the mutated DNA sequence. The adjacent graph indicates the activities of the enhancers in untreated (ethanol control, stem cells = St) and RA-treated (labeled as RA) P19 cells (see "Experimental Procedures"). Constructs contain a total of ~13.5 kb of Hoxa-1 (1.6) genomic DNA with ~6.5 kb of 5'- and ~3 kb of 3'-flanking sequence with lacZ (shaded box) fused in frame to translated sequences of Hoxa-1 (1.6). Exons are depicted as open boxes, and the hatched box indicates the location of the homeobox. The location of the RARE in the enhancer is indicated below as DR5 and conserved elements 1 and 2 by CE1 and CE2. The sequences of CE1 and CE2 (see Fig. 4) were changed as follows: WT CE1, GAGAGTTTTACTTTTGG to muCE1, GAGctgaggaTcccGG; WT CE2, CAATATTTACTCA to muCE2, CAActgcagaaCA; and WT DR5, CA<UNL>GGTTCA</UNL>CCGAA<UNL>AGTTCA</UNL>AG to muRARE, C-cTagcCCGAAAaTTacAG (unchanged bases are shown in capital letters). The bar heights in the figure represent the averages of three different experiments using three independent plasmid preparations. Standard deviations are indicated by lines above each bar. The average and standard deviations obtained for each construct in beta -galactosidase units are: 1) stem cells: WT 0.253 ± 0.085, muRARE 0.184 ± 0.006, muCE1 0.526 ± 0.160, muCE2 0.302 ± 0.090, and 2 × mu 0.591 ± 0.114; 2) RA-treated cells: WT 0.814 ± 0.054, muRARE 0.186 ± 0.010, muCE1 1.520 ± 0.224, muCE2 1.54 ± 0.170, and 2 × mu 2.163 ± 0.672.
[View Larger Version of this Image (21K GIF file)]


Preparation of Nuclear Extracts

Approximately 1 × 107 F9 or P19 teratocarcinoma cells, either stem (control, undifferentiated, untreated) or retinoic acid treated for 48 h, were washed twice with phosphate-buffered saline and resuspended in two packed cell volumes of cell lysis buffer (10 mM Hepes, pH 7.0; 3 mM MgCl2, 40 mM KCl, 0.5 mM phenylmethylsulfonyl fluoride, 1 mM DTT, 5% glycerol, 8 mg/ml aprotinin, 2 mg/ml leupeptin, 0.2% Nonidet P-40). Cells were lysed for 5 min at 4 °C and nuclei were pelleted by centrifugation in a microcentrifuge at 5000 rpm for 5 min. Nuclei were resuspended in two packed nuclear volumes of extraction buffer (20 mM Hepes, pH 7.9, 1.5 mM MgCl2, 0.42 M KCl, 0.2 mM EDTA, 1 mM DTT, 0.5 mM phenylmethylsulfonyl fluoride; 25% glycerol) and incubated for 45 min at 4 °C with gentle shaking. Samples were centrifuged at high speed in a microcentrifuge for 10 min. Supernatants were removed and dialyzed for 5 h at 4 °C against 50 volumes of dialysis buffer (20 mM Hepes, pH 7.9; 0.1 M KCl; 0.2 mM EDTA; 0.5 mM DTT; 0.5 mM phenylmethylsulfonyl fluoride; 20% glycerol). Dialyzed samples were aliquoted and stored at -70 °C.

Electrophoretic Mobility Shift Assays

The sequences of complementary CE2 oligonucleotides used as probe in the binding assays are: sense CE2, GGCAAACCGATCAATATTTACTCAGTCTGA; and antisense CE2, GGTCAGACTGAGTAAATATTGATCGGTTTG. The mutated CE2 oligonucleotides are identical to those above except they contain the dinucleotide substitutions as indicated in Fig. 6. The sequence of the AP-1 consensus oligonucleotides are: sense AP-1, AACTTTGACTCAG; and antisense AP-1, CTGAGTCAAAGTT. Complementary nucleotides were annealed by heating at 85 °C for 2 min, followed by successive 15 min incubations at 65, 37, 22, and 4 °C. The double-stranded oligonucleotide to be used as probe was end-labeled by filling in 5' overhangs with an [alpha -32P]dCTP using Klenow enzyme. Binding reactions were performed in a total volume of 20 µl containing: 0.5 ng (50,000 cpm) of probe, 5 µg of nuclear extract, 1 × binding buffer (10 mM Hepes, pH 7.9, 1 mM MgCl2, 60 mM KCl, 0.5 mM EDTA, 1 mM DTT, 10% glycerol), and 2 µg of poly(dI-dC). Samples were incubated for 20 min at 22 °C and separated on a 4% nondenaturing polyacrylamide gel, which was dried and visualized by autoradiography. Supershift experiments were performed similarly to the standard binding assay with the following modifications. Following the 20-min 22 °C incubation, 2 µl of either anti-Fos or anti-Jun antibody (Santa Cruz Biotechnology) was added to the binding reaction and incubated another 2 h at 4 °C. Samples were separated on a 6% nondenaturing polyacrylamide gel at 4 °C.


Fig. 6. The CE2 element of the Hoxa-1 3' RAIDR5 enhancer is a factor recognition site in RA treated P19 cells. A double-stranded oligonucleotide encoding the CE2 element from the Hoxa-1 enhancer was 32-P-end-labeled and incubated with 5 µg of nuclear extract from either P19 stem cells (lanes 2-4) or P19 cells that had been treated with RA for 48 h (lanes 5-7). Lane 1 contains probe only. Samples contained either no competitor (lanes 2 and 5) or 100-fold molar excess of either the wild type unlabeled competitor (lanes 4 and 7) or a competitor with the M1 mutation (see Fig. 7) in the CE2 element (designated NS). The specifically competed band is indicated by an arrow. Free probe and nonspecific complexes (NS) are also indicated by arrows.
[View Larger Version of this Image (62K GIF file)]


Ultraviolet Cross-linking of Protein to DNA

Binding reactions were carried out in a 20-µl volume as described in the previous section. Following a 20-min incubation, the reactions were exposed to 254-nm wavelength ultraviolet light from a hand-held luminometer for 10 min at a distance of 5 cm. 20 µl of 2 × SDS-sample buffer (100 mM Tris-HCl, pH 6.8, 100 mM DTT, 4% (w/v) SDS, 0.2% (w/v) bromphenol blue, 20% (w/v) glycerol) were added to each reaction, and the samples were boiled for 5 min to denature proteins. The samples were subjected to SDS-polyacrylamide gel electrophoresis utilizing a 5% stacking gel and an 8% separating gel. A 10-kDa protein ladder (Life Technologies, Inc.) was run as a size standard. To visualize the protein standards, the gel was stained overnight in Coomassie Blue staining solution (50% (v/v), methanol 0.05% (v/v) Coomassie Brilliant Blue R-250, 10% (v/v) acetic acid, and 40% H2O) and destained for several hours in 5% (v/v) methanol, 7% (v/v) acetic acid, and 88% H2O. The gel was then dried and visualized by autoradiography.


RESULTS

Identification of a Retinoic Acid-responsive Enhancer 3' of the Human HOXA1 Locus

Since we had previously identified a retinoic acid-responsive enhancer located about 4.5 kb 3' of the start site of transcription of the murine Hoxa-1 gene (53), we wanted to determine whether or not this enhancer sequence was conserved in other Hox genes located in the most 3' position of Hox chromosomal clusters such as the murine Hoxb-1 gene, the chicken Hoxb-1 gene, and the human HOXA1 gene. Genomic clones for the murine Hoxa-1 and Hoxb-1 genes, the human HOXA1 gene, and the chicken Hoxb-1 gene were isolated or obtained as described under "Experimental Procedures." (Murine Hox genes are labeled using small letters, human Hox genes with capital letters (52).) DNA hybridization experiments demonstrated that the human and murine Hoxa-1 genes were homologous not only in their transcribed regions, but also in portions of their 3'-flanking DNA. DNA fragments containing the ~300-bp murine Hoxa-1 retinoic acid-responsive enhancer, called RAIDR5 (53), were used to identify homologous sequences in the human HOXA1 gene. This fragment of human DNA was tested for the presence of a retinoic acid-responsive enhancer by subcloning cross-hybridizing DNA fragments into a minimal promoter-CAT vector and transfecting these constructs into F9 or P19 teratocarcinoma cells. The structure of the human HOXA1 gene, and the location of the 3' RA-responsive enhancer are shown in Fig. 1. One NsiI-SacI restriction fragment mediates retinoic acid responsiveness in transient transfection assays (Fig. 1). Thus, a retinoic acid-responsive enhancer is present about 4.5 kb 3' of the human HOXA1 gene, in a location very similar to that which we previously described for the murine Hoxa-1 gene (53).


Fig. 1. Structure of the human HOXA-1 (1.6) locus and location of the 3' RA-responsive RAIDR5 enhancer. HOXA-1 (1.6) exons are drawn as open boxes and the homeobox is hatched. B, BamHI; E, EcoRI; K, KpnI; N, NsiI; S, SacI. The shaded horizontal bar indicates the region that hybridizes with the murine Hoxa-1 (1.6) enhancer fragment used to isolate the human genomic clones (see "Experimental Procedures"). Below are depicted the DNA fragments cloned adjacent to the HSVTK minimal promoter of pGTKCAT and the results of CAT assays with these constructs, following their transient transfection into F9 cells, as described under "Experimental Procedures." Et, ethanol carrier; RA, 1 × 10-6 M all-trans-retinoic acid. For comparison, included in the figure is a diagram of the murine Hoxa-1 gene with the location of its 3' RAIDR5 enhancer indicated by an open arrow. The murine Hoxa-1 3' RAIDR5 was identified and analyzed in a previous publication (53).
[View Larger Version of this Image (19K GIF file)]


Identification of a Retinoic Acid-responsive Enhancer 3' of the Murine Hoxb-1 Gene

DNase I hypersensitivity assays were used to map a putative retinoic acid-responsive enhancer near the murine Hoxb-1 gene using the same strategy employed to identify the RA-responsive enhancer 3' of the Hoxa-1 gene (53). Following RA treatment of F9 murine teratocarcinoma cells, a DNase I hypersensitive site was detected approximately 6.5 kb 3' of the Hoxb-1 gene (data not shown; position of the hypersensitive site is indicated by the open arrow in Fig. 2). Minimal promoter-CAT vectors containing a series of DNA fragments including and surrounding the location of the RA-inducible hypersensitive site were shown to mediate responsiveness to retinoic acid, as shown in Fig. 2. More specifically, an NsiI-SacI fragment which includes the region of the hypersensitive site was shown to be sufficient for RA inducibility in the transient transfection assays in either F9 (Fig. 2) or P19 cells (data not shown).


Fig. 2. Structure of the murine Hoxb-1 (2.9) locus and location of the distal 3' RA-responsive enhancer. Hoxb-1 (2.9) exons are drawn as open boxes and the homeobox is hatched. B, BamHI; E, EcoRI; S, SacI; Sc, ScaI. The open arrow above indicates the location of the RA-inducible DNase I-hypersensitive site detected in F9 cells (data not shown). Depicted below, at an expanded scale, are the DNA fragments cloned adjacent to the HSVTK minimal promoter of pGTKCAT and the results of CAT assays with these constructs, following their transient transfection into F9 cells, as described under "Experimental Procedures." N, NsiI site, only mapped in the CAT constructs (below), not in the Hoxb-1 (2.9) locus (above). Et, ethanol carrier; RA, 1 × 10-6 M all-trans-retinoic acid.
[View Larger Version of this Image (37K GIF file)]


Identification of a Retinoic Acid-responsive Enhancer from the Chicken Hoxb-1 Gene

The chicken Hoxb-1 (2.9) genomic phage DNA was analyzed for 3' enhancer activity by subcloning restriction fragments of the 3'-flanking DNA and testing various fragments for RA inducibility. In transient transfection experiments, an approximately 2-kb BamHI-EcoRI DNA fragment located 3' of the chicken Hoxb-1 gene was shown to confer RA responsiveness on a minimal promoter (Fig. 3). Other 3' chicken DNA fragments lacked the ability to confer RA responsiveness (Fig. 3, and data not shown).


Fig. 3. Structure of the chicken Hoxb-1 (2.9) locus and location of the distal 3' RAIDR5 RA-responsive enhancer. Hoxb-1 (2.9) exons are drawn as open boxes and the homeobox is hatched. B, BamHI; E, EcoRI; H, HindIII. Below are depicted the DNA fragments cloned adjacent to the HSVTK minimal promoter of pBLCAT2 and the results of CAT assays with these constructs, following their transient transfection into F9 cells, as described under "Experimental Procedures." Et, ethanol carrier; RA, 1 × 10-6 M all-trans-retinoic acid.
[View Larger Version of this Image (14K GIF file)]


Comparison of the DNA Sequences of the 3' Hoxa-1 and Hoxb-1 Retinoic Acid-responsive Enhancers: Conservation of a DR5 RARE and Elements CE1 and CE2

The aligned sequences of the RA-responsive enhancers from the murine Hoxa-1, the human HOXA1, and the murine and chicken Hoxb-1 genes are presented in Fig. 4. First, it is striking that two different homeobox genes, Hoxa-1 and Hoxb-1, located on different chromosomes, have such similar sequences in their RA-inducible enhancers. Second, with respect to the mouse Hoxa-1 and human HOXA1 3' retinoid-responsive enhancers, the region of near identity shown in Fig. 4 is part of a large block of conserved sequence. Furthermore, homology of the Hoxa-1 and b-1 enhancers among different species is particularly noteworthy, given that these DNA sequences come from species separated by an estimated 300 million years of evolution (57).


Fig. 4. Alignment of the 3' RAIDR5 enhancers from chick Hoxb-1 (2.9), murine Hoxb-1 (2.9), human HOXA1 (1.6), and murine Hoxa-1 (1.6). Regions of identity of greater than three sequential nucleotides are shaded; blocks of homology common to all four sequences are: conserved elements 1 and 2 (CE1 and CE2, boxed) and the direct repeats of the RAREs (arrows). Gaps are introduced to maximize sequence alignment. This region corresponds to the region between the XhoI site (+1) and SacI site (+467) of the murine Hoxa-1 gene (Fig. 1) from nucleotides 238 to 455.
[View Larger Version of this Image (55K GIF file)]


As expected from the ability of these enhancers to mediate RA responsiveness, all four enhancers include a DR5 (direct repeat 5) RARE. The half sites of these RAREs are precisely conserved, as is their separation by 5 base pairs. Thus, these ~300-bp enhancers are called the Hoxa-1 RAIDR5 and Hoxb-1 RAIDR5. Two other conserved elements (CE1 and CE2; boxed in Fig. 4) are also present in all four enhancers. The conservation of these sequences is equivalent to that of the RARE, suggesting that CE1 and CE2 play equally important roles in controlling the expression of the vertebrate homeobox genes. Therefore, we examined the functions of the CE1 and CE2 elements in more detail using electrophoretic mobility shift assays and transient transfection experiments.

Functional Analysis of the CE1 and CE2 in RAIDR5 Enhancer

To examine the functional importance of CE1 and CE2, mutations were introduced that altered each nucleotide of CE1 and CE2, as described under "Experimental Procedures." In addition, a double mutation in which both CE1 and CE2 elements were disrupted and another mutation in which the conserved RARE was specifically mutated were also characterized. These mutations were made in the context of a Hoxa-1 minigene/lacZ reporter construct that contains the lacZ gene inserted into the coding sequence of Hoxa-1 as well as 6.5 kb of 5'-flanking region and about 3 kb of 3'-flanking DNA (53) (Fig. 5). P19 teratocarcinoma cells were first transiently transfected with these constructs, and cells were either untreated (stem) or treated for 24 h with RA.

The results from the untreated P19 stem cells showed that mutation of the CE1 element did not significantly change beta -galactosidase activity as compared with that observed with the wild type construct (Fig. 5). Mutation of either the CE2 element or the RARE also had no effect on the activity of the reporter (Fig. 5). These results indicate that CE1 and CE2 do not appear to be functional elements in P19 stem cells.

The activities of all of the reporter constructs were increased by the addition of RA to P19 cells, with the exception of the construct containing a mutated RARE (Fig. 5). Mutation of CE1 resulted in an increase of approximately 3.0-fold and mutation of CE2 resulted in a 4.9-fold increase in activity, as compared to the 3.1-fold RA-associated increase in reporter activity observed with the wild type enhancer/reporter construct (Fig. 5). Mutation of both elements CE1 and CE2 resulted in an RA-associated increase in reporter activity of 3.7-fold (Fig. 5). These results indicate that the CE2 element plays a negative role in the RA responsive of the Hoxa-1 gene, since mutation of the CE2 element leads to a greater increase in the response to RA. The CE1 element does not function as a negative element in RA-treated P19 cells.

CE2 of the Hoxa-1 3' RAIDR5 Is a Retinoic Acid-inducible Factor Binding Site

Electrophoretic mobility shift assays were performed using CE1 and CE2 sequences from the mouse Hoxa-1 3' RAIDR5 enhancer as probes and nuclear extracts prepared from P19 or F9 teratocarcinoma stem cells versus P19 or F9 cells that had been treated for 48 h with RA. No binding to the CE1 element was detected in nuclear extracts from either stem cells or RA-treated cells (data not shown). Binding to the CE2 element was also absent in P19 stem cells (Fig. 6, lanes 2-4). In contrast, binding to the CE2 element was detected in RA-treated P19 cells (Fig. 6, lane 5) and F9 cells (data not shown). CE2 binding was shown to be specific since it could be effectively competed with a 100-fold molar excess of unlabeled CE2 oligonucleotide but could not be competed by an unrelated, nonspecific double-stranded oligonucleotide (Fig. 6, lane 6). When the CE2 element of the murine Hoxb-1 enhancer was used as a probe, an apparently identical binding complex was observed (data not shown). The CE2 element of the Hoxb-1 enhancer differs from that of the Hoxa-1 CE2 element by 1 base out of 14 (Fig. 4).

Analysis of the CE2 element revealed the presence of an AP-1 site (58-60). The AP-1 consensus site is TKANTCA where K is a G or T and N represents any nucleotide. To determine whether AP-1 was involved in recognition of the CE2 element, supershift assays were performed using antibodies that recognized conserved regions of both Fos and Jun family members. Under a variety of binding and gel buffer conditions, no shifting of the CE2 complex was observed (data not shown), suggesting that Fos and Jun are not present in the CE2 binding complex. To confirm this, a consensus AP-1 recognition site was examined for its ability to act as a competitor for the CE2 binding complex in an electrophoretic mobility shift assay. A 100-fold molar excess of the unlabeled AP-1 consensus element did not compete for CE2 binding activity (Fig. 7, lane 10), indicating that the CE2 complex did not contain Fos or Jun.


Fig. 7. The CE2 element of the Hoxa-1 3' RAIDR5 enhancer is a unique DNA recognition site and not an AP-1 element. A double-stranded oligonucleotide encoding the CE2 element from the Hoxa-1 enhancer was 32-P-end-labeled and incubated with 5 µg of nuclear extract from P19 cells that had been treated for 48 h with RA. Samples contained either: no competitor (lane 1); 100-fold molar excess of unlabeled wild type competitor (lane 2); 100-fold molar excess of unlabeled mutant competitors, containing dinucleotide mutations in the CE2 element as indicated in bold type (lanes 3-9); or 100-fold molar excess of an unlabeled AP-1 site (lane 10). The specifically competed band is indicated by an arrow. Free probe and nonspecific complexes (NS) are also indicated by arrows.
[View Larger Version of this Image (44K GIF file)]


To determine which nucleotides in the murine Hoxa-1 CE2 element are essential for binding, a panel of CE2 oligonucleotides containing dinucleotide base mutations were examined for their ability to compete the CE2 complex binding in an electrophoretic mobility shift assay (Fig. 7). Mutations M1 and M7 were effective competitors and therefore still retained the ability to bind the CE2 complex (Fig. 7, lanes 3 and 9). Mutations M2 through M6 could not compete for the binding complex indicating that the 10 nucleotides, TATTTACTCA, are critical to CE2 binding (Fig. 7, lanes 4-8). This sequence constitutes a novel binding site since, although it overlaps with the AP-1 site, it contains additional residues that are not essential for AP-1 binding. Importantly, these ten bases are the nucleotides that are specifically conserved in the homeobox 3' RAIDR5 enhancers of the murine Hoxb-1, human HOXA1, and chicken Hoxb-1 genes (Fig. 4). Thus, the CE2 element is likely to play an important role in the transcriptional regulation of the murine Hoxa-1 and human HOXA1 genes, and the murine and chicken Hoxb-1 genes.

Brn 3.0, a pituitary-octamer-unc domain protein expressed in the pituitary gland and in the corticotroph cell line ATt-20, is involved in regulation of the proopiomelanocortin gene (61). The sequence GCATAAATAAT has been identified as a high affinity Brn 3.0 binding site. This sequence overlaps with a complementary region, TATTTA, of the CE2 element. To examine whether Brn 3.0 was involved in binding the CE2 element, a mobility shift assay was performed using nuclear extracts prepared from the pituitary ATt-20 cell line. High levels of both Brn 3.0 and the CE2 factor(s) were detected in these ATt-20 cells, but the Brn 3.0 and CE2 binding complexes migrated with different mobilities on the gel (data not shown). In addition, the Brn 3.0 site could not compete the CE2 complex and the CE2 site could not compete the Brn 3.0 complex, indicating that Brn 3.0 is not involved in binding to the CE2 element (data not shown).

To analyze further the CE2 binding complex, UV cross-linking was performed. Binding reactions were carried out as described under "Experimental Procedures," using nuclear extracts from P19 cells that had been treated for 48 h with RA. Following this incubation, the samples were exposed to ultraviolet light at a wavelength of 254 nm and at a distance of 5 cm for 10 min. The samples were then separated on an 8% SDS-polyacrylamide gel. The probe alone is shown in Fig. 8, lane 1. In the absence of any UV treatment, no bands are observed (lane 2). Following UV treatment a band is observed at approximately 180 kDa (lane 3), and a smeared band is observed below 60 kDa. The 180-kDa band is specifically competed away by a 100-fold molar excess of unlabeled CE2 competitor (lane 4), but is unaffected by unlabeled competitor that contains a mutation of the CE2 site (lane 5). The smear below 60 kDa is not significantly affected by specific competitor indicating that these are nonspecific interactions. The 180-kDa band observed includes the molecular mass of the 32 bases of one strand of the labeled 32-base pair probe which has a molecular mass of approximately 10 kDa (depending on which strand of the CE2 binding site is effectively cross-linked to the protein). The cross-linked protein therefore has an approximate molecular mass of 170 kDa.


Fig. 8. UV treatment cross-links a 170-kDa protein to the labeled CE2 probe. Binding reactions were carried out as described previously. All samples were incubated with 5 µg of nuclear extract from P19 cells that had been treated for 48 h with RA and the 32-P-labeled Hoxa-1 enhancer CE2 element with the exception of lane 1 which contains probe only and no nuclear extract. Lane 2 contains extract but was not subjected to UV irradiation. Lane 3 is identical to lane 2 but was subjected to 10 min of UV irradiation. Lane 4 is identical to lane 3 but contains a 100-fold molar excess of unlabeled wild type CE2 competitor, and lane 5 is identical to lane 3 but contains a 100-fold molar excess of the unlabeled mutant CE2 competitor site M3, which was described previously. Samples were separated by SDS-polyacrylamide gel electrophoresis utilizing a 5% stacking gel and an 8% separating gel. The size and migration of known protein standards is indicated (in kilodaltons) on the left. The specific 180-kDa binding complex (including the size of the cross-linked DNA probe) is indicated by the arrow on the right. This experiment was performed three times with essentially identical results obtained in all three experiments.
[View Larger Version of this Image (47K GIF file)]


The 3' RAIDR5 Enhancer of the Murine Hoxb-1 Gene Is Distinct from the Previously Identified 3' RAIDR2 Enhancer

In previous work (62-66), several enhancers surrounding the murine and human Hoxb-1 genes were analyzed, but none of these 5' or 3' enhancers was reported to contain a DR5 RARE. However, a functional RARE 3' of the murine, chicken, and pufferfish Hoxb-1 (2.9) genes was shown to mediate a portion of the RA responsiveness of the Hoxb-1 gene in transgenic animals. Marshall et al. (62) have reported that this RARE is a functional DR2-type RARE in the murine and pufferfish Hoxb-1 genes, while Ogura and Evans (64) have reported similar results for the human HOXB1 gene. We have confirmed that the mouse Hoxb-1 gene has this second RA-responsive enhancer, located 3' of this gene but much closer to the transcribed sequence (referred to as the DR2 RARE, see Fig. 9) than the RAIDR5 enhancer described above.


Fig. 9. Structure of the murine and chicken Hoxb-1 (2.9) loci and identification of a proximal 3' RAIDR2 enhancer in the murine gene. Maps are as described previously in the legends to Figs. 2 and 3. Open diamonds indicate the locations of the 3' RAIDR5 enhancers, while the RAIDR2 DR-2 RARE described by Marshall et al. (62) is depicted as an open circle. B, BamHI; E, EcoRI; H, HindIII; S, SacI; Sc, ScaI. Depicted below are the DNA fragments cloned adjacent to the HSVTK minimal promoter of pGTKCAT and the results of CAT assays with these constructs following their transient transfection into F9 and P19 cells as indicated (see "Experimental Procedures"). Et, ethanol carrier; RA, 1 × 10-6 M all-trans-retinoic acid.
[View Larger Version of this Image (33K GIF file)]


This RAIDR2 enhancer, which contains a DR2 RARE, exhibits different properties in cultured teratocarcinoma cells when compared to the RAIDR5 enhancer we have identified in this report. Using P19 teratocarcinoma cells, RA responsiveness of the murine Hoxb-1 gene from this 3' RAIDR2 enhancer could be detected (Fig. 9). However, in F9 teratocarcinoma cells these same constructs did not mediate a response to RA, consistent with the observed absence of a DNase I-hypersensitive site at this location in F9 cells (Fig. 2). Thus, the murine Hoxb-1 RAIDR2 enhancer functions to induce RA responsiveness only in some teratocarcinoma cell lines. This is a markedly different result from that obtained with the RAIDR5 enhancers; these function in all teratocarcinoma and embryonic stem cell lines we have tested, including F9 and P19 teratocarcinoma cells, and CCE embryonic stem cells (Figs. 1, 2, 3 and 5, and data not shown).

The chicken homolog of the Hoxb-1 3' proximal enhancer does not show the same cell type variation as the cognate enhancer from the mouse. However, while it functions in both P19 and F9 cells, in F9 cells the fold induction by RA is considerably less (Fig. 9). After examination of the sequence of this DNA fragment from the chicken Hoxb-1, we were unable to identify a DR2 RARE identical to that previously identified by Marshall et al. (62) or any other blocks of homology between the chicken and its cognate fragment from the mouse Hoxb-1 gene in this region (data not shown). Thus, this DR2 RARE appears to be less conserved than the DR5 RARE within the RAIDR5 enhancers identified in this report. Creation of chimeric constructs between the 3' RAIDR2 enhancer of the mouse Hoxb-1 and similar portions of the chicken Hoxb-1 gene would allow us to map the sequences involved in the cell type-specific function (P19 versus F9 cells) of the murine Hoxb-1 RAIDR2.

Further evidence that, in cultured teratocarcinoma cells, the RAIDR5 and RAIDR2 enhancers are functionally distinct comes from the fact that the DR2 RARE from the murine Hoxb-1 gene, without additional genomic sequences, is unable to confer significant RA responsiveness on a heterologous promoter (63, 64).2 In contrast, the DR5 RARE (a 21-mer with 2 bases on each side of the DR5 sequence) mediates RA responsiveness in all teratocarcinoma cell lines tested when it is placed upstream of a basal thymidine kinase promoter/reporter construct, even in the absence of co-transfected receptor (53).2 Thus, the RAIDR5 enhancer 3' of the murine and chicken Hoxb-1 genes, which we describe here, is unlikely to be redundant to other previously described Hoxb-1 regulatory elements (62-64, 66), given the evolutionary conservation of this enhancer and the apparent functional differences between these DR5 and DR2 RAREs (for review, see Ref. 30).


DISCUSSION

Experiments in which sequences from Hox loci have been used to control lacZ expression in transgenic animals have demonstrated the complexity of Hox gene regulation (for review, see Refs. 6 and 27). Multiple, distinct enhancer-like elements, each functioning in a stage- and tissue-specific manner, are thought to act in combination to create the temporal and spatial expression patterns of Hox genes. Similar combinatory action of enhancer elements have been well documented for the homeotic genes of Drosophila (67, 68). We previously described the identification of one such enhancer, located at about 4.5 kb 3' of the murine Hoxa-1 gene transcription start site, and demonstrated that this enhancer, and specifically the DR5 RARE within it, was required for the RA responsiveness of the Hoxa-1 gene in teratocarcinoma cells (53).

In this study we show that this RA-responsive enhancer is also present in other homeobox genes similar in chromosomal position to Hoxa-1 (see Fig. 10). Conservation of this RAIDR5 enhancer sequence suggests that the DR5 RARE and the two conserved elements CE1 and CE2 serve regulatory functions which are required for expression of both the Hoxa-1 and Hoxb-1 genes. To date, the only RAREs identified in the Hox clusters are the DR5 RARE of Hoxa-1 (53, 69) (this report for the human HOXA1 gene), the DR5 RAREs of the murine and chicken Hoxb-1 genes (this report), the DR2 RAREs in the murine and human Hoxb-1 genes (62-64, 66), and a divergent DR5 RARE conserved in the promoters of the human and murine D4 genes (70, 71). Thus, while it has been shown that most Hox genes are inducible by RA in cultured cells (46, 47), how extensive a role direct regulation by activated retinoic acid receptors plays in the creation of the expression patterns of other Hox genes remains to be determined (for review, see Ref. 72).


Fig. 10. Diagram comparing the approximate locations of the genes of the murine Hoxa chromosomal cluster with those of the murine Hoxb chromosomal cluster (51). The locations of the Hoxa-1 RAIDR5 and Hoxb-1 RAIDR5 are shown. The locations of Hox genes in the human HOXA chromosomal cluster are very similar to those of the murine cluster (46).
[View Larger Version of this Image (10K GIF file)]


The potential roles that the conserved elements CE1 and CE2 in the RAIDR5 enhancer play in the regulation of Hoxa-1 and Hoxb-1 in various cell types are currently being examined in greater depth. The data presented in this report indicates that the CE2 binding factor(s) is a novel, previously unidentified protein(s). The transactivation data indicate that the CE2 element plays a negative role in the RA responsiveness of the Hoxa-1 gene. Although the level of inhibition of expression observed is small, the repression correlates with the induction of CE2 binding activity in P19 cells following RA treatment. In addition, CE2 binding is detected in F9 cells, another teratocarcinoma line, and is up-regulated by RA with the same kinetics as observed for P19 cells (data not shown). Since the Hoxa-1 and Hoxb-1 genes are only transiently activated by RA in murine and human teratocarcinoma cells (44-47), the RA induction of CE2 binding activity most likely plays a role in the repression of the RAIDR5 enhancer at later times after RA addition. The relatively weak inhibitory effect observed (Fig. 5) may reflect experimental limitations in using transient transfections to perform this analysis. For instance, previous experiments (53) demonstrated that, following RA treatment, a DNase I hypersensitive site is found at the Hoxa-1 RAIDR5 3' enhancer, indicating a reorganization of chromatin at this site. This change in chromatin may be essential to the function of the CE2 element. The generation of stable cell lines containing the Hoxa-1 minigene reporter constructs should help elucidate any role of chromatin structure on the ability of the CE2 site to function in regulating Hoxa-1 expression.

UV treatment of binding reactions cross-links a single protein band of approximately 170 kDa to the labeled CE2 binding site. UV cross-linking in Fig. 8 was performed for 10 min. In experiments not shown, samples were also UV-treated for time periods of 30, 60, and 90 min. In these cases, the 170-kDa band was still the only band observed. These results indicate that the lack of detection of additional proteins binding to the CE2 element was not due to an insufficient amount of UV cross-linking treatment. UV treatment results in the cross-linking of only a small percentage of protein (73) that is in close proximity to the probe. Therefore, only a single protein of a multimeric protein complex binding to the CE2 element will likely acquire label. Since only one band is observed, these results indicate that the CE2 binding protein(s) recognize the CE2 site as: 1) a monomer, 2) a homodimer, or 3) a heterodimer of two proteins of identical molecular mass. It is also possible that additional protein(s) can bind to this element in other cell types.

The consensus binding site recognized by the CE2 factor(s) is TATTTACTCA. These 10 nucleotides are identically conserved among the 3' enhancers of the murine Hoxa-1, murine Hoxb-1, human HOXA1, and chicken Hoxb-1 genes, suggesting that the CE2 element may play a role in regulating all of these genes. The CE2 element overlaps with an AP-1 site, but experiments show that neither Fos nor Jun is present in the binding complex. Although not identical, CE2 does show some homology to other known factor binding sites. Three elements which are similar in sequence to the CE2 binding site are those for the transcription factors Brn 3.0 and MEF-2, and the DE-2 element of the proopiomelanocortin promoter (61, 74-76).

The 3' enhancers identified in this study are likely to be important not only in the regulation of Hoxa-1 and Hoxb-1 genes themselves, but also in the activation of entire Hox loci. Most of the genes in the Hoxa and Hoxb chromosomal clusters (not all have been studied) have been shown to be activated in response to RA in a co-linear manner with respect to time and RA concentration (Fig. 10) (see Refs. 39 and 72 for review). There are several models which could explain this temporal Hox cluster activation. In one model, the Hox genes would be activated via an RA-responsive "locus control region," similar to that which controls the globin genes (77, 78); in this model the 3' RAIDR5 enhancer would function to regulate the RA responsiveness of the entire chromosomal Hox gene cluster. In a second model, the Hoxa-1 and Hoxb-1 genes would be activated directly via the RAIDR5 enhancers analyzed in this report, and then the protein products of these genes would activate the next 5' genes in the clusters, i.e. Hoxa-2 and b-2, respectively. In a third model, multiple RAREs would control the responses of Hox genes in a manner similar to that in which stripes of gene expression are generated in Drosophila embryos by binding sites with differing affinities for the morphogens bicoid and hunchback (79, 80). Although there is no direct evidence to support the validity of any one of these three mechanisms, in the case of the first two proposed models, the 3' RAIDR5 enhancers, identified here, are critical to the activation of the entire Hox cluster. Aspects of these models can be tested using cultured teratocarcinoma and embryonic stem cells, and such experiments are currently in progress.


FOOTNOTES

*   This work was supported in part by National Institutes of Health Grant R01CA39036 (L. J. G.). The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) S78041[GenBank] (for murine Hoxa-1).


Dagger    Supported by a fellowship from the American Cancer Society PF4280 during a portion of this work.
§   To whom correspondence should be addressed: Dept. of Pharmacology, Cornell University Medical College, 1300 York Ave., New York, NY 10021. Tel.: 212-746-6250; Fax: 212-746-8858.
1    The abbreviations used are: Hox, homeobox; RA, retinoic acid; RARE, retinoic acid response element; RAR, retinoic acid receptor; RXR, retinoid X receptor; DR, direct repeat; DR5, direct repeat 5; RAIDR5, retinoic acid-inducible RARE direct repeat5 enhancer; RAIDR2, retinoic acid-inducible RARE direct repeat2 enhancer; CE1, conserved element 1; CE2, conserved element 2; TK, thymidine kinase; CAT, chloramphenicol acetyltransferase; DTT, dithiothreitol; bp, base pair(s); kb, kilobase pair(s).
2    A. W. Langston and L. J. Gudas, unpublished observations.

Acknowledgments

We thank Dr. Joe Grippo for the Hoxb-1 cDNA probe, Dr. Gregor Eichele for the chicken Hoxb-1 phage, Taryn Resnick for editorial assistance, and Drs. Anna Means and Lap Ho for critically reading the manuscript.


REFERENCES

  1. Kenyon, C. (1994) Cell 78, 175-180 [CrossRef][Medline] [Order article via Infotrieve]
  2. Lawrence, P. A., and Morata, G. (1993) Cell 78, 181-189
  3. Lewis, E. B. (1992) J. A. M. A. 267, 1524-1531 [Free Full Text]
  4. McGinnis, W., and Krumlauf, R. (1992) Cell 68, 283-302 [CrossRef][Medline] [Order article via Infotrieve]
  5. Duboule, D., and Dollé, P. (1989) EMBO J. 8, 1497-1505 [Medline] [Order article via Infotrieve]
  6. Krumlauf, R. (1994) Cell 78, 191-201 [CrossRef][Medline] [Order article via Infotrieve]
  7. Krumlauf, R. (1993) Trends Genet. 9, 106-112 [CrossRef][Medline] [Order article via Infotrieve]
  8. Tabin, C. J. (1991) Cell 66, 199-217 [CrossRef][Medline] [Order article via Infotrieve]
  9. Tabin, C. J. (1992) Development 116, 289-296 [Medline] [Order article via Infotrieve]
  10. Gehring, W. J., Qian, Y. Q., Billeter, M., Furukubo-Tokunaga, K., Schier, A. F., Resendez-Perez, D., Affolter, M., Otting, G., and Wüthrich, K. (1994) Cell 78, 211-223 [CrossRef][Medline] [Order article via Infotrieve]
  11. Andrew, D. J., and Scott, M. P. (1992) New Biol. 4, 5-15 [Medline] [Order article via Infotrieve]
  12. Takahashi, Y. I., Smith, J. E., Winick, M., and Goodman, D. S. (1975) J. Nutr. 105, 1299-1310
  13. Wilson, J. G., Roth, C. B., and Warkany, J. (1953) Am. J. Anat. 92, 189-217 [CrossRef][Medline] [Order article via Infotrieve]
  14. Holder, N., and Hill, J. (1991) Development 113, 1159-1170 [Abstract]
  15. Agarwal, V. R., and Sato, S. M. (1993) Mech. Dev. 44, 167-173 [CrossRef][Medline] [Order article via Infotrieve]
  16. Durston, A. J., Timmermans, J. P. M., Hage, W. J., Hendriks, H. F. J., de Vries, N. J., Heideveld, M., and Nieuwkoop, P. D. (1989) Nature 340, 140-143 [CrossRef][Medline] [Order article via Infotrieve]
  17. Papalopulu, N., Clarke, J. D., Bradley, L., Wilkinson, D., Krumlauf, R., and Holder, N. (1991) Development 113, 1145-1158 [Abstract]
  18. Sive, H. L., and Cheng, P. F. (1991) Genes Dev. 5, 1321-1332 [Abstract/Free Full Text]
  19. Sundin, O., and Eichele, G. (1992) Development 114, 841-852 [Abstract]
  20. Shenefelt, R. (1972) Teratology 5, 103-118 [CrossRef][Medline] [Order article via Infotrieve]
  21. Kessel, M. (1992) Development 115, 487-501 [Abstract]
  22. Kessel, M. (1993) Neuron 10, 379-393 [CrossRef][Medline] [Order article via Infotrieve]
  23. Marshall, H., Nonchev, S., Sham, M. H., Muchamore, I., Lumsden, A., and Krumlauf, R. (1992) Nature 360, 737-741 [CrossRef][Medline] [Order article via Infotrieve]
  24. Morriss-Kay, G. M., Murphy, P., Hill, R. E., and Davidson, D. R. (1991) EMBO J. 10, 2985-2995 [Medline] [Order article via Infotrieve]
  25. Lammer, E. J., Chen, D. T., Hoar, R. M., Agnish, N. D., Benke, P. J., Braun, J. T., Curry, C. J., Fernhoff, P. M., Grix, A. W., Jr., Lotti, I. T., Richard, J. M., and Sun, S. C. (1985) N. Engl. J. Med. 313, 837-841 [Abstract]
  26. Duboule, D. (1993) Ann. Genet. 36, 24-29 [Medline] [Order article via Infotrieve]
  27. Means, A. L., and Gudas, L. J. (1995) Annu. Rev. Biochem. 64, 201-233 [CrossRef][Medline] [Order article via Infotrieve]
  28. Tickle, C. (1991) Dev. Suppl. 1, 113-121 [Medline] [Order article via Infotrieve]
  29. Leid, M., Kastner, P., and Chambon, P. (1992) Trends Biochem. Sci. 17, 427-433 [CrossRef][Medline] [Order article via Infotrieve]
  30. Mangelsdorf, D. J., Umesono, K., and Evans, R. M. (1994) in The Retinoids: Biology, Chemistry and Medicine (Sporn, M. B., Roberts, A. B., and Goodman, D. S., eds), pp. 319-350, Raven Press, New York
  31. Mangelsdorf, D. J., Thummel, C., Beato, M., Herrlich, P., Schütz, G., Umesono, K., Blumberg, B., Kastner, P., Mark, M., Chambon, P., and Evans, R. M. (1995) Cell 83, 835-839 [CrossRef][Medline] [Order article via Infotrieve]
  32. Heyman, R. A., Mangelsdorf, D. J., Dyck, J. A., Stein, R. B., Eichele, G., Evans, R. M., and Thaller, C. (1992) Cell 68, 397-406 [CrossRef][Medline] [Order article via Infotrieve]
  33. Levin, A. A., Sturzenbecker, L. J., Kazmer, S., Bosakowski, T., Huselton, C., Allenby, G., Speck, J., Kratzeisen, Cl., Rosenberger, M., Lovey, A., and Grippo, J. F. (1992) Nature 355, 359-361 [CrossRef][Medline] [Order article via Infotrieve]
  34. Pijnappel, W. W. M., Hendriks, H. F. J., Folkers, G. E., van den Brink, C. E., Dekker, E. J., Edelenbosch, C., van der Saag, P. T., and Durston, A. J. (1993) Nature 366, 340-344 [CrossRef][Medline] [Order article via Infotrieve]
  35. Thaller, C., and Eichele, G. (1990) Nature 345, 815-819 [CrossRef][Medline] [Order article via Infotrieve]
  36. Blumberg, B., Bolado Jr, J., Derguini, F., Craig, A. G., Moreno, T. A., Charkaravarti, D., Heyman, R. A., Buck, J., and Evans, R. M. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 4873-4878 [Abstract/Free Full Text]
  37. Achkar, C. C., Derguini, F., Blumberg, B., Langston, A., Levin, A. A., Speck, J., Evans, R. M., Bolado, J., J., Nakanishi, K., Buck, J., and Gudas, L. J. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 4879-4884 [Abstract/Free Full Text]
  38. Hofmann, C., and Eichele, G. (1994) in The Retinoids: Biology, Chemistry, and Medicine (Sporn, M. B., Roberts, A. B., and Goodman, D. S., eds), pp. 387-442, Raven Press, New York
  39. Gudas, L. J., Sporn, M. B., and Roberts, A. B. (1994) in The Retinoids: Biology, Chemistry, and Medicine (Sporn, M. B., Roberts, A. B., and Goodman, D. S., eds), pp. 443-520, Raven Press, New York
  40. Lohnes, D., Mark, M., Mendelsohn, C., Dollé, P., Dierich, A., Gorry, P., Gansmuller, A., and Chambon, P. (1994) Development 120, 2723-2748 [Abstract]
  41. Mendelsohn, C., Lohnes, D. D. D., Lufkin, T., Le Meur, M., Chambon, P., and Mark, M. (1994) Development 120, 2749-2771 [Abstract]
  42. Breier, G. M. B., Francke, U., Colberg-Poley, A. M., and Gruss, P. (1986) EMBO J. 5, 2209-2215 [Medline] [Order article via Infotrieve]
  43. Colberg-Poley, A. M., Voss, S. D., Chowdhury, K., and Gruss, P. (1985) Nature 314, 713-718 [CrossRef][Medline] [Order article via Infotrieve]
  44. LaRosa, G. J., and Gudas, L. J. (1988a) Proc. Natl. Acad. Sci. U. S. A. 85, 329-333 [Abstract/Free Full Text]
  45. LaRosa, G. J., and Gudas, L. J. (1988b) Mol. Cell. Biol. 8, 3906-3917 [Abstract/Free Full Text]
  46. Simeone, A., Acampora, D., Arcioni, L., Andrews, P. W., Boncinelli, E., and Mavilio, F. (1990) Nature 346, 763-766 [CrossRef][Medline] [Order article via Infotrieve]
  47. Simeone, A., Acampora, D., Nigro, V., Faiella, A., D'Esposito, M., Stornaiuolo, A., Mavilio, F., and Boncinelli, E. (1991) Mech. Dev. 33, 215-227 [CrossRef][Medline] [Order article via Infotrieve]
  48. Cho, K. W., and De Robertis, E. M. (1990) Genes Dev. 4, 1910-1916 [Abstract/Free Full Text]
  49. Conlon, R. A., and Rossant, J. (1992) Development 116, 357-68 [Medline] [Order article via Infotrieve]
  50. Dekker, E. J., Pannese, M., Houtzager, E., Boncinelli, E., and Durston, A. (1993) Mech. Dev. 40, 3-12 [CrossRef][Medline] [Order article via Infotrieve]
  51. Hunt, P., and Krumlauf, R. (1992) Annu. Rev. Cell Biol. 8, 227-256 [CrossRef]
  52. Scott, M. P. (1992) Cell 71, 551-553 [CrossRef][Medline] [Order article via Infotrieve]
  53. Langston, A. W., and Gudas, L. J. (1992) Mech. Dev. 38, 217-227 [CrossRef][Medline] [Order article via Infotrieve]
  54. Sundin, O. H., Busse, H. G., Rogers, M. B., Gudas, L. J., and Eichele, G. (1990) Development 108, 47-58 [Abstract]
  55. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  56. Luckow, B., and Schütz, G. (1987) Nucleic Acids Res. 15, 6490
  57. Gilbert, W., Marchionni, M., and McKnight, G. (1986) Cell 46, 151-154 [CrossRef][Medline] [Order article via Infotrieve]
  58. Bohmann, D., Bos, T. J., Admon, A., Nishimura, T., Vogt, P. K., and Tjian, R. (1987) Science 238, 1386-1392 [Abstract/Free Full Text]
  59. Franza, B. R., Jr., Rauscher, F. J., III, Josephs, S. F., and Curran, T. (1988) Science 239, 1150-1153 [Abstract/Free Full Text]
  60. Risse, G., Jooss, K., Neuberg, M., Brüller, H.-J., and Müller, R. (1989) EMBO J. 8, 3825-3832 [Medline] [Order article via Infotrieve]
  61. Gerrero, M. R., McEvilly, R. J., Turner, E., Lin, C. R., O'Connell, S., Jenne, K. J., Hobbs, M. V., and Rosenfeld, M. G. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 10841-10845 [Abstract/Free Full Text]
  62. Marshall, H., Studer, M., Pöpperl, H., Aparicio, S., Kuroiwa, A., Brenner, S., and Krumlauf, R. (1994) Nature 370, 567-571 [CrossRef][Medline] [Order article via Infotrieve]
  63. Ogura, T., and Evans, R. M. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 392-396 [Abstract/Free Full Text]
  64. Ogura, T., and Evans, R. M. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 387-391 [Abstract/Free Full Text]
  65. Pöpperl, H., Bienz, M., Studer, M., Chan, S.-K., Aparicio, S., Brenner, S., Mann, R. S., and Krumlauf, R. (1995) Cell 81, 1031-1042 [CrossRef][Medline] [Order article via Infotrieve]
  66. Studer, M., Pöpperl, H., Marshall, H., Kuroiwa, A., and Krumlauf, R. (1994) Science 265, 1728-1732 [Abstract/Free Full Text]
  67. Kaufman, T. C., Seeger, M. A., and Olsen, G. (1990) Adv. Genet. 27, 309-362 [Medline] [Order article via Infotrieve]
  68. Peifer, M., Karch, F., and Bender, W. (1987) Genes Dev. 1, 891-898 [Free Full Text]
  69. Frasch, M., Chen, X., and Lufkin, T. (1995) Development 121, 957-974 [Abstract]
  70. Moroni, M. C., M. A., V., and Mavilio, F. (1993) Mech. Dev. 44, 139-154 [CrossRef][Medline] [Order article via Infotrieve]
  71. Pöpperl, H., and Featherstone, M. S. (1993) Mol. Cell. Biol. 13, 257-265 [Abstract/Free Full Text]
  72. Langston, A. W., and Gudas, L. J. (1994) Curr. Opin. Genet. Dev. 4, 550-555 [CrossRef][Medline] [Order article via Infotrieve]
  73. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. (1994) Current Protocols in Molecular Biology, pp. 12.5.1-12.5.8, John Wiley & Sons, New York
  74. Nurrish, S. J., and Treisman, R. (1995) Mol. Cell. Biol. 15, 4076-4085 [Abstract]
  75. Therrien, M., and Drouin, J. (1991) Mol. Cell. Biol. 11, 3492-3503 [Abstract/Free Full Text]
  76. Therrien, M., and Drouin, J. (1993) Mol. Cell. Biol. 13, 2342-2353 [Abstract/Free Full Text]
  77. Engel, J. D. (1993) Trends Genet. 9, 304-309 [CrossRef][Medline] [Order article via Infotrieve]
  78. Grosveld, F., Greaves, D., Philipsen, S., Talbot, D., Pruzina, S., de Boer, E., Hanscombe, O., Belhumeur, P., Hurst, J., and Fraser, P. (1990) Ann. N. Y. Acad. Sci. 612, 152-159 [Medline] [Order article via Infotrieve]
  79. Nusslein-Volhard, C. (1991) Dev. Suppl. 1, 1-10 [Medline] [Order article via Infotrieve]
  80. Struhl, G., Johnston, P., and Lawrence, P. A. (1992) Cell 69, 237-249 [CrossRef][Medline] [Order article via Infotrieve]

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Hum ReprodHome page
L.-L. Wang, Z. Zhang, Q. Li, R. Yang, X. Pei, Y. Xu, J. Wang, S.-F. Zhou, and Y. Li
Ethanol exposure induces differential microRNA and target gene expression and teratogenic effects which can be suppressed by folic acid supplementation
Hum. Reprod., March 1, 2009; 24(3): 562 - 579.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
S. P. Atkinson, C. M. Koch, G. K. Clelland, S. Willcox, J. C. Fowler, R. Stewart, M. Lako, I. Dunham, and L. Armstrong
Epigenetic Marking Prepares the Human HOXA Cluster for Activation During Differentiation of Pluripotent Cells
Stem Cells, May 1, 2008; 26(5): 1174 - 1185.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H. Chen, H. Zhang, J. Lee, X. Liang, X. Wu, T. Zhu, P.-k. Lo, X. Zhang, and S. Sukumar
HOXA5 Acts Directly Downstream of Retinoic Acid Receptor {beta} and Contributes to Retinoic Acid Induced Apoptosis and Growth Inhibition
Cancer Res., September 1, 2007; 67(17): 8007 - 8013.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. W. McCool, X. Xu, D. B. Singer, F. E. Murdoch, and M. K. Fritsch
The Role of Histone Acetylation in Regulating Early Gene Expression Patterns during Early Embryonic Stem Cell Differentiation
J. Biol. Chem., March 2, 2007; 282(9): 6696 - 6706.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y.-S. Cho, E.-J. Kim, U.-H. Park, H.-S. Sin, and S.-J. Um
Additional Sex Comb-like 1 (ASXL1), in Cooperation with SRC-1, Acts as a Ligand-dependent Coactivator for Retinoic Acid Receptor
J. Biol. Chem., June 30, 2006; 281(26): 17588 - 17598.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Martinez-Ceballos, P. Chambon, and L. J. Gudas
Differences in Gene Expression between Wild Type and Hoxa1 Knockout Embryonic Stem Cells after Retinoic Acid Treatment or Leukemia Inhibitory Factor (LIF) Removal
J. Biol. Chem., April 22, 2005; 280(16): 16484 - 16498.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
S. S. Williams, J. P. Mear, H.-C. Liang, S. S. Potter, B. J. Aronow, and M. C. Colbert
Large-scale reprogramming of cranial neural crest gene expression by retinoic acid exposure
Physiol Genomics, October 4, 2004; 19(2): 184 - 197.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
S. Santini, J. L. Boore, and A. Meyer
Evolutionary Conservation of Regulatory Elements in Vertebrate Hox Gene Clusters
Genome Res., June 1, 2003; 13(6): 1111 - 1122.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
Y. Zhuang, T. N. Faria, P. Chambon, and L. J. Gudas
Identification and Characterization of Retinoic Acid Receptor {beta}2 Target Genes in F9 Teratocarcinoma Cells
Mol. Cancer Res., June 1, 2003; 1(8): 619 - 630.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
S. Bel-Vialar, N. Itasaki, and R. Krumlauf
Initiating Hox gene expression: in the early chick neural tube differential sensitivity to FGF and RA signaling subdivides the HoxB genes in two distinct groups
Development, March 13, 2003; 129(22): 5103 - 5115.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
J. M. McClintock, M. A. Kheirbek, and V. E. Prince
Knockdown of duplicated zebrafish hoxb1 genes reveals distinct roles in hindbrain patterning and a novel mechanism of duplicate gene retention
Development, March 7, 2003; 129(10): 2339 - 2354.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Thompson, M. F. Quinn, D. Grimwade, C. M. O'Neill, M. R. Ahmed, S. Grimes, M. F. McMullin, F. Cotter, and T. R. J. Lappin
Global down-regulation of HOX gene expression in PML-RARalpha + acute promyelocytic leukemia identified by small-array real-time PCR
Blood, February 15, 2003; 101(4): 1558 - 1565.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. A. Glozak, Y. Li, R. Reuille, K. H. Kim, M.-N. Vo, and M. B. Rogers
Trapping and Characterization of Novel Retinoid Response Elements
Mol. Endocrinol., January 1, 2003; 17(1): 27 - 41.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. Si and S. J. Collins
IL-3-induced enhancement of retinoic acid receptor activity is mediated through Stat5, which physically associates with retinoic acid receptors in an IL-3-dependent manner
Blood, December 15, 2002; 100(13): 4401 - 4409.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
G. S. Prins, W. Y. Chang, Y. Wang, and R. B. van Breemen
Retinoic Acid Receptors and Retinoids Are Up-Regulated in the Developing and Adult Rat Prostate by Neonatal Estrogen Exposure
Endocrinology, September 1, 2002; 143(9): 3628 - 3640.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
X. Guo, B. S. Knudsen, D. M. Peehl, A. Ruiz, D. Bok, R. R. Rando, J. S. Rhim, D. M. Nanus, and L. J. Gudas
Retinol Metabolism and Lecithin:Retinol Acyltransferase Levels Are Reduced in Cultured Human Prostate Cancer Cells and Tissue Specimens
Cancer Res., March 1, 2002; 62(6): 1654 - 1661.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. Houle, P. Prinos, A. Iulianella, N. Bouchard, and D. Lohnes
Retinoic Acid Regulation of Cdx1: an Indirect Mechanism for Retinoids and Vertebral Specification
Mol. Cell. Biol., September 1, 2000; 20(17): 6579 - 6586.
[Abstract] [Full Text]


Home page
Circ. Res.Home page
J. M. Miano and B. C. Berk
Retinoids : Versatile Biological Response Modifiers of Vascular Smooth Muscle Phenotype
Circ. Res., September 1, 2000; 87(5): 355 - 362.
[Full Text] [PDF]


Home page
Physiol. Rev.Home page
S. A. Ross, P. J. McCaffery, U. C. Drager, and L. M. De Luca
Retinoids in Embryonal Development
Physiol Rev, July 1, 2000; 80(3): 1021 - 1054.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
S. M. Lippman and R. Lotan
Advances in the Development of Retinoids as Chemopreventive Agents
J. Nutr., February 1, 2000; 130(2): 479 - 479.
[Abstract] [Full Text]


Home page
Cell Growth Differ.Home page
J. Shen and L. J. Gudas
Molecular Cloning of a Novel Retinoic Acid-responsive Gene, HA1R-62, Which Is also Up-Regulated in Hoxa-1-overexpressing Cells
Cell Growth Differ., January 1, 2000; 11(1): 11 - 17.
[Abstract] [Full Text]


Home page
BloodHome page
A. Melnick and J. D. Licht
Deconstructing a Disease: RAR{alpha}, Its Fusion Partners, and Their Roles in the Pathogenesis of Acute Promyelocytic Leukemia
Blood, May 15, 1999; 93(10): 3167 - 3215.
[Full Text] [PDF]


Home page
DevelopmentHome page
D Huang, S. Chen, A. Langston, and L. Gudas
A conserved retinoic acid responsive element in the murine Hoxb-1 gene is required for expression in the developing gut
Development, January 8, 1998; 125(16): 3235 - 3246.
[Abstract] [PDF]


Home page
DevelopmentHome page
A. Packer, D. Crotty, V. Elwell, and D. Wolgemuth
Expression of the murine Hoxa4 gene requires both autoregulation and a conserved retinoic acid response element
Development, January 6, 1998; 125(11): 1991 - 1998.
[Abstract] [PDF]


Home page
DevelopmentHome page
M Studer, A Gavalas, H Marshall, L Ariza-McNaughton, F. Rijli, P Chambon, and R Krumlauf
Genetic interactions between Hoxa1 and Hoxb1 reveal new roles in regulation of early hindbrain patterning
Development, January 3, 1998; 125(6): 1025 - 1036.
[Abstract] [PDF]


Home page
DevelopmentHome page
J van der Wees, J. Schilthuis, C. Koster, H Diesveld-Schipper, G. Folkers, P. van der Saag, M. Dawson, K Shudo, B van der Burg, and A. Durston
Inhibition of retinoic acid receptor-mediated signalling alters positional identity in the developing hindbrain
Development, January 2, 1998; 125(3): 545 - 556.
[Abstract] [PDF]


Home page
Cold Spring Harb Symp Quant BiolHome page
P. J. Kolm and H. L. Sive
Retinoids and Posterior Neural Induction: A Reevaluation of Nieuwkoop's Two-step Hypothesis
Cold Spring Harb Symp Quant Biol, January 1, 1997; 62(0): 511 - 521.
[Abstract] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
C.-B. Kim, C. Amemiya, W. Bailey, K. Kawasaki, J. Mezey, W. Miller, S. Minoshima, N. Shimizu, G. Wagner, and F. Ruddle
Hox cluster genomics in the horn shark, Heterodontus francisci
PNAS, February 15, 2000; 97(4): 1655 - 1660.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Langston, A. W.
Right arrow Articles by Gudas, L. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Langston, A. W.
Right arrow Articles by Gudas, L. J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1997 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement