INTRODUCTION

The control of body weight involves a regulated balance between energy intake and expenditure. Energy expenditure can be divided into three components (1): resting metabolic rate, physical activity, and adaptive thermogenesis, the latter being defined as the component of energy expenditure that changes in response to environmental stimuli such as cold exposure or chronic dietary excess. In rodents, an important site of adaptive thermogenesis is brown adipose tissue (reviewed in Ref. 2) where uncoupling protein-1 (UCP1),¹ expressed exclusively in brown adipocytes (3, 4), promotes proton transport across the mitochondrial inner membrane. UCP1 decreases the proton electrochemical potential gradient, uncoupling fuel oxidation from ADP availability (reviewed in Refs. 5 and 6). Activation of UCP1, therefore, causes increased consumption of calories and generation of heat. UCP1-mediated effects on energy expenditure are regulated by changes in the level of sympathetic nervous system activity in brown fat. Cold exposure and overfeeding cause increased sympathetic stimulation of brown fat, simulating UCP1-mediated uncoupling and energy expenditure. The importance of this is demonstrated by the fact that mice lacking UCP1 are cold-intolerant (7). UCP1 is also regulated by purine di- and trinucleotides (ATP, ADP, GTP, and GDP) and free fatty acids, which inhibit and stimulate uncoupling activity, respectively (reviewed in Refs. 5 and 6).

UCP1 may be of lesser importance in humans in whom the mass of brown adipose tissue is limited. Instead, skeletal muscle is thought to be a major site of adpative thermogenesis (8-12). UCP2 (13-15) is a recently described UCP1 homologue which, unlike UCP1, is expressed in most tissues. Because of its wide tissue distribution, UCP2 could have important effects on metabolic rate in humans. However, as UCP2 is expressed at high levels in many sites not thought to mediate adaptive thermogenesis, such as spleen, lymph node, thymus, and gastrointestinal tract (13-16), its role in mediating regulated energy expenditure is unclear.

UCP3 is a third member of the uncoupling protein family (15, 16). It was identified by Boss et al. (15) using a homology-based screening method and by the present authors (16) as an expressed sequence tag (EST) deposited into the Washington University, St. Louis-Merck & Co. EST data base. UCP3 is distinguished from other UCPs by its relatively selective, high level expression in skeletal muscle (15, 16) and the existence of two RNA transcripts (15), UCP3_L and UCP3_S, which are predicted to encode long (312 amino acids) and short (275 amino acids) UCP3 proteins, differing only by the presence or absence of C-terminal 37 residues. This difference could be significant because the region in question is homologous to a domain in UCP1 thought to mediate inhibition of uncoupling activity by purine nucleotides (17, 18). The abundant and relatively selective expression of UCP3 in skeletal muscle suggests that it may be a mediator of adaptive thermogenesis in humans. Here we define the intron-exon structure of the human UCP3 gene, establish its chromosomal localization at 11q13, within 75-150 kb of UCP2, and define the genetic basis for the two UCP3_S and UCP3_L mRNA transcripts.

EXPERIMENTAL PROCEDURES

Six sense and antisense PCR primer pairs corresponding to cDNA sequence were used to amplify genomic fragments from human genomic DNA (see Table I). The genomic PCR fragments were subcloned using the TA cloning system (pCR2.1 plasmid, Invitrogen, Carlsbad, CA) and were subjected to restriction enzyme digestion plus agarose gel electrophoresis and dideoxy sequencing using M13, T7, and internal UCP3 gene-specific primers. 3RACE (rapid amplification of cDNA ends) was used to clone the 3 ends of UCP3_S and UCP3_L. 3RACE was performed using the Marathon cDNA Amplification Kit, human skeletal muscle Marathon-Ready cDNA (both from CLONTECH) and a sense UCP3 primer (TCAGCCCCCTCGACTGTA) located in exon 6 (cDNA position relative to ATG = +761 to +778).

Table I. PCR primers used to amplify the human UCP3 gene PCR primers used to amplify human UCP3 gene                     Position of primers in cDNA   (relative to ATG) Position of   primers in gene     Size of amplified   PCR product kb Sense: GAGGGGCCATCCAATCC  183 to 165 Exon 1 2.0 Antisense: AAGGCTTCAGTCCAACCATAG +19 to 2 Exon 2  Sense: AGGACTATGGTTGGACTGAA  6 to +14 Exon 2  0.12 Antisense: GGCGGACCTTGGCTGTGT +121 to +104 Exon 2  Sense: AACTCGTTACCTTTCCACTG +83 to +102 Exon 2  1.3 Antisense: GGTTCTGTAGGCGTCCATA +504 to +486 Exon 4  Sense: AACTCGTTACCTTTCCACTG +83 to +102 Exon 2  3.0 Antisense: GGGCCACCATCTTTATCA +796 to +779 Exon 6  Sense: TCGCCAGGGAGGAAGGA +506 to +522 Exon 4  1.7 Antisense: GTCGAGGGGGCTGAAGTAC +774 to +756 Exon 6  Sense: TCAAGGAGAAGCTGCTGGACTA +608 to +629 Exon 6  2.5 Antisense: CATTCTTAACTGGTTTCGGACAC +991 to +969 Exon 7

RNase protection assays were performed as described previously (19) using two in vitro transcribed ³²P-labeled RNA antisense probes, one corresponding to UCP3_L, spanning exons 6 and 7 (+631 to +925 relative to ATG), and the other corresponding to UCP3_S, spanning exon 6 and the immediately adjacent UCP3_S 3UTR (+623 to +900 relative to ATG).

The Genebridge 4 Radiation Hybrid Panel (20-22) was screened for the presence of hUCP3 (Research Genetics, Inc., Huntsville, AL) using the following PCR primer pair: sense = GCGACAGAAAATACAGCGGGACTA (exon 4, cDNA position relative to ATG = +464 to +487) and antisense = GCAAAGGGCTGGTAAAATGAACTG (intron 4, 192 to 169 bp downstream of the exon 4 splice donor). These primers amplified a 269-bp band from human genomic DNA and failed to amplify any signal from control, hamster genomic DNA.

P1 (human and mouse 129/ola) and BAC (mouse 129/SvJ) genomic libraries were screened (Genome Systems, St. Louis, MO) using gene-specific primers shown in Table II (P1 libraries) or a ³²P-labeled mUCP3 cDNA clone (BAC library). P1 and BAC DNA was isolated and analyzed for the presence of UCP2 and UCP3 using PCR (specific primer sets shown in Table II).

Table II. Colocalization of UCP2 and UCP3 within P1 and BAC genomic clones Human P1 genomic clones Mouse P1 genomic clones Mouse BAC genomic clones Plate (well) 324 (H6) 597 (F6) 1159 (G8) 17 51 109 301 37 (L13) 280 (E17) 454 (C10) UCP2 + + + + + + + +   + UCP3 + + + + +   + + + + PCR primers used to detect human and mouse UCP2 and UCP3 Position of primers in cDNA (relative to ATG) Size of amplified PCR product kb Human Sense:     GCCCCGAGCCTTCTACAAA +795 to +813 0.55 UCP2 Antisense: ATCAGGTCAGCAGCAGGAGAG +953 to +933 Human Sense:     GGACTACCACCTGCTCACTG +624 to +643 0.65 UCP3 Antisense: GGGCCACCATCTTTATCAT +796 to +778 Mouse Sense:     GCCCGGGCTGGTGGTGGTC +542 to +560 0.60 UCP2 Antisense: CCCCGAAGGCAGAAGTGAAGTGG +669 to +647 Mouse Sense:     GGTCCCCGCAGCCCCTACAGC +208 to +228 0.55 UCP3 Antisense: AAATCGGACCTTCACCACATC +423 to +402

RESULTS

As shown in Fig. 1, the human UCP3 coding sequence was found to be distributed over six exons (exons 2-7) spanning ~5.25 kb of genomic DNA. To obtain 5 upstream cDNA sequence of human UCP3, 5RACE on human skeletal muscle Marathon cDNA was performed (16). Different clones were obtained and sequenced, and the longest ones were found to contain 183 bp 5 upstream of the ATG. Thus, at least one exon containing UCP3 5-untranslated sequence was detected (exon 1). Sequence analysis indicated that the 3-UTR of UCP3_S and the intron region between exon 6 and the AATAAA_S in intron 6 were identical (see Fig. 1). The protein predicted to be generated by the UCP3_S transcript is truncated by an in-frame stop codon (tga) which follows a preserved glycine (G) codon (GGg) at residue position 275. This glycine codon in UCP3_L (GGA) is located at the splice junction between exons 6 and 7. 

An RNase protection assay probe corresponding to the UCP3_L transcript, spanning exons 6 and 7, was prepared. This probe contained 193 bp of exon 6 sequence and 100 bp of exon 7 sequence. As is shown in Fig. 2, two bands were protected, one of ~290 bp representing UCP3_L and another of ~190 bp representing UCP3_S. Additional RNase protection assays were performed using a probe corresponding to UCP3_S (data not shown). This probe contained 200 bp of exon 6 and 77 bp of adjacent 3 sequence corresponding to the UCP3_S 3-untranslated region (3UTR_S, see Fig. 1). As would be predicted, two protected bands were obtained, one of ~280 bp representing UCP3_S and another of ~200 bp representing UCP3_L (data not shown). Quantitation of RNase protection assay results using in vitro transcribed sense UCP3 transcripts as a standard curve and total RNA extracted from five lean subjects (rectus abdominis muscle) revealed that there were ~15 amol (per µg of total RNA) of UCP3_L transcripts and ~18 amol (per µg of total RNA) of UCP3_S transcripts.

A hUCP3 PCR primer set (see "Experimental Procedures") was applied to the Genebridge 4 Radiation Hybrid Panel (20-22) generating the following data set for hybrid clones 1 through 93 (0 = no amplification, 1 = amplification and 2 = ambiguous results): 1001012001 0000010101 0000010000 0200112000 1110000001 0000100001 0000000000 0100100000 001. These data were submitted to the MIT Center for Genome Research STS mapping server.² UCP3 was mapped to chromosome 11q13 (distal portion), 1.31 cR (lod > 3.0) below framework marker WI-6189. WI-6189 maps to 387.58 cR from the top of the Chr 11 linkage group on the Whitehead Institute Center for Genome Research radiation hybrid map, between framework markers D11S916 (384 cR) and D11S911 (391 cR). D11S916 and D11S911 have also been positioned on the Généthon human genetic linkage map, 85 and 89 cM from the top of the Chr 11 linkage group, respectively (23). It has previously been noted (13) that two ESTs representing UCP2, WI-13873 (accession number R49188) and WI-16720 (accession number T80845), have been independently mapped to this region (385.84 and 387.58 cR, respectively, Whitehead Institute Center for Genome Research). See Fig. 3 for the order of markers in this region and the position of framework markers on the genetic map.

Given the proximity of human UCP2 and UCP3 by radiation hybrid mapping, we investigated whether human UCP2 and UCP3 might be found together on P1 genomic clones. P1 genomic clones generally have genomic inserts of ~75-100 kb. In addition, we also investigated whether mouse UCP2 and UCP3 might be found together on P1 and BAC mouse genomic clones. BAC genomic clones generally have a genomic insert of ~150 kb. Analysis for mUPC3 was possible because we had recently cloned its corresponding cDNA.³ Mouse UCP3 is 87% identical to human UCP3 at the amino acid level,³ but is only 55% identical to mUCP1 and 72% identical to mUCP2. As is shown in Table II, 3 of 3 human P1 clones, 3 of 4 mouse P1 clones, and 2 of 3 mouse BAC clones contained both UCP2 and UCP3. Thus, UCP2 and UCP3 genes in mice and humans are located within 75-150 kb of each other.

DISCUSSION

In the present study we have analyzed the human UCP3 gene. It contains at least 7 exons spread over ~8.5 kb and is located on chromosome 11 (11q13), adjacent to UCP2. The UCP3 gene generates two mRNA transcripts, UCP3_L and UCP3_S, which are predicted to encode long and short UCP3 proteins, differing only by the presence or absence of 37 residues on the C terminus (15). These 37 residues are encoded by exon 7 which is missing from UCP3_S. Intron 6 contains a cleavage and polyadenylation signal (designated AATAAA_S in Fig. 1). The AATAAA_S signal terminates message elongation ~50% of the time, thus generating UCP3_S. When the AATAAA_S signal is bypassed, which seems to occur ~50% of the time, message elongation continues until the AATAAA_L signal (located ~1.1 kb downstream of exon 7) is reached, thus generating UCP3_L.

The domain encoded by exon 7 is highly homologous to C-terminal residues found in UCP1 and UCP2, thus UCP3_S is unique in lacking these residues. Since this region is believed to participate in purine nucleotide-mediated inhibition of UCP1 uncoupling activity (17, 18), UCP3_S may have increased uncoupling activity. Alternatively, UCP3_S could have reduced activity or no activity due to the possible absence of critical residues. The biological significance of UCP3_S will need to be the focus of future investigations.

The human UCP3 gene maps to the distal segment of 11q13, adjacent to UCP2. Human UCP1, on the other hand, is located on chromosome 4 (24). In this context, it is noteworthy that UCP2 and UCP3 are more similar to each other than to UCP1. Both mouse and human UCP2 and UCP3 genes colocalize on P1 and BAC genomic clones, indicating that these two UCPs are within 75-150 kb of each other. Given this and the high degree of similarity between UCP2 and UCP3 (~70% at the nucleotide level), it is likely that one UCP gene arose from the other via a duplication event. However, despite their common origin and similar sequence, the two UCPs are unique, being distinguished by their different patterns of expression and the existence of a short form for UCP3, but not UCP2.³ The close proximity of UCP2 and UCP3 and the similarity in nucleotide sequence have additional implications. Unequal crossovers during meiosis could generate alleles with deletions, duplications, or gene conversions of UCP2 and/or UCP3, as observed with -globin (25), 21-hydroxylase (26), and 11-hydroxylase (27) genes. Also, the close proximity of UCP2 and UCP3 will prevent genetic linkage studies from discriminating between UCP2 and UCP3. Of interest, a prior study mapped mUCP2 to chromosome 7 (13), tightly linked to the tubby mutation. This region is coincident with a quantitative trait locus for obesity in three mouse models (28-30) and one congenic strain (31). Since mUCP2 and mUCP3 are adjacent, it is possible that an abnormality in one or both of these genes is responsible for obesity. In humans, the Bardet-Beidl syndrome (BBS1, MIM#209901) consisting of retinal degeneration, polydactyly, hypogonadism, mental retardation, and obesity has been linked to 11q13 (32-34) (significant lod scores with markers D11S1883 and D11S913, see Fig. 3). However, in this case UCP2 and/or UCP3 are unlikely candidate genes given that they are positioned at least 12 cM distal to BBS1 (no significant linkage between BBS1 and marker D11S916).

In summary, genes for UCP2 and UCP3 are highly homologous and are located in close proximity on chromosome 11q13. UCP3 is distinguished from UCP2 and UCP1, however, by its selective and high level expression in skeletal muscle and the expression of a short form transcript, UCP3_S, generated by a cleavage and polyadenylation signal (AATAAA) located in the last intron. Given its proximity to the UCP2 gene, the mouse UCP3 gene is also coincident with 3 independently mapped quantitative trait loci for obesity (28-30), raising the possibility that abnormalities in UCP3 are responsible for obesity in these models. Thus, human linkage studies for the UCP2/UCP3 locus along with mutational analyses of mouse and human UCP2 and UCP3 genes should be the focus of future investigations.