![]()
|
|
||||||||
(Received for publication, April 21, 1997, and in revised form, July 21, 1997)
From the Cardiovascular Research Institute, University of
California, San Francisco, California 94143-0130
In this study, we have identified and
characterized a new protein present in human high density lipoprotein
that we have designated apolipoprotein L. Using a combination of
liquid-phase isoelectrophoresis and high resolution two-dimensional gel
electrophoresis, apolipoprotein L was identified and partially
sequenced from immunoisolated high density lipoprotein (Lp(A-I)).
Expression was only detected in the pancreas. The cDNA sequence
encoding the full-length protein was cloned using reverse
transcription-polymerase chain reaction. The deduced amino acid
sequence contains 383 residues, including a typical signal peptide of
12 amino acids. No significant homology was found with known
sequences. The plasma protein is a single chain polypeptide
with an apparent molecular mass of 42 kDa. Antibodies raised against
this protein detected a truncated form with a molecular mass of 39 kDa.
Both forms were predominantly associated with immunoaffinity-isolated
apoA-I-containing lipoproteins and detected mainly in the density range
1.123 < d < 1.21 g/ml. Free apoL was not
detected in plasma. Anti-apoL immunoaffinity chromatography was used to
purify apoL-containing lipoproteins (Lp(L)) directly from plasma.
Nondenaturing gel electrophoresis of Lp(L) showed two major molecular
species with apparent diameters of 12.2-17 and 10.4-12.2 nm.
Moreover, Lp(L) exhibited both pre- Epidemiological studies have demonstrated a strong inverse
correlation between the levels of plasma high density lipoproteins (HDL)1 and risk of premature
coronary heart disease (1, 2). However, the mechanisms by which HDL
protect against atherosclerosis need further exploration. One proposed
protective role of HDL involves reverse cholesterol transport (3-5), a
process in which HDL acquire cholesterol from peripheral cells and
facilitate its esterification and delivery to the liver. In this
process, small, relatively lipid-poor HDL particles, termed
pre- A major difficulty in understanding HDL metabolism is the molecular
heterogeneity of HDL (11, 12). Until recently, ultracentrifugation was
the most practical way to purify HDL. This methodology has been the
basis for the vast majority of the studies in this field. However, it
is now well documented that ultracentrifugation causes protein
dissociation and can modify structures of HDL particles (13-15). An
alternative purification strategy that conserves lipoprotein integrity
is immunoaffinity chromatography, which isolates lipoproteins on the
basis of their protein content (15-17). The development of the
strategy of selected affinity immunosorption is particularly suited to
investigation of the protein constituents of lipoprotein complexes
because it permits isolation of the lipoproteins under minimally
perturbing conditions (17). For example, functional components such as
lecithin:cholesterol acyltransferase and cholesterol ester transfer
protein are present in higher concentrations in immunopurified
lipoproteins, whereas they are depleted or absent in ultracentrifugally
purified lipoproteins (12, 15, 18). These observations demonstrate the
importance of immunoaffinity chromatography in identifying novel
HDL-associated proteins of potential physiological significance.
In this study, we employed selected affinity immunosorption and
two-dimensional gel electrophoresis to identify a new protein we have
designated apolipoprotein L (apoL) that is associated with plasma
lipoproteins, predominantly with apoA-I-containing lipoproteins
(Lp(A-I)). We report here the isolation and plasma lipoprotein
distribution of apoL and the cloning and characterization of the
cDNA encoding apoL.
Blood was drawn from fasting
normolipidemic subjects (female and male) and immediately cooled to
4 °C in the presence of preservatives and protease inhibitors
(0.04% EDTA, 0.05% NaN3, 1 µg/ml gentamycin, 0.3 mg/ml
benzamidine, 1 mM phenylmethylsulfonyl fluoride, 0.13% The apoA-I-containing lipoproteins (Lp(A-I)) were isolated by selected
affinity immunosorption (17). Plasma was applied to a selected affinity
anti-apoA-I column. The unbound fraction was eluted with Tris-buffered
saline (5 mM Tris (pH 7.4), 150 mM NaCl, 0.04%
EDTA, and 0.05% NaN3). The Lp(A-I) fraction was eluted
with 0.2 M acetic acid (pH 3) and 0.15 M NaCl.
The eluate was immediately neutralized to pH 7.4 with 2 M
Trizma (Tris base), and preservatives were added as described above.
Finally, Lp(A-I) were passed through protein A-Sepharose and
anti-albumin columns to remove traces of albumin and
immunoglobulins.
The apoL-containing lipoproteins (Lp(L)) were isolated similarly.
First, 200 µg of apoL was purified by electroelution from two-dimensional gels. The purified protein was used to raise rabbit antisera. Antibodies were adsorbed to protein A-Sepharose, and the IgG
fraction was eluted with 0.2 M acetic acid and neutralized with 2 M Tris. The IgG fraction was cross-linked to
CNBr-activated Sepharose (Pharmacia, Uppsala) to construct an anti-apoL
column.
VLDL (d < 1.006 g/ml), IDL (1.006 < d < 1.019 g/ml), LDL (1.019 < d < 1.063 g/ml), HDL2 (1.063 < d < 1.123 g/ml), and HDL3 (1.123 < d < 1.21 g/ml) fractions were isolated from plasma by sequential
ultracentrifugation in a Beckman 40.3 rotor (10 °C, 36,000 rpm,
19 h) (19). Solvent densities were adjusted with anhydrous KBr and
verified by pycnometry. After isolation, lipoproteins were dialyzed
against Tris-buffered saline.
ApoL was purified by a combination
of preparative liquid-phase isoelectric focusing (ROTOFOR, Bio-Rad) and
high resolution two-dimensional gel electrophoresis (20). 200 mg of
Lp(A-I) was fractionated with the ROTOFOR into 20 fractions over a pH range of 3.5-10.0. Fractions of interest were then subjected to two-dimensional gel electrophoresis. After electrophoresis, the proteins were electrotransferred to a polyvinylidene difluoride membrane (Bio-Rad). Proteins were stained with Coomassie Blue, and
individual spots were subjected to N-terminal sequence analysis (Model
473 A, Applied Biosystems, Inc., Foster City, CA) (21). The
amino-terminal sequences were compared with the SWISS-PROT and
GenBankTM data bases (22).
A multiple-tissue Northern blot
(CLONTECH, Palo Alto, CA) was probed, strictly
adhering to the recommended protocol. Each lane contained 2 µg of
highly purified poly(A)+ RNA from various human tissues.
The Northern blot was probed with a synthetic guessmer
(5 We used a reverse transcription-polymerase
chain reaction (PCR)-based cDNA cloning strategy (23) to isolate a
cDNA encoding apoL. RNA was prepared from human pancreas using
a total RNA isolation kit (CLONTECH). mRNA was
purified using an mRNA purification kit (Pharmacia Biotech Inc.).
Single-stranded cDNA was synthesized using 1 µg of human pancreas
mRNA and 500 ng of oligo(dT)-primer 5 10 µl of single-stranded cDNA was used for amplification of apoL
cDNA. The first round of PCR contained 100 ng each of oligo(dT) and
primer 331 (5 A band of 1.3 kilobase pairs, in accordance with the apoL mRNA size
on a Northern blot, was extracted from an agarose gel. A third round of
PCR was carried out using the same primers as the second. The final PCR
product was directly cloned using the pCR-ScriptTM SK(+) cloning kit
(Stratagene, La Jolla, CA). 30 clones were found to have the correct
insert. Both strands were sequenced by chain termination using the
Thermo Sequenase cycle sequencing kit (Amersham Life Science, Inc.).
One-dimensional
SDS-polyacrylamide slab gel electrophoresis (25) was performed
employing 12 or 5-25% gradient polyacrylamide gels and run in a
Bio-Rad minigel system. Samples were boiled in buffer (2% SDS, 67 mM Tris (pH 6.8), 20% glycerol, and 2% mercaptoethanol) for 1 min before loading. Molecular mass markers (Amersham Corp. or
Bio-Rad) were used to calibrate the gels. Gels were stained either with
silver nitrate (26) or with Coomassie Brilliant Blue R-250 (Sigma)
(27).
Two-dimensional gel electrophoresis (20) was performed with 8.5 M urea in the isoelectric focusing gel. The sample
preparation buffer consisted of 9.5 M urea, 0.31% SDS, 2%
Nonidet P-40, 100 mM dithiothreitol, and 2% ampholytes pH
3-10 (Pharmacia). The apparatus used was the IsoDalt system (Hoefer
Scientific Instruments, San Francisco).
Proteins were transferred to nitrocellulose membranes (0.2 µm;
Bio-Rad) (28). The membranes were soaked in 10 mM Tris (pH 7.4) and 0.5 M NaCl with 5% nonfat dry milk and then
incubated for 16 h with antiserum. The blots were washed
extensively in Tris buffer and incubated for 1 h with
horseradish peroxidase-conjugated secondary antibodies. After four
washes, proteins were detected by 4-chloro-1-naphthol.
Pre- To quantify apolipoprotein L in
plasma, we developed a competitive enzyme-linked immunosorbent assay
using IgG purified from rabbit anti-apoL antiserum with purified apoL
as a standard. A series of dilutions of plasma were incubated for
16 h at 4 °C with a constant amount of antibody diluted 4000 times with phosphate-buffered saline. The samples were then added to a
96-well plate coated with immunopurified apoA-I-containing lipoprotein
(500 ng/well) to quantify the uncoupled antibody. After a 1-h
incubation at 23 °C, the plate was washed with phosphate-buffered
saline. Horseradish peroxidase-labeled anti-rabbit IgG was added. After
45 min, the plate was washed, and the substrate
3,3 Through the use of our
minimally perturbing method of anti-apoA-I selected affinity
immunosorption (17), we have identified subspecies of HDL that contain
a new protein that we have designated apolipoprotein L. ApoL was
identified from 200 mg of immunoisolated Lp(A-I) prepared from
normolipidemic human plasma. Lp(A-I) were depleted of albumin by
anti-albumin immunosorption. Because apoA-I is the predominant protein
in the Lp(A-I) fraction, our initial purification step involved
preparative liquid-phase isoelectric focusing. This was followed by
high resolution two-dimensional gel electrophoresis. Fig.
1A shows a typical
fractionation obtained after preparative isoelectric focusing. ApoA-I,
the most predominant band in fraction 6, was greatly depleted in
succeeding fractions. Fractions enriched in apoL (fractions 9-10) were
then submitted to analytical two-dimensional gel electrophoresis, and
the resolved proteins were electrotransferred to polyvinylidene
difluoride membranes (Fig. 1B). Each Coomassie Blue-stained
spot was submitted to N-terminal microsequencing, and their sequences
were compared with known proteins. The first 27 amino acid residues
were identified (Table I). This sequence
was confirmed in 15 samples from three donors. By analytical
two-dimensional gel electrophoresis, two major proteins (Fig.
1B, indicated by arrows) were determined to have
identical N-terminal sequences (Table I). This sequence was compared
with those in the SWISS-PROT and GenBankTM data bases. At this time, no
sequence matching that of apoL was found. However, during this study,
our search for matching sequences revealed the existence of a 143-base
pair expressed tag DNA sequence (clone C22-280), recently cloned from
human chromosome 22 (24), that matched the apoL sequence. This clone
contained 12 amino acid codons upstream of our sequence. Computerized
analysis of the sequence using prediction program (31, 32) indicated
that these 12 amino acids constitute the signal peptide.
Table I.
N-terminal amino acid sequence of apolipoprotein L and comparison with
clone C22-280
Volume 272, Number 41,
Issue of October 10, 1997
pp. 25576-25582
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.
IDENTIFICATION, CLONING, CHARACTERIZATION, AND PLASMA
DISTRIBUTION OF APOLIPOPROTEIN L*

and
electromobility. Apolipoproteins A-I, A-II, A-IV, and C-III were also detected in the
apoL-containing lipoprotein particles.
1-HDL, have been postulated to be the first
acceptors of cholesterol from the cells (4, 6, 7). An additional
mechanism may involve the ability of HDL to impede the oxidation of
other plasma lipoproteins (8-10).
Isolation of Lipoproteins
-amino-n-caproic acid, and 10 µg/ml
2-macroglobulin, final concentrations) (12). Plasma was
separated by centrifugation at 1000 × g for 45 min at
4 °C.
-AIGGGCTTIGACTGGGG(G/A)TCGCCTGT(G/A)TCTGTGCCIGAGGGCACATTCTGCTGCACIC(T/G)GGCGCCAGCCTCCTCC-3
) that corresponds to the first 25 residues of the circulating form of apoL.
-(T)18(A/G/C)(A/G/C/T)-3
with 200 units of
Superscript II RNase H
(Life Technologies, Inc.) in
a volume of 20 µl. The reaction was then diluted to 200 µl for
PCR.
-CACTTTTCCTTGGTGTGAGAGTGAG-3
) in a final volume of 50 µl. The PCR conditions were 40 cycles of denaturation for 30 s
at 95 °C, annealing for 30 s at 55 °C, extension for 1 min at 72 °C, and a final extension for 7 min. An aliquot (0.5 µl) of
this product was used in a second round of PCR using 100 ng each of
oligo(dT) and primer 329 (5
-GAGGAAGCTGGAGCGAGGGTGCAAC-3
) under the
same reaction conditions. Oligonucleotides 329 and 331 were designed
using the expressed tag DNA sequence recently cloned (24).
- and
-HDL were prepared by starch block electrophoresis of
immunopurified Lp(A-I) (29). Briefly, purified potato starch was
hydrated with 50 mM barbital (pH 8.6) and poured into a
Plexiglas form. After removal of excess buffer, the starch formed a
rigid block. The Lp(A-I) sample (10 mg) was loaded onto the cathodic
end, and 200 V was applied across the block. After the lipoprotein had
migrated 20 cm as judged by a dye marker (bromphenol blue), the block
was fractionated into 1-cm segments, and the apoA-I content of each was
determined by immunonephelometry (30). Pre-
- and
-HDL were
recovered from the appropriate fractions, and purity was verified by
immunoelectrophoresis on 1% agarose with anti-apoA-I antibodies.
,5,5
-tetramethylbenzidine was added. Plates were read at 450 nm
using a computer-linked plate reader (Vmax, Molecular Devices, Menlo
Park, CA).
Identification of Apolipoprotein L
Fig. 1.
Apolipoprotein L purification from
Lp(A-I). Lp(A-I) protein (200 mg) was resolved by liquid-phase
isoelectric focusing into 20 fractions representing a pH range of
3.5-10.0. 5 µl of each fraction was then submitted to SDS-PAGE and
silver-stained (A). Fractions 9 and 10 were pooled and
subjected to two-dimensional gel electrophoresis (isoelectric focusing
(IEF)/SDS-PAGE). After electrophoretic transfer to
polyvinylidene difluoride membrane, proteins were visualized by
Coomassie Blue R-250 staining (B). Individual protein spots
were then submitted to microsequencing for identification
(arrows show the localization of apoL and apoA-I). ApoL was
resolved into two components (indicated by arrowheads)
[View Larger Version of this Image (88K GIF file)]
Residues
12
11
10
9
8
7
6
5
4
3
2
11 2 3 4 5 6 7 8 9 101112131415161718192021222324252627282930313233343536
42-kDa
protein
E E A G A R V Q Q N V P S G T D T G D P Q S K P L G D
39-kDa
protein
D W A A G T M D P E
C22-280
clone
M S A L F L G V R V R A E E A G A R V Q Q N V P S G T D T G D P Q S K P L G D W A A G T M D P
We prepared apoL antigen by
two-dimensional gel electrophoresis, isolating 200 µg by gel
electroelution (Fig. 2A). Fig.
2B illustrates the reactivity of rabbit antiserum to
Lp(A-I). Unexpectedly, the antiserum detected two bands with apparent
molecular masses of 42 and 39 kDa. No proteins were detected with
preimmune serum (Fig. 2B). The same pattern was obtained
under nonreducing and reducing conditions, suggesting the absence of
disulfide-bridged subunits. To rule out cross-reaction with other
Lp(A-I) proteins, we analyzed the sequence of the 39-kDa protein
detected by the antiserum. The N terminus of the 39 kDa protein did not
correspond, at this time, to any known protein. Later, we found that
apoL cDNA and part of clone C22-280 (Table I) matched, showing that the 39-kDa protein identified by immunoblotting and amino acid sequence
analysis was a truncated form of mature apoL (42 kDa).
Molecular Cloning and Sequence Analysis of ApoL
To clone apoL
cDNA, we performed a Northern analysis of poly(A)+ RNA
from various human tissues (CLONTECH). A single
mRNA transcript of ~1.3 kilobase pairs was detected in the
pancreas, but not in the heart, brain, placenta, lung, liver, skeletal
muscle, kidney, spleen, thymus, prostate, testis, ovary, small
intestine, colon, or perileukocytes (Fig.
3). The mark between the ovary and testis lanes in the lower right blot is an artifact.
-actin as a control.
Using oligonucleotides 331 and 329, an oligo(dT)-primer, and purified
pancreas mRNA as a template, we were able to amplify a band of
~1.3 kilobase pairs, as expected according to the Northern analysis
(Fig. 3). This was cloned into pCR-ScriptTM SK(+), and both strands
were sequenced. The sequence revealed only one possible open reading
frame, encoding 383 amino acids with a typical signal peptide of 12 residues and a mature protein of 371 amino acids (Fig.
4). The molecular mass of 41,041 Da of
the mature protein agrees with the apparent molecular mass
determined by SDS-PAGE. There was no polyadenylation site in any
clone.
Computer analysis of the predicted sequence indicated a high content of
-helical structure (Fig. 5); four
possible amphipathic helices between residues 93 and 110, 140 and 152, 227 and 243, and 353 and 370 that may be responsible for lipid binding
(Fig. 5); and one possible N-glycosylation site, consensus
sequence NX(S/T)N, at positions 246-249. There are three
threonines (Thr-202, Thr-209, and Thr-292) and one serine (Ser-170)
that are potential O-glycosylation sites. The search for
homology with sequences in the SWISS-PROT and GenBankTM data bases did
not show any significant similarity between apoL and any other known
protein.
) and positively (+) charged
amino acids are indicated.
Apolipoprotein L Is Not Free in Plasma and Is Mainly Associated with Apolipoprotein A-I-containing Lipoproteins
We studied the
distribution of apoL among apoA-I and apoB lipoproteins using selected
affinity immunosorption. The experimental procedure is shown in Fig.
6A. Using successive
anti-apoA-I and anti-apoB columns, we obtained the following fractions:
lipoprotein-deficient plasma, apoA-I-containing lipoproteins (Lp(A-I)),
and apoB-containing apoA-I-deficient lipoproteins (Lp(B w/o A-I)). Fig.
6B shows an immunoblot obtained after SDS-PAGE of 20 µg of
protein from each. The 42-kDa apoL was present as a single reactive
band in Lp(A-I). ApoL was undetectable in the Lp(B w/o A-I) and
lipoprotein-deficient plasma fractions. This result suggests that apoL
is associated chiefly with the apoA-I-containing lipoproteins.
Apolipoprotein L Is Present in a Dense HDL Fraction
The
distribution was also compared among lipoproteins prepared by
ultracentrifugation. VLDL, IDL, LDL, HDL2, and
HDL3 were isolated by conventional sequential
ultracentrifugation. Because this technique is known to disrupt
lipoprotein structure (13-15, 33-35), we attempted to minimize
lipoprotein alteration by submitting each lipoprotein class to
equivalent ultracentrifugal forces as the
2t
product, using the same rotor. Qualitative detection of apoL in the
different subclasses was maximized by immunoblotting samples overloaded
on SDS-polyacrylamide gel (100 µg of each fraction). Only minor
amounts of apoL were detected in VLDL and HDL2. ApoL was
primarily present in HDL3 (1.21 > d > 1.12 g/ml) (Fig. 7A). Because of the long exposure to the substrate, artifact bands (larger
than apoL) were also revealed in IDL and LDL. The quantitative assay
for apoL confirmed this by showing an apoL content in HDL of 2 ± 0.7 µg of apoL/mg of total protein versus 0.13 ± 0.13 µg of apoL/mg of total protein in VLDL (Fig. 7B).
ApoL was also detected in the bottom fraction (d > 1.25 g/ml) in trace amounts.
Immunosorption with an Anti-apolipoprotein L Affinity Gel
To
find the subpopulation of Lp(A-I) containing apoL (Lp(A-I:L)), we
constructed an anti-apoL column using purified anti-apoL IgG. We
isolated apoL-containing lipoproteins (Lp(L)) directly from
normolipidemic plasma. Fig. 8 shows an
SDS gel comparing the bound fraction (Lp(L)) with the apoA-I-containing
lipoproteins. By immunoblotting with specific antiserum, we were able
to detect the presence of apolipoproteins A-I, A-II, A-IV, and C-III
(data not shown). Fractionation of Lp(A-I) into the Lp(A-I:L) and
Lp(A-I w/o L) fractions showed that only ~10% of Lp(A-I) contained
apoL. Nondenaturing PAGE of these particles revealed two major Lp(L) subspecies based on their diameters (Fig.
9). ApoL was mainly distributed in large
apoA-I-containing lipoproteins (12.2-17 and 10.4-12.2 nm) and was
totally absent in the small particles. Moreover, the analysis of Lp(L)
lipoproteins by immunoelectrophoresis revealed
- and
pre-
-migrating components (Fig.
10).
-
and
-migrating lipoproteins. Pre-
- and
-migrating
lipoproteins were isolated by starch block electrophoresis of Lp(A-I)
as described under "Experimental Procedures." The
immunoelectrophoresis of Lp(L) using antisera against apoA-I is shown.
Pure pre-
- and
-migrating HDL were used as standards.
,
-migrating Lp(A-I); pre
,
pre-
-migrating Lp(A-I).
We have reported here the identification, characterization, and cloning of a new human apolipoprotein that we have designated apolipoprotein L. This new apolipoprotein is mainly associated with the apoA-I-containing lipoproteins of plasma.
High density lipoproteins comprise a number of molecular subspecies that differ with respect to protein and lipid composition, particle morphology, and size. The numerous HDL molecular species are not fully apparent when HDL is prepared by ultracentrifugation. Hydrostatic pressure developed in the ultracentrifuge causes the dissociation of a portion of the complement of apolipoproteins (such as apolipoproteins A-I, A-II, C, and E) from HDL and leads to concomitant protein and lipid rearrangements (13-15, 33-35). The contents of proteins such as lecithin:cholesterol acyltransferase and cholesterol ester transfer protein shown to interact and to form physical complexes with apoA-I-containing lipoproteins are diminished or totally depleted in HDL altered by ultracentrifugal isolation (15, 18). Thus, ultracentrifugation hinders identification of the molecular species of HDL and characterization of their constituent proteins.
Since first proposed by Alaupovic (16), numerous studies have shown the importance of immunoaffinity fractionation of lipoproteins. The development of the strategy of selected affinity immunosorption permits the isolation of native lipoprotein complexes with minimal perturbation (17), avoiding the loss of protein constituents that dissociate during isolation by ultracentrifugation (13-15, 33-35). In this study, we combined liquid-phase isoelectric focusing and high resolution two-dimensional gel electrophoresis to surmount the problem posed by the predominance of apoA-I in the immunoisolated Lp(A-I) fractions that would otherwise hinder purification of proteins present at lower concentrations.
ApoL isolated from the Lp(A-I) particles was observed in two forms: 42 and 39 kDa (minor form) (Fig. 1). The truncated species could represent a proteolytically activated form of the protein, as is the case for several other plasma apolipoproteins (36, 37). If so, the putative precursor form (42 kDa) represents the main constituent. So far, we have not been able to determine if this truncation occurs in vivo or during isolation.
Recently, Trofatter et al. (24) published an expressed sequence tag (clone C22-280, human chromosome 22) that matched the N-terminal sequence we had found for apoL. This sequence revealed 12 residues upstream of the first amino acid of the plasma form of apoL. Since this structure is typical of a signal peptide (38) and since the cDNA sequence of apoL reveals only one possible open reading frame and encodes a mature protein of 371 amino acids with a molecular mass of 41,041 Da, in agreement with the experimental value, we propose that these 12 residues (starting with a methionine) represent the signal peptide of apoL. Therefore, the cDNA presented in this report encodes the full-length apoL protein.
The analysis of apoL cDNA (32) reveals one putative N-glycosylation site (246NISN249) and several candidate serine and threonine residues for O-glycosylation. Post-transcriptional modifications at these sites could explain the charge isoforms of apoL found in plasma (Fig. 1).
Because we did not find any significant homology between the apoL sequence and any present in SWISS-PROT or GenBankTM (22), it is not yet possible to predict any function of apoL based on homologies. However, the transcription of apoL mRNA by the pancreas suggests a very specific function, possibly enzymatic, in lipid metabolism. Indeed, preliminary data (not shown) seem to indicate a positive correlation between plasma levels of apoL and plasma triglyceride levels.
Analysis of the secondary structure of apoL (31) reveals four possible amphipathic helices (Fig. 5). These would confer a high level of lipophilicity, in agreement with our finding of very little detectable free apoL in plasma. That apoL in plasma is entirely bound to lipoproteins and remains associated with them during exposure to large volumes of buffer during column washing supports the view that it has very high affinity for HDL. Hence, it should be regarded as a true apolipoprotein rather than a plasma protein that exists partially in a lipoprotein-associated form such as haptoglobin. This is the basis of our designating it an apolipoprotein.
ApoL, with a mean plasma concentration of 5.9 ± 0.9 µg/ml (n = 5), is a marker for a distinct subpopulation of HDL. Indeed, apoL was found almost exclusively in association with apoA-I in lipoproteins prepared by immunoaffinity chromatography (Fig. 6). Moreover, the presence of apoL in plasma lipoproteins isolated by ultracentrifugation and its localization to HDL3 (Fig. 7A) corroborate results obtained by immunoaffinity chromatography. Because of close association between apoA-I and apoL and because it is well known that lipoprotein integrity is better preserved by immunoaffinity isolation, we used the latter methodology to isolate specific lipoprotein subpopulations containing apoL. In agreement with our previous data, the apoL-containing lipoproteins (Lp(L)) contained apoA-I (Fig. 8). Moreover Lp(L) exhibited diameters typical of HDL (Fig. 9). However, it is interesting to note the discordance of the data between HDL purified by ultracentrifugation and the lipoprotein purified by immunoaffinity, showing the protein redistribution occurring during ultracentrifugation (13-15, 33-35). We found apoL to be preponderantly in HDL3; however, the Lp(L) particles isolated by selected immunosorption exhibited heterogeneity of size. ApoL was chiefly associated with large HDL particles (Fig. 9). Fig. 9 also shows the existence of a very large apoL-containing lipoprotein corresponding to VLDL. Due to their low content in Lp(L) particles, these minor populations were not detectable by immunoblotting of apoB-containing lipoprotein (Fig. 7), but were only measurable by enzyme-linked immunosorbent assay. Fig. 7B shows the amount of apoL relative to the amount of total protein in the lipoprotein. The apoL content of HDL was >10 times higher than that in VLDL. No apoL was detectable in LDL. Apparently due to protein dissociation during ultracentrifugation, we also found apoL in the fraction of d > 1.25 g/ml. Moreover, apoA-II, apoA-IV, and apoC-III were also detected in Lp(L) (data not show), indicating, as for other subclasses of HDL, the presence of a complex protein complement in Lp(L).
Populations of HDL designated as pre-
-HDL have been postulated as
serving key roles in reverse cholesterol transport (4, 6, 39). One,
pre-
1-HDL, appears to act as the initial acceptor of
cellular unesterified cholesterol (6). In this study, we showed that a
subpopulation of apoL-containing lipoproteins also exhibits pre-
mobility (Fig. 10), possibly belonging to the larger pre-
2- or pre-
3-HDL particle
populations.
In summary, we have reported in this study the nucleotide and deduced amino acid sequences for a new human apolipoprotein that we have designated apolipoprotein L. This is the first apolipoprotein shown to be secreted by the pancreas. Its origin in that organ may reflect a non-insulin-dependent role of the pancreas in lipid metabolism. This new apolipoprotein is found in plasma, mainly associated with apoA-I-containing lipoproteins. Moreover, apoL-containing lipoproteins clearly define new HDL subspecies. Since no sequence homology was found with any known protein, its function cannot be inferred on a structural basis.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF019225.
To whom correspondence should be addressed. Tel.: 415-476-1155;
Fax: 415-476-2283.
This article has been cited by other articles:
![]() |
M. P. Molina-Portela, M. Samanovic, and J. Raper Distinct roles of apolipoprotein components within the trypanosome lytic factor complex revealed in a novel transgenic mouse model J. Exp. Med., August 4, 2008; 205(8): 1721 - 1728. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Wan, S. Zhaorigetu, Z. Liu, R. Kaini, Z. Jiang, and C.-a. A. Hu Apolipoprotein L1, a Novel Bcl-2 Homology Domain 3-only Lipid-binding Protein, Induces Autophagic Cell Death J. Biol. Chem., August 1, 2008; 283(31): 21540 - 21549. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Vanhollebeke, G. De Muylder, M. J. Nielsen, A. Pays, P. Tebabi, M. Dieu, M. Raes, S. K. Moestrup, and E. Pays A Haptoglobin-Hemoglobin Receptor Conveys Innate Immunity to Trypanosoma brucei in Humans Science, May 2, 2008; 320(5876): 677 - 681. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-i. Kawada, H. Kimura, Y. Kamachi, K. Nishikawa, M. Taniguchi, K. Nagaoka, H. Kurahashi, S. Kojima, and T. Morishima Analysis of gene-expression profiles by oligonucleotide microarray in children with influenza J. Gen. Virol., June 1, 2006; 87(6): 1677 - 1683. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. W. Oli, L. F. Cotlin, A. M. Shiflett, and S. L. Hajduk Serum Resistance-Associated Protein Blocks Lysosomal Targeting of Trypanosome Lytic Factor in Trypanosoma brucei Eukaryot. Cell, January 1, 2006; 5(1): 132 - 139. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Shiflett, J. R. Bishop, A. Pahwa, and S. L. Hajduk Human High Density Lipoproteins Are Platforms for the Assembly of Multi-component Innate Immune Complexes J. Biol. Chem., September 23, 2005; 280(38): 32578 - 32585. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Perez-Morga, B. Vanhollebeke, F. Paturiaux-Hanocq, D. P. Nolan, L. Lins, F. Homble, L. Vanhamme, P. Tebabi, A. Pays, P. Poelvoorde, et al. Apolipoprotein L-I Promotes Trypanosome Lysis by Forming Pores in Lysosomal Membranes Science, July 15, 2005; 309(5733): 469 - 472. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. S. E. Albert, P. N. Duchateau, S. S. Deeb, C. R. Pullinger, M. H. Cho, D. C. Heilbron, M. J. Malloy, J. P. Kane, and B. G. Brown Apolipoprotein L-I is positively associated with hyperglycemia and plasma triglycerides in CAD patients with low HDL J. Lipid Res., March 1, 2005; 46(3): 469 - 474. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Liu, H. Lu, Z. Jiang, A. Pastuszyn, and C.-a. A. Hu Apolipoprotein L6, a Novel Proapoptotic Bcl-2 Homology 3-Only Protein, Induces Mitochondria-Mediated Apoptosis in Cancer Cells Mol. Cancer Res., January 1, 2005; 3(1): 21 - 31. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. Regard, S. Scheek, T. Borbiev, A. A. Lanahan, A. Schneider, A.-M. Demetriades, H. Hiemisch, C. A. Barnes, A. D. Verin, and P. F. Worley Verge: A Novel Vascular Early Response Gene J. Neurosci., April 21, 2004; 24(16): 4092 - 4103. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Mimmack, M. Ryan, H. Baba, J. Navarro-Ruiz, S. Iritani, R. L. M. Faull, P. J. McKenna, P. B. Jones, H. Arai, M. Starkey, et al. Gene expression analysis in schizophrenia: Reproducible up-regulation of several members of the apolipoprotein L family located in a high-susceptibility locus for schizophrenia on chromosome 22 PNAS, April 2, 2002; 99(7): 4680 - 4685. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. N. Duchateau, C. R. Pullinger, M. H. Cho, C. Eng, and J. P. Kane Apolipoprotein L gene family: tissue-specific expression, splicing, promoter regions; discovery of a new gene J. Lipid Res., April 1, 2001; 42(4): 620 - 630. [Abstract] [Full Text] |
||||
![]() |
G. CANDIANO, L. MUSANTE, M. CARRARO, L. FACCINI, L. CAMPANACCI, C. ZENNARO, M. ARTERO, F. GINEVRI, F. PERFUMO, R. GUSMANO, et al. Apolipoproteins Prevent Glomerular Albumin Permeability Induced In Vitro by Serum from Patients with Focal Segmental Glomerulosclerosis J. Am. Soc. Nephrol., January 1, 2001; 12(1): 143 - 150. [Abstract] [Full Text] |
||||
![]() |
P. N. Duchateau, I. Movsesyan, S. Yamashita, N. Sakai, K.-I. Hirano, S. A. Schoenhaus, P. M. O'Connor-Kearns, S. J. Spencer, R. B. Jaffe, R. F. Redberg, et al. Plasma apolipoprotein L concentrations correlate with plasma triglycerides and cholesterol levels in normolipidemic, hyperlipidemic, and diabetic subjects J. Lipid Res., August 1, 2000; 41(8): 1231 - 1236. [Abstract] [Full Text] |
||||
![]() |
N. Xu and B. Dahlback A Novel Human Apolipoprotein (apoM) J. Biol. Chem., October 29, 1999; 274(44): 31286 - 31290. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J.G. Horrevoets, R. D. Fontijn, A. J. van Zonneveld, C. J.M. de Vries, J. W. ten Cate, and H. Pannekoek Vascular Endothelial Genes That Are Responsive to Tumor Necrosis Factor-{alpha} In Vitro A |