Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jbilo, O.
Right arrow Articles by Casellas, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jbilo, O.
Right arrow Articles by Casellas, P.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 43, Issue of October 24, 1997 pp. 27107-27115
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Purification and Characterization of the Human SR 31747A-binding Protein
A NUCLEAR MEMBRANE PROTEIN RELATED TO YEAST STEROL ISOMERASE*

(Received for publication, June 19, 1997, and in revised form, August 13, 1997)

Omar Jbilo Dagger §, Hubert Vidal Dagger §, Raymond Paul Dagger , Nathalie De Nys Dagger , Mohammed Bensaid Dagger , Sandra Silve , Pierre Carayon Dagger , Danielle Davi Dagger , Sylvaine Galiègue Dagger , Bernard Bourrié Dagger , Jean-Claude Guillemot , Pascual Ferrara , Gérard Loison , Jean-Pierre Maffrand par , Gérard Le Fur ** and Pierre Casellas Dagger Dagger Dagger

From Dagger  Sanofi, 371 rue du Pr. Joseph Blayac, 34184 Montpellier cedex 04,  Sanofi, Voie no. 1, BP 137, 31676 Labège cedex, par  Sanofi, 195 route d'Espagne, 31036 Toulouse cedex, and ** Sanofi, 32-34 rue Marbeuf, 75374 Paris cedex 08, France

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES


ABSTRACT

SR 31747A, defined as a sigma ligand, is a novel immunosuppressive agent that blocks proliferation of human and mouse lymphocytes. Using a radiolabeled chemical probe, we here purified a target of SR 31747A and called it SR 31747A-binding protein (SR-BP). Purified SR-BP retained its binding properties and migrated on SDS-polyacrylamide gel as a Mr 28,000 protein. Cloning of the cDNA encoding human SR-BP shows an open reading frame for a 223-amino acid protein, which is homologous to the recently cloned sigma 1 receptor. Interestingly, the deduced amino acid sequence was found to be related to fungal C8-C7 sterol isomerase, encoded by the ERG2 gene. The ERG2 gene product has been identified recently as the molecular target of SR 31747A that mediates antiproliferative effects of the drug in yeast. Northern blot analysis of SR-BP gene expression revealed a single transcript of 2 kilobases which was widely expressed among organs, with the highest abundance in liver and the lowest abundance in brain. Subcellular localization analysis in various cells, using a specific monoclonal antibody raised against SR-BP, demonstrated that this protein was associated with the nuclear envelope. When studying the binding of SR 31747A on membranes from yeast expressing SR-BP, we found a pharmacological profile of sigma 1 receptors; binding was displaced by (+)-pentazocine, haloperidol, and (+)-SKF 10,047, with (+)-SKF 10,047 being a more potent competitor than (-)-SKF 10,047. Scatchard plot analysis revealed Kd values of 7.1 nM and 0.15 nM for (+)-pentazocine and SR 31747A, respectively, indicating an affinity of SR-BP 50-fold higher for SR 31747A than for pentazocine. Additionally, we showed that pentazocine, a competitive inhibitor of SR 31747A binding, also prevents the immunosuppressive effect of SR 31747A. Taken together, these findings strongly suggest that SR-BP represents the molecular target for SR 31747A in mammalian tissues, which could be critical for T cell proliferation.


INTRODUCTION

Sigma receptors, initially identified by Martin et al. (1) as a subclass of opiate receptors, were characterized by Su (2, 3) in guinea pig brain. They were subsequently found to be distributed in a variety of distinct regions of the central nervous system (4), as well as in endocrine-related structures (5), gastrointestinal tract (6), liver (7), and kidney (8). Sigma receptors were further identified in human peripheral blood mononuclear cells (9-12), and their presence was confirmed in rat spleen. The biological significance of sigma receptors in the immune system is poorly understood. However, Liu et al. (12), using a panel of sigma ligands, demonstrated a high correlation between drug binding potency at sigma sites and inhibition of splenocyte proliferation, suggesting that sigma receptors may function as immunoregulators.

SR 31747A was first described by Paul et al. (13) as a ligand able to compete with a very high potency with all known sigma ligands and to inhibit mitogen-induced mouse and human T cell proliferation with a potency similar to that of cyclosporin A (14). However, unlike cyclosporin A, SR 31747A does not alter early cellular events, but rather interferes at steps further along the pathway leading to proliferation, most probably during the S phase (14).

Multiple receptors have been described (8, 15-19). Sigma 1 designates a high affinity binding site, which is stereoselective for (+)-optical enantiomers of pentazocine, SKF 10,047, and 3-(3-hydroxyphenyl)-N-(1-propyl)-piperidine (3-PPP).1 Sigma 2 refers to a site that binds these drugs with lower affinity, and which is selective for (-)-optical enantiomers of pentazocine, SKF 10,047, and 3-PPP. A lower affinity sigma 3 site has been reported in rat and guinea pig brain (20). More recently, a novel binding site was discovered that binds all sigma ligands with two notable exceptions: haloperidol and 1,3-di(2-tolyl)guanidine (21, 22).

Pharmacological studies with SR 31747A cannot discriminate among sigma 1, sigma 2, sigma 3, and the novel sigma/opioid binding sites since multiple types of sigma receptors can coexist on cells (19). Moreover, the cross-reactivity of many drugs that bind with high affinity to other receptors has impeded efforts to define precisely the sites for SR 31747A binding.

Recently, we examined the effect of this drug in the yeast Saccharomyces cerevisiae. We showed that SR 31747A arrested cell proliferation by inhibiting an enzyme of the sterol biosynthetic pathway, namely C8-C7 sterol isomerase (23).

In the present work, we undertook a biochemical characterization of a molecular entity that specifically binds SR 31747A using [3H]SR 31747A as the specific probe and the human T leukemia cell line Ichikawa as the biological source. We purified the protein carrying the SR 31747A binding site and cloned the corresponding cDNA, which was shown to be homologous to the yeast ERG2 gene. Expression of SR-BP cDNA in yeast S. cerevisiae led to high affinity binding sites for SR 31747A indistinguishable from mammalian sites. We also present the tissue distribution and subcellular localization and discuss the structural features of this receptor and its possible functions.


MATERIALS AND METHODS

Reagents

[3H](+)-Pentazocine (NET 1056-1550 GBq/mmol) was supplied by NEN Life Science Products (Paris, France). SR 31747A, (Z)-N-cyclohexyl-N-ethyl-3-(3-chloro-4-cyclohexylphenyl)-propen-2-ylamine hydrochloride, and [3H]SR 31747A (2109 GBq/mmol) were synthetized by Sanofi Recherche. 1,3-di(2-tolyl)guanidine, (+)-3-PPP, (-)-3-PPP, (+)-SKF 10,047, (-)-SKF 10,047, and (+)- and (-)-pentazocine were supplied by Research Biochemicals Inc. (Natick, MA). Digitonin, haloperidol, ifenprodil, and the anti-bleaching reagent DABCO were supplied by Sigma. Fenpropimorph and tridemorph were a generous gift of Dr. A. Akers (BASF Aktiengesellshaft, Limburgerhof, Germany). LH2O, DEAE-Sepharose, Mono Q HR 10/10, Superdex 200 HR, and CNBr-Sepharose 4B were purchased from Pharmacia (Orsay, France). Q Hyper D column was from Biosepra (Frankfurt, Germany).

Strains, Media, and Growth Conditions

EMY43 (MATalpha , ura3Delta , trp1-4, erg2::TRP1) and EMY47 (MATalpha , ura3Delta , trp1-4, erg2::TRP1, fen1::LEU2) were isogenic derivatives of S. cerevisiae wild type FL100 (ATCC-28383). C13-ABYS86 (EMY761, MATalpha , ura3Delta 5 leu2-3 leu2-112 his3 pra1 prb1 prc1 cps1) was kindly provided by Heinemeyer et al. (24). Yeast culture media were YPD medium and synthetic minimal (SD) medium containing 2% glucose (25). Anaerobic conditions were obtained using an anaerobic glove box (La Calhène, Vélizy, France) under N2-H2-CO2 (85-10%-5%) atmosphere. For anaerobic growth, media were supplemented with 0.1% Tween 80 and 50 mg/liter ergosterol.

Drug Binding Assay

SR 31747A Binding Assays on Soluble Receptor

To monitor SR 31747A binding activity during the purification process, a SR 31747A binding assay on soluble receptor was developed. Briefly, 2 nM [3H]SR 31747A was incubated with 10 to 50 µl of each fraction in a final volume of 250 µl in 50 mM Tris-HCl, pH 7.4, 0.1% BSA for 30 min at 20 °C. Separation of bound from free ligands was obtained by gel filtration with a 1-ml LH 20 column. Samples (200 µl) were loaded onto the column and eluted with 1.8 ml of 50 mM Tris-HCl, pH 7.4. The 2-ml volume containing bound [3H]SR 31747A was mixed with 10 ml of scintillation liquid and counted for radioactivity.

In competition studies using purified receptor, various concentrations (0.4-1000 nM) of unlabeled ligands were incubated for 2 h at 20 °C with 1 nM [3H]SR 31747A in 500 µl of binding buffer (50 mM Tris-HCl, pH 7.4, containing 0.1% BSA, 0.02% digitonin, 0.02% Tween 20). For saturation analysis, purified receptor was incubated for 2 h at 20 °C with increasing concentrations of [3H]SR 31747A (0.03-3 nM) in the presence or absence of 1 µM SR 31747A in binding buffer.

SR 31747A Binding Studies on Yeast Cell Membranes

Yeast cells were treated with zymolyase as described previously (26) and homogenized at 4 °C in 50 mM Tris-HCl buffer, pH 8.0, for membrane preparation. Receptor binding assays for [3H](+)-pentazocine and [3H]SR 31747A were performed according to the methods described by Paul et al. (13).

Purification of the Human SR 31747A-binding Protein (SR-BP)

Human T leukemia Ichikawa cells (2 × 1010 cells) were suspended in 200 ml of a buffer containing 70 mM sucrose, 210 mM D-mannitol, 2 mM EDTA, 1 mM 4-(2-aminoethyl-1)-phenylsulfonyl fluoride, and 2 mM Hepes, pH 7.4, then homogenized using a Turrax homogenizer. The crude homogenate was centrifuged at 650 × g for 20 min, and the supernatant was further centrifuged at 100,000 × g for 1 h. The membrane-containing pellet was solubilized at 10 mg/ml in 50 mM Tris-HCl, pH 7.4, 1 mM 4-(2-aminoethyl-1)-phenylsulfonyl fluoride, 2% digitonin. The suspension was centrifuged at 100,000 × g for 30 min, and the supernatant was then subjected to chromatography successively on DEAE-Sepharose column (2.5 × 11 cm), Mono Q column (1 × 10 cm), Q Hyper D column (0.5 × 10 cm), and then Superdex 200 HR column (1 × 30 cm). These columns were pre-equilibrated with TDG buffer (50 mM Tris-HCl, pH 7.4, and 0.1% digitonin). Bound proteins were eluted with linear NaCl gradient (0-500 mM) in TDG buffer. Peak fractions containing SR 31747-binding protein were monitored by [3H]SR 31747 binding activity. Purified binding activity from 200 HR column was used for generation of specific antibodies as described below.

To immunopurify SR-BP, active peak from the DEAE-Sepharose was loaded onto a 2-ml column of anti-SR-BP Sepharose obtained by coupling purified monoclonal anti-SR-BP antibody (see below) to CNBr-activated Sepharose (ratio: 0.5 mg of proteins/ml of Sepharose). Bound proteins were eluted with 0.1 M glycine pH 3.0, 0.5 M NaCl, 0.02% digitonin. The fractions containing binding activity were neutralized to pH 7.0 with 1 M Tris-HCl and concentrated for further analysis.

Anti-SR-BP Monoclonal Antibody Obtention

Positive fractions from Q Hyper D chromatography were incubated with 2 nM [3H]SR 31747A for 2 h at 20 °C and chromatographed on Superdex 200 HR as described above. Fractions containing the maximum radioactivity were pooled and used as tritiated SR-BP ([3H]SR-BP) for antibody screening.

Three mice were immunized by subcutaneous injection of 10 µg of proteins of enriched SR-BP preparation from Superdex 200 HR chromatography in Freund's complete adjuvant. On days 30 and 60, mice were boosted with 10 µg of proteins in incomplete Freund's adjuvant. Sera were collected on days 38 and 68, diluted to 100 µl in PBS buffer containing 0.1% BSA and 0.1% Tween 20, and then incubated for 16 h at 4 °C with 100 µl of solution containing 5000 dpm of [3H]SR-BP. Separation of free and bound antibodies was obtained by addition of 1 ml of 20% polyethylene glycol 4000, followed by a centrifugation at 4000 × g. The pellet containing bound antibodies was dissolved in 1 ml of PBS mixed with 10 ml of scintillation liquid and counted for radioactivity.

For the production of monoclonal antibodies, 3 days before fusion, mice were boosted intravenously with 10 µg of proteins. Splenocytes were collected and fused with P3 × 63Ag8.653 mouse myeloma cells. Screening for anti-SR-BP antibodies was performed using [3H]SR-BP. Antibodies were produced in mice and purified from ascitic fluid by affinity chromatography on protein A-Sepharose.

Electrophoresis and Immunoblot

SDS-PAGE was performed according to Laemmli (27). Proteins were transferred electrophoretically to nitrocellulose membrane. The membrane was incubated for 1 h at 20 °C in 5% nonfat dry milk in 0.1% Tween 20, 150 mM NaCl, 20 mM Tris-HCl, pH 7.4, then for 1 h at 20 °C with monoclonal antibody at 0.5 µg/ml in the same buffer. Peroxidase-conjugated goat anti-mouse antibodies were added, and protein detection was performed with ECL kit (Amersham) as described in the manufacturer's protocol.

Partial Amino Acid Sequencing of SR-BP

Immunopurified SR-BP was subjected to SDS-PAGE. After gel staining with Coomassie Blue G-250, the 28-kDa band was cut out and subjected to trypsin hydrolysis, which generated six distinct peptides. Edman's degradation was performed using an Applied Biosystems model 477A pulse-liquid sequenator connected on line to an RP-HPLC unit (model 120A, Applied Biosystems) (28).

Molecular Cloning of Human SR-BP cDNA

Two degenerate oligonucleotides were designed based on the amino acid sequence of the longer peptide (these were derived from GARGTNTTYTAYCCIGGIGARAC (sense) and from CATVCANGTRTTIGGICCCCAYTC (antisense)) (Fig. 3). PCR was performed using 100 ng of first strand cDNA prepared from Daudi mRNA. The 80-bp PCR product was further subcloned into PGEM-T vector (Promega, Madison, WI) and sequenced. Two matched antisense primers (AS1: 5'-GCCCCACTCCACAGCTGTTGCCTC-3'; AS2: 5'-ACCAGGCCCGTGTACTACCGTCTC-3') complementary to the middle of the sequence were used to amplify the 5' end of cDNA with the RACE system (Life Technologies, Inc.). A PCR product of about 320 bp was subcloned into PGEM-T and sequenced. This DNA fragment was used as a probe to screen a Daudi lambda  UniZAP XR cDNA library. The longest isolated clone was fully sequenced, and sequence analyses were performed with Blast (29). Amino acid sequence alignment was produced by the clustal W program.


Fig. 3. Sequence of human SR-BP cDNA and its encoded protein. The deduced protein sequence of human SR-BP is shown below the cDNA sequence. The numbers on the left refer to the nucleotide sequence; numbers on the right refer to the amino acid sequence. The underlined sequences indicate the tryptic peptides. The ATG of the open reading frame and the consensus polyadenylation signal (AATAAA) are in bold letters. The asterisk denotes the termination codon.

[View Larger Version of this Image (99K GIF file)]


Expression of SR-BP cDNA in S. cerevisiae

The open reading frame of SR-BP was cloned by PCR amplification using two oligonucleotides, A and B. The oligonucleotide sequence of A (forward, BamHI, SalI) was as follows: ATCAGGATCCGTCGACAACATGCAATGGGCTGTTGGTAGACGGTGGGCGTGGGCC) and corresponded to the first 12 codons of SR-BP with some modifications at the DNA level to improve mRNA translation. The oligonucleotide sequence of B (reverse, BamHI, XbaI) corresponded to positions +662 to +684 (relative to the first base of the initiation codon). The amplified DNA fragment was cloned between the SalI and BamHI sites of the pEMR1023 polylinker (23) to yield pEMR1499, a multicopy E. coli-S. cerevisiae shuttle vector containing URA3 as the selective marker. The SR-BP open reading frame was expressed under the control of the PGK promoter.

Northern Blot Analysis

The expression of SR-BP mRNA in human tissues was examined by Northern blot analysis using membranes purchased from CLONTECH (Palo Alto, CA). Hybridization was carried out in Church buffer (30) with a 32P-labeled 300-bp probe specific for SR-BP cDNA. Autoradiography was performed overnight with an intensifying screen.

Analysis of Subcellular Localization of SR-BP by Confocal Microscopy

Cells were fixed overnight with 1% formaldehyde at 4 °C, washed once in PBS, and permeabilized for 10 min with a solution of 0.1% saponin in PBS containing 1% BSA. Biotinylated conjugated anti-SR-BP mAb, and anti-mitochondria M117 or anti-nuclear membrane AE-5 mAbs (Leinco Technologies Inc., St. Louis, MO) were simultaneously incubated with cells in the 0.1% saponin, 1% BSA solution for 30 min at room temperature. After two washes, cells were simultaneously incubated for 30 min with fluorescein isothiocyanate-conjugated goat anti-mouse IgG1 Abs (Southern Biotechnology Inc., Birmingham, AL) to stain M117 or AE-5 mAbs, and with Cy5-conjugated streptavidin (from Jackson Immunoresearch, West Grove, PA) to stain biotinylated conjugated anti-SR-BP mAb. Cell pellets were resuspended in 20 µl of glycerol containing the anti-bleaching reagent DABCO at 50 mg/ml. A laser-scanning confocal microscope (LSM410, Zeiss, Oberkochen, Germany) equipped with a planapo oil (× 63) immersion lens (numerical aperture = 1.4) was used to analyze the three-dimensional distribution of SR-BP as described previously (31).

In Vitro Lymphocyte Proliferation

Mouse splenocytes were cultured in 96-well flat-bottomed plates in quadruplicate at 4 × 105 cells/well with 1 µg/ml staphylococcal enterotoxin B. Cells were cultured in complete medium for 4 days in the presence of various concentrations of SR 31747A or (+)-pentazocine, then pulsed with 1 µCi/well [3H]thymidine (Amersham, les Ulis, France), and harvested 4 h later on glass fiber papers using a Skatron harvester system (Pharmacia). Incorporated radioactivity was measured by using a Betaplate liquid scintillation spectrometer (Pharmacia).


RESULTS

Purification of Human SR-BP

Results of SR-BP purification from human T leukemia Ichikawa cells are summarized in Table I. From the solubilized membrane preparation, the binding activity was eluted as a single peak with DEAE anion exchange chromatography. A straightforward enrichment of SR-BP was obtained using Mono Q gel followed by Q Hyper D gel. The apparent size of SR-BP determined by gel filtration gave a value of approximately 100 kDa (Fig. 1), whereas electrophoresis revealed several bands between 80 and 100 kDa and a band close to 30 kDa (Fig. 2, lane 5). At this stage, the enriched SRBP preparation was used to immunize animals to generate specific monoclonal antibodies against SR-BP for further purification.

Table I. Purification of SR-BP from Ichikawa T cells


Purification stepsa Proteins
[3H]SR 31747A bindingb
Recovery Recovery Purification factor Kdc

mg protein % pmol/mg %
SDGa 560 100 3.2 100 1
DEAE 76 13.0 7.7 32 2.4
Mono Q 16 2.8 21 19 6.6
Q Hyper D 1.4 0.25 153 12 48
200 HR 0.19 0.068 510 5.4 160 0.24  ± 0.05
Anti-SRBP Sepharosed 0.018 0.0032 2925 3.0 914 0.22  ± 0.04

a Purification steps were as follows: SDG, crude supernatant of membrane solubilization by digitonin; DEAE, pooled active fractions from DEAE Sepharose column; Mono Q, pooled active fractions from Mono Q column; Q Hyper D, pooled active fractions from Q Hyper D column; HR 200, pooled active fractions from Superdex HR 200 column; anti-SR-BP-Sepharose, pooled active fractions from the affinity anti-SR-BP column.
b [3H]SR 31747A binding was determined as described under "Materials and Methods."
c Scatchard analysis of specific [3H]SR 31747A binding to purified fractions; purified HR200 fraction (450 ng/ml) or immunopurified fraction (144 ng/ml) were incubated for 2 h at 20 °C with [3H]SR 31747A (0.03-3.0 nM). Nonspecific binding was determined in the presence of 1 µM SR 31747A.
d Direct purification from DEAE fraction using anti-SR-BP antibody.


Fig. 1. Superdex HR 200 chromatography. The active fractions from Q Hyper D were pooled, concentrated, and passed through a Superdex HR200 column, either directly, the fractions being assayed for [3H]SR 31747A binding (open circle ), or after a 2-h preincubation with 20 nM [3H]SR 31747A, after which the radioactivity was measured in each fraction (down-triangle). The arrows indicate the elution positions of molecular size markers: 1, ferritin (440 kDa); 2, catalase (232 kDa); 3, aldolase (158 kDa); 4, bovine serum albumin (67 kDa); 5, ovalbumin (43 kDa).

[View Larger Version of this Image (26K GIF file)]



Fig. 2. SDS-PAGE during SR-BP purification. Lane 1, molecular size markers; lane 2, digitonin-solubilized membrane (40 µg); lane 3, DEAE-Sepharose fraction (20 µg); lane 4, Mono Q-Sepharose fraction (20 µg); lane 5, Q Hyper D fraction (6 µg); lane 6, HR 200 fraction (3 µg); lane 7, affinity fraction (1 µg). The gel (12% acrylamide) was stained with Coomassie Blue; lane 8, immunoblot of the immunopurified fraction.

[View Larger Version of this Image (86K GIF file)]


We developed a screening test for antibody detection, taking advantage of the fact that the binding of [3H]SR 31747A to partially purified SR-BP was not dissociated upon gel filtration chromatography. As shown in Fig. 1, Q Hyper D fraction incubated with [3H]SR 31747A gave a single radioactive peak associated with eluted proteins. We used this property to prepare a [3H]SR 31747A/SR-BP complex (tritiated antigen) for radioimmunoassay to detect antibody specific to SR-BP. The hybridoma 30G10 producing the antibody with the highest affinity was selected; antibodies were produced in mice, purified, and linked to CNBr-Sepharose. The subsequent immunopurification step drastically improved the purity of SR-BP (Table I) since only a single band of 28 kDa could be detected by silver staining and immunobloting (Fig. 2). In the purified preparation, the SR 31747A binding activity was enriched 914-fold over the crude digitonin extract. This preparation was used for partial amino acid sequencing.

SR-BP cDNA Cloning

To isolate the human SR-BP-encoding cDNA, we used the trypsic peptides obtained from the purified human SR-BP protein. Based on amino acid sequence of the longest peptide, reverse transcriptase-PCR and then 5' RACE experiments led us to clone a 320-bp fragment.

This fragment was then used to screen an oligo(dT)-primed Daudi cDNA library in lambda  UniZAP phage. The cDNA and deduced amino acid sequence of the largest clone are shown in Fig. 3. This cDNA contained a 669-bp open reading frame with untranslated regions of 74 bp at the 5'-end, 906 bp at the 3'-end, and a consensus polyadenylation signal (AATAAA) 16 bp upstream from the poly(A) tail. Translation of this open reading frame yielded a 223-amino acid protein with a calculated molecular mass of 24.8 kDa.

Comparisons to the GenBank data base revealed that human SR-BP displayed 93% amino acid sequence identity with the predicted amino acid sequence of a guinea pig protein called sigma 1 receptor (32) and was further found identical to the recently published human sigma 1 receptor (33). In addition, a significant homology (29.9% amino acid sequence identity) was found with the product of the gene ERG2, a fungal gene encoding a sterol isomerase (34). It is noteworthy that we have already shown that ERG2P is the molecular target of SR 31747A in yeast (23). The three proteins shared the same hydropathy plot, including a highly hydrophobic domain located at the N terminus, with a second stretch of hydrophobic amino acids located in the middle of these proteins. Multiple alignments showed that this domain is highly conserved among human SR-BP, guinea pig sigma 1 receptor, and the ERG2 gene product from yeast S. cerevisiae as well as from other fungi (Magnaportae grisea, Ustilago maydis, Neurospora crassa) (Fig. 4).


Fig. 4. Comparative analysis of human SR-BP amino acid sequence. The alignment was done using the clustal W alignment program. Identical amino acid residues conserved in three or more sequences are in bold letters. The proteins listed include the SR-BP, the guinea pig sigma 1 receptor (GP-sigma 1R) (32), and the sterol isomerase from the yeast (S. cerevisiae) (34), the rice blast fungus M. grisea (39), the maize smut pathogen U. maydis (39), and N. crassa (GenBank data base accession number Z22775).

[View Larger Version of this Image (50K GIF file)]


SR-BP Expression

We next investigated SR-BP functions by first transfecting SR-BP cDNA in a different host cell. We used a ERG2 gene disruptant strain of S. cerevisiae (EMY47), as host to express SR-BP. Untransformed EMY47 cells did not detectably display any SR-BP binding sites. In contrast, SR-BP-expressing cells exhibited SR 31747A binding sites at a high level. Flow cytometry analysis showed a marked labeling in SR-BP-expressing cells (data not shown). These results confirmed that the cDNA sequence encoded the SR-BP protein.

Analysis of the SR-BP transcript expression by Northern blotting identified a major band of 2 kilobases (Fig. 5A). The human tissues that contained the highest amount of human SR-BP mRNA were liver along with colon, prostate, placenta, small intestine, heart, and pancreas. SR-BP mRNA is also present at a slightly lower level in spleen, lung, thymus, ovary, peripheral blood leukocytes, and brain. These observations were confirmed in the human Master Blot (Fig. 5B).


Fig. 5. Northern blot analysis of human SR-BP expression. A, commercial blots (CLONTECH) containing 2 µg of poly(A)+ mRNAs from human tissues shown above each lane were hybridized with human SR-BP cDNA as described under "Materials and Methods." Blots were stripped and rehybridized with actin probe to assess levels of RNA between lanes (data not shown). B, a human master blot (CLONTECH) containing 50 different human tissues immobilized in separate dots was hybridized with human SR-BP cDNA as described under "Materials and Methods." The diagram on the left shows the nature and the position of poly(A)+ RNAs and controls.

[View Larger Version of this Image (61K GIF file)]


Subcellular distribution of SR-BP was examined in the human promonocytic cell line THP1 by immunological analysis using confocal microscopy. Cells were simultaneously labeled with anti-SR-BP mAb and mAbs specific for different subcellular organelles. We clearly observed SR-BP localized in association with the nuclear envelope (Fig. 6). This localization was also observed on a variety of different cell types including freshly isolated lymphocytes and monocytes. Another localization was found in the cytosol distinct from mitochondria (Fig. 6) and might be the endoplasmic reticulum.


Fig. 6. Nuclear envelope localization of SR-BP in THP1 cells by confocal microscopy. THP1 cells were simultaneously labeled with anti-SR-BP and anti-nuclear envelope mAbs or with anti-SR-BP and anti-mitochondria (anti-mt) mAbs as described under "Materials and Methods." The red (Cy5) left side corresponds to the labeling of SR-BP, the green (fluorescein isothiocyanate) central part to the labeling of subcellular organelles, and the right side represents the merged images. A single optical section representative of each cell type is shown in this image. Ab, antibody; mb, membrane.

[View Larger Version of this Image (119K GIF file)]


Pharmacological Characterization of SR-BP

We studied the binding properties of human SR-BP expressed in yeast and compared it to the S. cerevisiae ERG2 gene product (Erg2p). Binding assays were performed in transformed cells of the ERG2 disruptant strain EMY47, which produce either Erg2p (control) or SR-BP. SR 31747A binding assays were also carried out on purified SR-BP. A variety of competing compounds were tested, including drugs with high affinity for sigma receptors as well as compounds known to bind yeast sterol isomerase (Table II). Among the various molecules tested, the rank order of drug potency at SR 31747A sites was: tridemorph = fenpropimorph > SR 31747A > haloperidol > (+)-pentazocine > ifenprodil. Purified soluble SR-BP showed an essentially similar affinity profile for various tested compounds when compared with membraneous SR-BP. Only minor decreases in affinity were observed for haloperidol and ifenprodil, instead of major decreases for (+)-pentazocine, which could be related to a difference in protein conformation.

Table II. Inhibition of [3H]SR 31747A or [3H](+)-pentazocine binding to soluble SR-BP, SR-BP, and Erg2p expressed in yeast by different drugs

Binding experiments were performed as described under "Materials and Methods." The values shown are the mean ± S.E. of triplicate determinations. Data are from one representative experiment out of two or three. Binding parameters were obtained by nonlinear curve fitting of the inhibition data to the general dose-response equation (41).

Compounds IC50 (nM)
[3H]SR 31747A site soluble SR-BP Yeast [3H]SR 31747A site SR-BP Yeast [3H]-pentazocine site SR-BP Erg2p [3H]-SR 31747A site

SR 31747A 1.5  ± 0.3 1.7  ± 0.1 0.90  ± 0.02 2.8  ± 0.2
Emopamil 258  ± 12 1000 190  ± 39 >1000
Ifenprodil 333  ± 50 70  ± 5 16  ± 1 16  ± 2
Fenpropimorph 2.6  ± 0.2 0.17  ± 0.02 0.50  ± 0.04 0.10  ± 0.01
Tridemorph 0.7  ± 0.04 0.16  ± 0.01 0.91  ± 0.07 0.18  ± 0.01
(+)-Pentazocine 1000 18  ± 2 6.6  ± 1.3 >1000
(-)-Pentazocine 10,000 >1000 290  ± 20 >1000
DTG 2000 >1000 92  ± 15 >10,000
(+)-3-PPP 1000 >1000 176  ± 19 >1000
(+)SKF10047 5000 >1000 310  ± 58 >1000
(-)SKF10047 >10,000 >1000 >10,000 >1000
Haloperidol 63  ± 2 5.3  ± 0.5 1.2  ± 0.1 1.3  ± 0.1

Comparable ranking of tested ligands was observed with Erg2p: tridemorph = fenpropimorph > haloperidol > SR 31747A > ifenprodil. Nevertheless, a major difference in the pharmacology of SR-BP and Erg2p is that (+)-pentazocine inhibited the binding of [3H]SR 31747A to SR-BP (IC50 = 18 nM) but not to Erg2p (IC50 > 1000 nM). We therefore examined the binding of [3H]pentazocine to Erg2p and SR-BP. In agreement with the above findings, [3H]pentazocine, which bound to membraneous SR-BP, did not bind to Erg2p (data not shown).

As shown in Table II, the binding profile of [3H]pentazocine to membraneous SR-BP corresponded to a typical sigma 1 profile: (+)-pentazocine and (+)-SKF 10,047 having, respectively, a 43-fold and >33-fold higher affinity than their (-)-counterparts. Unlike (+)-pentazocine and haloperidol, the sigma ligands 1,3-di(2-tolyl)guanidine, (+)-3-PPP, and (+)-SKF 10,047 were unable to displace [3H]SR 31747A. We also noted a low efficiency of inhibition in the case of the sigma 1 ligand emopamil.

Scatchard plot analysis (Fig. 7A) for membraneous SR-BP using [3H]SR 31747A as labeled ligand revealed a single high affinity site with a Kd value of 0.15 nM and a Bmax of 6195 fmol/mg protein. In these experiments, (+)-pentazocine acted as a competitive ligand (increased Kd with unchanged Bmax). Comparatively, [3H](+)-pentazocine (Fig. 7B) bound with high affinity to a single population of sites (Kd = 7.1 nM and Bmax = 3860 fmol/mg protein). SR 31747A used at the concentration of 2 nM was competitive to this site (Kd = 11.7 nM and Bmax = 3977 fmol/mg protein). The affinity of [3H]SR 31747A for the SR-BP site was 50- fold higher compared with that of [3H](+)-pentazocine.


Fig. 7. A, Scatchard plots of [3H]SR 31747A binding to membraneous SR-BP without or with (+)-pentazocine. Yeast membranes (15 µg/assay) were incubated with increasing concentrations of [3H]SR 31747A (0.03-3 nM) in the absence (square ) or presence of (+)-pentazocine (25 nM; black-square). Experiments were performed as described under "Materials and Methods." Each value is represented as the mean of triplicate determinations. Data are from one representative experiment out of three performed in triplicate. The figure shows the Scatchard transformation of these data. The Kd and Bmax values are for control 0.15 ± 0.01 (n[scapm) and 6195 ± 121 (fmol/mg proteins), respectively; and in the presence of 25 nM (+)-pentazocine 0.32 ± 0.01 (n[scapm) and 5580 ± 94 (fmol/mg proteins). B: Scatchard plots of [3H](+)-pentazocine binding to human SR-BP without or with SR 31747A. Yeast membranes (50 µg/assay) were incubated with increasing concentrations of [3H](+)-pentazocine (0.02-20 nM) in the absence (square ) or presence of SR 31747A (2 nM; black-square). Experiments were performed as described under "Materials and Methods." Each value is represented as the mean of triplicate determinations. Data are from one representative experiment out of three performed in triplicate. The figure shows the Scatchard transformation of these data. The Kd and Bmax values are for control 7.1 ± 0.4 (n[scapm) and 3860 ± 126 (fmol/mg proteins) respectively; and in the presence of 2 nM SR 31747A, 11.7 ± 0.01 (n[scapm) and 3977 ± 132 (fmol/mg proteins).

[View Larger Version of this Image (13K GIF file)]


We have shown previously (14) that SR 31747A is active at inhibiting lymphocyte proliferation while pentazocine is inactive. Since pentazocine does not block T lymphocyte proliferation while it prevents [3H]SR 31747A binding, if SR 31747A is acting through SR-BP to block T lymphocyte mitogenesis, pentazocine should thereby prevent SR 31747A inhibition. We hence analyzed the effect of SR 31747A on cell growth in the absence or presence of pentazocine. As shown in Fig. 8A, cellular proliferation was inhibited by SR 31747A and restored in the presence of increasing pentazocine concentrations (Fig. 8B). Although it is not known whether pentazocine could completely reverse the SR 31747A effect due to the high pentazocine concentration-induced toxicity, this observation strongly suggests that the SR 31747A antiproliferative effects could be mediated by SR-BP.


Fig. 8. Effect of pentazocine on the inhibition of T lymphocyte mitogenesis by SR 31747A. Spleen cells were isolated from naive BALB/c mice and cultured (4 × 105/well) for 96 h with 1 µg/ml staphylococcal enterotoxin B. [3H]thymidine was incorporated during the last 4 h. A, effect of SR 31747A (bullet ) or (+)-pentazocine (black-down-triangle ) on cell proliferation. Results are expressed as the percent of [3H]thymidine incorporation of untreated cells (100% = 64983 cpm). B, (+)-pentazocine blocked the inhibitory effect induced by SR 31747A. Spleen cells were treated with 27 nM SR 31747A and with various concentrations of (+)-pentazocine. Results are expressed as the percent of inhibition of SR 31747A effect.

[View Larger Version of this Image (16K GIF file)]



DISCUSSION

SR 31747A is an immunomodulating agent eliciting high affinity for sigma receptors. It demonstrates immunosuppressive properties both in vitro and in vivo (14). This compound, which blocks the proliferation of lymphocytes at nanomolar concentrations, displays a spectrum of activity distinct from current immunosuppressive agents (35). However, these studies suffered from a lack of information on the binding protein involved to relate the observed effects to a biochemical process (36). In an attempt to decipher this, we have purified, cloned, sequenced, and expressed the SR-BP. We also studied the tissue distribution, subcellular localization, and pharmacological properties of this protein.

Molecular Characterization of SR-BP

Partial purification of the digitonin-solubilized SR-BP from cells of the human T leukemic Ichikawa cell line was achieved by three successive ion-exchange chromatographic steps followed by a gel filtration. The specific activity obtained was 510 pmol/mg of protein, representing a 160-fold increase over the specific activity of the crude extract. This preparation was used to generate a monoclonal antibody anti-SR-BP, which in turn enabled the subsequent purification of SR-BP. Immunopurified SR-BP was used for partial amino acid sequence analyses, after which the corresponding cDNA was cloned. The nucleotide sequence of the SR-BP cDNA encodes a 223-amino acid protein. Furthermore, the characterization of the heterologous expression of the SR-BP cDNA in yeast demonstrates that the cloned cDNA encodes a protein that has a high affinity [3H]SR 31747A-binding domain and is specifically recognized by anti SR-BP-antibodies.

In the course of this study, we cloned the guinea pig and human sigma 1 receptor cDNA and found a 93% and 100% amino acid sequence identity, respectively, with SR-BP (32, 33). We discuss below successively (i) the relationship of SR-BP and sigma 1 receptor, and (ii) the relationship of SR-BP and Erg2p.

Comparison of SR-BP and Sigma 1 Receptor

The sigma 1 receptor was recently purified and characterized from guinea pig liver by Hanner et al. (32) (see, for review, Moebius et al. (37)). The high degree of homology between the two proteins suggests that it could be the guinea pig counterpart of human SR-BP. We show here that the SR 31747A binding profile fits with the pharmacological definition of sigma 1 receptor: 1) SR-BP binds the sigma ligands, pentazocine and haloperidol with high affinity; 2) only one stereoisomer of pentazocine efficiently competed for [3H]SR 31747A-labeled sites, which is a trait characteristic of the sigma 1 receptor previously characterized in rat spleen (10, 11, 12). Our results obtained with [3H]pentazocine are in line with those of Hanner et al. (32) on the sigma 1 receptor from guinea pig.

From saturation studies with SR 31747A and (+)-pentazocine binding on SR-BP, we concluded that both ligands bound to a single population of sites. As SR 31747A was competitively displaced by (+)-pentazocine and reciprocally, it is very likely that SR 31747A and (+)-pentazocine bind the same site. Nevertheless, Bmax values (6195 and 3860 fmol/mg proteins for SR 31747A and (+)-pentazocine, respectively) were slightly different and the SR 31747A affinity was 50-fold higher than that of (+)-pentazocine. We observed an irreversible (or very slowly dissociable) binding of [3H]SR 31747A at SR-BP.

Comparison between SR-BP and Erg2p

SR-BP shares a significant sequence identity with Erg2p (29.9%). We have shown that this latter protein is the target that mediates the anti-proliferation effects of SR 31747A in yeast (23). Results presented here as well as those of Hanner et al. (32) show that yeast Erg2p and mammalian sigma 1 receptor or SR-BP, whether of guinea-pig or human source, are related to one another not only structurally but also pharmacologically. In fact, only pentazocine clearly distinguishes both proteins, whereas SR 31747A, haloperidol, ifenprodil, and drugs of the N-substituted morpholine derivative family, like tridemorph and fenpropimorph, all bind to both proteins with high affinity. Tridemorph and fenpropimorph are known to inhibit C8-C7 sterol isomerase, as well as other enzymes of the sterol biosynthetic pathway, presumably by mimicking the high energy carbocationic reaction intermediate (38). These drugs can therefore be considered as belonging to a non-sterol class of sterol analogs that bind to the reactive sterol-binding pocket of sterol biosynthesis enzymes. Sequence alignment of the C8-C7 sterol isomerase from S. cerevisiae (34), the rice blast fungus M. grisea (39), and the maize smut pathogen U. maydis (39) show a strikingly high percentage of similarity within the central hydrophobic region. For this reason, this central domain has been suggested to contain the sterol isomerase catalytic site. Interestingly, SR-BP, which displays a hydropathy profile similar to that of fungal sterol isomerase, also presents this highly conserved central domain. This observation raises two hypotheses: first, the presumably catalytic domain of Erg2p, and the equivalent central hydrophobic domain of SR-BP might contain the sigma ligand binding site. This could be illustrated by the property of fenpropimorph to competitively inhibit C8-C7 sterol isomerase and other sterol biosynthesis enzymes (23, 38). The second hypothesis is that SR-BP may exhibit a C8-C7 sterol isomerase activity. This hypothesis is supported by the high affinity of the sterol isomerase competitive inhibitors tridemorph and fenpropimorph to bind to SR-BP. However, it is not supported by expression studies in yeast, since no complementation of any of the Erg2p defect, i.e. C8-sterol accumulation and ergosterol prototrophy, was observed by expressing either the guinea-pig sigma 1 receptor (32) or the human SR-BP in an ERG2 gene disruptant (this study). No ergosterol could be detected in pEMR1499-transformed EMY47 cells (data not shown). We cannot exclude that recombinant SR-BP produced in yeast is synthesized in an active form but localized in subcellular compartments where sterol biosynthesis does not take place, as has been suggested in the case of recombinant human squalene synthase (40). Alternatively, the enzymatically active form of SR-BP might require specific post-translation modification events that do not occur in yeast cells. Finally, one should not exclude that SR-BP function(s) might not include the sterol isomerization reaction as performed by Erg2p in yeast. It is worth noting that we have already cloned a mammalian enzyme by complementation of the Erg2p defect in yeast (38). This microsomal protein displays all the biochemical characteristics expected for mammalian sterol isomerase, including sensitivity to drugs that specifically inhibit the activity of this enzyme in mammals (38). Surprisingly, this enzyme is absolutely not related phylogenetically to Erg2p or SR-BP; it does not share any striking structural similarity with any members of the Erg2p family including SR-BP. However, mammalian sterol isomerase does contain a sigma ligand binding site (32, 38). This observation supports the hypothesis that the sterol-binding pocket present in sterol isomerase, whether belonging to the Erg2p family or not, indeed constitutes the sigma ligand binding site. It also suggests that other sterol metabolism enzymes might present sigma ligand binding sites as well.

Distribution and Subcellular Localization of SR-BP

The tissular distribution of human SR-BP mRNA revealed a major transcript of 2 kilobases, which was found to be ubiquitous, although its abundance varied among tissues. The transcript was most abundant in the liver, and lower in brain. This latter observation clearly contrasts with the high expression level of sigma 1 receptor mRNA in brain guinea pig reported by Hanner et al. (32). This suggests a major difference in tissue expression of sigma 1 receptor or SR-BP in guinea pig and human. Further investigations using specific anti-SR-BP antibodies are required to document this in particular to interpret the neurological activities of sigma ligands in rodent and human.

In cells expressing SR-BP, the subcellular localization using specific monoclonal antibodies showed that SR-BP is always associated with the nuclear envelope, strongly suggesting that SR-BP is an ubiquitous component of the nuclear membrane. We also observed that, when the nuclear envelope disassembles at the onset of mitosis and reassembles at the end of mitosis, the SR-BP follows the same dynamics (data not shown). Our finding of a subcellular localization of SR-BP in nuclear membrane was substantiated by the presence of a hydrophobic domain near the N terminus. The cytosolic localization, which was also observed, was different from one cell line to another and remains to be further explored. Within the nuclear membrane, the lack of recognition of SR-BP by mAbs applied to intact isolated nuclei indicates that the epitope recognized by the mAb is not exposed to the cytoplasm. However, further investigations are required to determine whether SR-BP belongs to the inner or outer nuclear membrane.

Biological Effect of SR 31747A and SR-BP

We have shown previously that SR 31747A blocks T lymphocyte proliferation. Several findings from this study support the possibility that SR 31747A effects are mediated by SR-BP.

1) We showed the presence of SR-BP in immune tissue at the mRNA level. The expression of the protein in purified T cells as well as in macrophages was also demonstrated by flow cytometry using an anti-SR-BP antibody (data not shown). These results are in agreement with recent studies from Wolfe et al. (22), who showed, using in vitro receptor autoradiography in frozen sections of rat spleen, that sigma 1 receptors were present throughout the spleen and particularly concentrated in the T cell zones.

2) We demonstrated that the effect of SR 31747A on T cell proliferation was blocked by the competitive ligand (+)-pentazocine. This finding is consistent with a sigma 1 receptor-mediated event. Although the clear definition of agonist and antagonist at the sigma 1 receptor is difficult, these results suggest that SR 31747A and pentazocine display opposite biological effects.

We have already established that SR 31747A affects a late event in the activation process of T lymphocytes which occurs during the S/G2/M phases of the cell cycle (14). This suggests that the function of SR-BP could be essential for T lymphocyte mitogenesis. Furthermore, and taking into account (i) the nuclear membrane localization of SR-BP, (ii) the dramatic changes in nuclear membrane during mitosis, (iii) the homology of SR-BP with sterol isomerase, and (iv) the known effects of cholesterol on the activity of membrane proteins, one may speculate that some of the effects of SR 31747A on T cell mitogenesis could be mediated by changes in membrane lipids.

Even though our study does not definitively prove that SR-BP is the site through which SR 31747A modulates immune functions, we cannot rule out that SR 31747A could be effective through other sites not yet identified. An accurate structure-activity relationship study should help to elucidate such an important question.

In conclusion, we have identified and characterized a high affinity binding protein for SR 31747 and shown that this protein is the human sigma 1 receptor. We also demonstrated that both binding and activity of SR 31747 could be reversed by (+)-pentazocine. This important property strongly suggests that the sigma 1 receptor displays biological functions and provides new tools for further mechanistic investigations.


FOOTNOTES

*   The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) U79528.


§   Both authors contributed equally to this work.
Dagger Dagger    To whom correspondence should be addressed: Tel.: 33-4-67-10-62-90; Fax: 33-4-67-10-68-83; e-mail: pierre.casellas{at}tls1.elfsanofi.fr.
1   The abbreviations used are: 3-PPP, 3-(3-hydroxyphenyl)-N-(1-propyl)-piperidine; mAb, monoclonal antibody; SR-BP, SR 31747A-binding protein; BSA, bovine serum albumin; RACE, rapid amplification of cDNA end; PCR, polymerase chain reaction; PBS, phosphate-buffered saline; SKF 10,047, norallylmetazocine; PAGE, polyacrylamide gel electrophresis; bp, base pair(s).

ACKNOWLEDGEMENTS

We thank Dr. Nadir Mechti (Institut de Génétique Moléculaire, Montpellier, France) for the gracious gift of Daudi lambda  UniZAP XR cDNA library and Prof. Dr. Gerhard Groß (Knoll AG, Ludwigshafen, Germany) for kindly providing us with emopamil.


REFERENCES

  1. Martin, W. R., Eades, C. G., Thomson, J. A., Hoppler, R. E., and Gilbert, P. E. (1976) J. Pharmacol. Exp. Ther. 197, 517-532 [Abstract/Free Full Text]
  2. Su, T.-P. (1981) Eur. J. Pharmacol. 75, 81-82 [CrossRef][Medline] [Order article via Infotrieve]
  3. Su, T.-P. (1982) J. Pharmacol. Exp. Ther. 223, 284-290 [Abstract/Free Full Text]
  4. Gundlack, A. L., Largent, B. L., and Snyder, S. H. (1996) J. Neurosci. 6, 1757-1770 [Abstract]
  5. Wolfe, S. A., Jr., Culp, S. G., and De Souza, E. B. (1989) Endocrinology 124, 1160-1172 [Abstract/Free Full Text]
  6. Roman, F. J., Pascaud, X., Chomette, G., Buéno, L., and Junien, J. L. (1989) Gastroenterology 97, 76 [Medline] [Order article via Infotrieve]
  7. Samovilova, N. N., Nagornaya, L. V., and Vinogradov, V. A. (1988) Eur. J. Pharmacol. 147, 259-264 [Medline] [Order article via Infotrieve]
  8. Hellewell, S. B., Bruce, A., Feinstein, G., Orringer, J., Williams, W., and Bowen, W. D. (1994) Eur. J. Pharmacol. Mol. Pharmacol. 268, 9-18 [CrossRef][Medline] [Order article via Infotrieve]
  9. Wolfe, S. A., Jr., Kulsakdinun, C., Battaglia, G., Jaffe, J. H., and De Souza, E. B. (1988) J. Pharmacol. Exp. Ther. 247, 1114-1119 [Abstract/Free Full Text]
  10. Wolfe, S. A., Jr., and De Souza, E. B. (1992) in Multiple Sigma and PCP Receptor Ligands: Mechanisms for Neuro-modulation and Neuroprotection? (Kamenka, J. M., and Domino, E. F., eds), pp. 927-958, NPP Books, Ann Arbor, MI
  11. Wolfe, S. A., Jr., and De Souza, E. B. (1994) in Sigma Receptors (Itzhak, Y., ed), pp. 287-317, Academic Press Inc., San Diego
  12. Liu, Y., Whitlock, B. B., Pultz, J. A., and Wolfe, S. A., Jr. (1995) J. Neuroimmunol. 59, 143-154 [CrossRef][Medline] [Order article via Infotrieve]
  13. Paul, R., Lavastre, S., Floutard, D., Floutard, R., Canat, X., Casellas, P., Le Fur, G., and Brelière, J.-C. (1994) J. Neuroimmunol. 52, 183-192 [CrossRef][Medline] [Order article via Infotrieve]
  14. Casellas, P., Bourrié, B., Canat, X., Carayon, P., Buisson, I., Paul, R., Brelière, J.-C., and Le Fur, G. (1994) J. Neuroimmunol. 52, 193-203 [CrossRef][Medline] [Order article via Infotrieve]
  15. Bowen, W. D., Hellewell, S. B., and McGarry, K. A. (1989) Eur. J. Pharmacol. 163, 309-318 [CrossRef][Medline] [Order article via Infotrieve]
  16. Hellewell, S. B., and Bowen, W. D. (1990) Brain Res. 527, 244-253 [CrossRef][Medline] [Order article via Infotrieve]
  17. Karbon, E. W., Naper, K., and Pontecorvo, M. J. (1991) Eur. J. Pharmacol. 193, 21-27 [Medline] [Order article via Infotrieve]
  18. Rothman, R. B., Reid, A., Mahboubi, A., Kim, C.-H., de Costa, B. R., Jacobson, A. E., and Rice, K. C. (1991) Mol. Pharmacol. 39, 222-232 [Abstract]
  19. Wu, X.-Z., Bell, J. A., Spivak, C. E., London, E. D., and Su, T.-P. (1991) J. Pharmacol. Exp. Ther. 257, 351-359 [Abstract/Free Full Text]
  20. Myers, A. M., Charifson, P. S., Owens, C. E., Kula, N. S., McPhail, A. T., Baldessarini, R. J., Booth, R. G., and Wyrick, S. D. (1994) J. Med. Chem. 37, 4109-4117 [CrossRef][Medline] [Order article via Infotrieve]
  21. Whitlock, B. B., Liu, Y., Chang, S., Saini, P., Ha, B. K., Barrett, T. W., and Wolfe, S. A., Jr. (1996) J. Neuroimmunol. 67, 83-96 [Medline] [Order article via Infotrieve]
  22. Wolfe, S. A., Jr., Ha, B. K., Whitlock, B. B., and Saini, P. (1997) J. Neuroimmunol. 72, 45-58 [Medline] [Order article via Infotrieve]
  23. Silve, S., Leplatois, P., Josse, A., Dupuy, P.-H., Lanau, C., Kaghad, M., Dhers, C., Picard, C., Rahier, A., Taton, M., Le Fur, G., Caput, D., Ferrara, P., and Loison, G. (1996) Mol. Cell. Biol. 16, 2719-2727 [Abstract]
  24. Heinemeyer, W., Kleinschmidt, J. A., Saidowski, J., Escher, C., and Wolf, D. H. (1991) EMBO J. 10, 555-562 [Medline] [Order article via Infotrieve]
  25. Guthrie, C., and Fink, G. R. (1991) Methods Enzymol. 194, 1-863 [Medline] [Order article via Infotrieve]
  26. Yaffe, M. P. (1991) Methods Enzymol. 194, 627-643 [Medline] [Order article via Infotrieve]
  27. Laemmli, U. K. (1970) Nature 227, 680-685 [CrossRef][Medline] [Order article via Infotrieve]
  28. Hewick, R. M., Hunkapiller, M. W., Hood, L. E., and Dreyer, W. J. (1981) J. Biol. Chem. 256, 7990-7997 [Abstract/Free Full Text]
  29. Altschul, S. P., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990) J. Mol. Biol. 215, 403-410 [CrossRef][Medline] [Order article via Infotrieve]
  30. Church, G. M., and Gilbert, W. (1984) Proc. Natl. Acad. Sci. U. S. A. 81, 1991-1995 [Abstract/Free Full Text]
  31. Dussossoy, D., Carayon, P., Feraut, D., Belugou, S., Combes, T., Canat, X., Vidal, H., and Casellas, P. (1996) Cytometry 24, 39-48 [CrossRef][Medline] [Order article via Infotrieve]
  32. Hanner, M., Moebius, F. F., Flandorfer, A., Knaus, H.-G., Striessnig, J., Kempner, E., and Glossmann, H. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 8072-8077 [Abstract/Free Full Text]
  33. Kekuda, R., Prasad, P. D., Fei, Y. J., Leibach, F. H., and Ganapathy, V. (1996) Biochem. Biophys. Res. Commun. 229, 553-558 [CrossRef][Medline] [Order article via Infotrieve]
  34. Ashman, W. H., Barbuch, R. J., Ulbright, C. E., Jarrett, H. W., and Bard, M. (1991) Lipids 26, 628-632 [Medline] [Order article via Infotrieve]
  35. Derocq, J.-M., Bourrié, B., Ségui, M., Le Fur, G., and Casellas, P. (1995) J. Pharmacol. Exp. Ther. 272, 224-230 [Abstract/Free Full Text]
  36. Bourrié, B., Bouaboula, M., Benoît, J.-M., Derocq, J.-M., Esclangon, M., Le Fur, G., and Casellas, P. (1995) Eur. J. Immunol. 25, 2882-2887 [Medline] [Order article via Infotrieve]
  37. Moebius, F. F., Striessnig, J., and Glossmann, H. (1997) Trends Pharmacol. Sci. 18, 67-70 [Medline] [Order article via Infotrieve]
  38. Silve, S., Dupuy, P. H., Labit-Lebouteiller, C., Kaghad, M., Chalon, P., Rahier, A., Taton, M., Lupker, J., Shire, D., and Loison, G. (1996) J. Biol. Chem. 271, 22434-22440 [Abstract/Free Full Text]
  39. Keon, J. P. R., James, C. S., Court, S., Baden-Daintree, C., Bailey, A. M., Burden, R. S., Bard, M., and Hargreaves, J. A. (1994) Curr. Genet. 25, 531-537 [CrossRef][Medline] [Order article via Infotrieve]
  40. Robinson, G. W., Tsay, E. Y., Kienzle, B. K., Smith-Monroy, C. A., and Bishop, R. W. (1993) Mol. Cell. Biol. 13, 2706-2717 [Abstract/Free Full Text]
  41. De Lean, A., Munson, P. J., and Rodbard, D. (1978) Am. J. Physiol. 4, E97-E102

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Eukaryot CellHome page
A. Gioti, J. M. Pradier, E. Fournier, P. Le Pecheur, C. Giraud, D. Debieu, J. Bach, P. Leroux, and C. Levis
A Botrytis cinerea Emopamil Binding Domain Protein, Required for Full Virulence, Belongs to a Eukaryotic Superfamily Which Has Expanded in Euascomycetes
Eukaryot. Cell, February 1, 2008; 7(2): 368 - 378.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
A. Pal, A. R. Hajipour, D. Fontanilla, S. Ramachandran, U. B. Chu, T. Mavlyutov, and A. E. Ruoho
Identification of Regions of the {sigma}-1 Receptor Ligand Binding Site Using a Novel Photoprobe
Mol. Pharmacol., October 1, 2007; 72(4): 921 - 933.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
M. Martina, M.-E. B. Turcotte, S. Halman, and R. Bergeron
The sigma-1 receptor modulates NMDA receptor synaptic transmission and plasticity via SK channels in rat hippocampus
J. Physiol., January 1, 2007; 578(1): 143 - 157.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
E. Aydar, C. P. Palmer, and M. B. A. Djamgoz
Sigma Receptors and Cancer: Possible Involvement of Ion Channels
Cancer Res., August 1, 2004; 64(15): 5029 - 5035.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H. Vidal, G. Mondesert, S. Galiegue, D. Carriere, P.-H. Dupuy, P. Carayon, T. Combes, E. Bribes, J. Simony-Lafontaine, A. Kramar, et al.
Identification and Pharmacological Characterization of SRBP-2: A Novel SR31747A-binding Protein
Cancer Res., August 15, 2003; 63(16): 4809 - 4818.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
M. Souter, J. Topping, M. Pullen, J. Friml, K. Palme, R. Hackett, D. Grierson, and K. Lindsey
hydra Mutants of Arabidopsis Are Defective in Sterol Profiles and Auxin and Ethylene Signaling
PLANT CELL, May 1, 2002; 14(5): 1017 - 1031.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
P. J Lupardus, R. A Wilke, E. Aydar, C. P Palmer, Y. Chen, A. E Ruoho, and M. B Jackson
Membrane-delimited coupling between sigma receptors and K+ channels in rat neurohypophysial terminals requires neither G-protein nor ATP
J. Physiol., August 1, 2000; 526(3): 527 - 539.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
D. Rozman, M. Fink, G. M. Fimia, P. Sassone-Corsi, and M. R. Waterman
Cyclic Adenosine 3',5'-Monophosphate(cAMP)/cAMP-Responsive Element Modulator (CREM)-Dependent Regulation of Cholesterogenic Lanosterol 14{alpha}-Demethylase (CYP51) in Spermatids
Mol. Endocrinol., November 1, 1999; 13(11): 1951 - 1962.
[Abstract] [Full Text]


Home page
J. Pharmacol. Exp. Ther.Home page
R. Paul, S. Silve, N. De Nys, P.-H. Dupuy, C. L.-L. Bouteiller, J. Rosenfeld, P. Ferrara, G. Le Fur, P. Casellas, and G. Loison
Both the Immunosuppressant SR31747 and the Antiestrogen Tamoxifen Bind to an Emopamil-Insensitive Site of Mammalian Delta 8-Delta 7 Sterol Isomerase
J. Pharmacol. Exp. Ther., June 1, 1998; 285(3): 1296 - 1302.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jbilo, O.
Right arrow Articles by Casellas, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jbilo, O.
Right arrow Articles by Casellas, P.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1997 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement