|
Volume 272, Number 43,
Issue of October 24, 1997
pp. 27107-27115
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.
Purification and Characterization of the Human SR
31747A-binding Protein
A NUCLEAR MEMBRANE PROTEIN RELATED TO YEAST STEROL
ISOMERASE*
(Received for publication, June 19, 1997, and in revised form, August 13, 1997)
Omar
Jbilo
§,
Hubert
Vidal
§,
Raymond
Paul
,
Nathalie
De
Nys
,
Mohammed
Bensaid
,
Sandra
Silve
¶,
Pierre
Carayon
,
Danielle
Davi
,
Sylvaine
Galiègue
,
Bernard
Bourrié
,
Jean-Claude
Guillemot
¶,
Pascual
Ferrara
¶,
Gérard
Loison
¶,
Jean-Pierre
Maffrand
,
Gérard
Le Fur
** and
Pierre
Casellas
 
From Sanofi, 371 rue du Pr. Joseph Blayac, 34184 Montpellier cedex 04, ¶ Sanofi, Voie no. 1, BP 137, 31676 Labège cedex, Sanofi, 195 route d'Espagne, 31036 Toulouse
cedex, and ** Sanofi, 32-34 rue Marbeuf,
75374 Paris cedex 08, France
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
ABSTRACT
SR 31747A, defined as a sigma ligand,
is a novel immunosuppressive agent that blocks proliferation of human
and mouse lymphocytes. Using a radiolabeled chemical probe, we here
purified a target of SR 31747A and called it SR 31747A-binding protein
(SR-BP). Purified SR-BP retained its binding properties and migrated on SDS-polyacrylamide gel as a Mr 28,000 protein.
Cloning of the cDNA encoding human SR-BP shows an open reading
frame for a 223-amino acid protein, which is homologous to the recently
cloned sigma 1 receptor. Interestingly, the deduced amino acid sequence
was found to be related to fungal C8-C7 sterol isomerase, encoded by
the ERG2 gene. The ERG2 gene product has been
identified recently as the molecular target of SR 31747A that mediates
antiproliferative effects of the drug in yeast. Northern blot analysis
of SR-BP gene expression revealed a single transcript of 2 kilobases
which was widely expressed among organs, with the highest abundance in
liver and the lowest abundance in brain. Subcellular localization analysis in various cells, using a specific monoclonal antibody raised
against SR-BP, demonstrated that this protein was associated with the
nuclear envelope. When studying the binding of SR 31747A on membranes
from yeast expressing SR-BP, we found a pharmacological profile of
sigma 1 receptors; binding was displaced by (+)-pentazocine, haloperidol, and (+)-SKF 10,047, with (+)-SKF 10,047 being a more potent competitor than ( )-SKF 10,047. Scatchard plot analysis revealed Kd values of 7.1 nM and 0.15 nM for (+)-pentazocine and SR 31747A, respectively,
indicating an affinity of SR-BP 50-fold higher for SR 31747A than for
pentazocine. Additionally, we showed that pentazocine, a competitive
inhibitor of SR 31747A binding, also prevents the immunosuppressive
effect of SR 31747A. Taken together, these findings strongly suggest
that SR-BP represents the molecular target for SR 31747A in mammalian
tissues, which could be critical for T cell proliferation.
INTRODUCTION
Sigma receptors, initially identified by Martin et al.
(1) as a subclass of opiate receptors, were characterized by Su (2, 3)
in guinea pig brain. They were subsequently found to be distributed in
a variety of distinct regions of the central nervous system (4), as
well as in endocrine-related structures (5), gastrointestinal tract
(6), liver (7), and kidney (8). Sigma receptors were further identified
in human peripheral blood mononuclear cells (9-12), and their presence
was confirmed in rat spleen. The biological significance of sigma
receptors in the immune system is poorly understood. However, Liu
et al. (12), using a panel of sigma ligands, demonstrated a
high correlation between drug binding potency at sigma sites and
inhibition of splenocyte proliferation, suggesting that sigma receptors
may function as immunoregulators.
SR 31747A was first described by Paul et al. (13) as a
ligand able to compete with a very high potency with all known sigma ligands and to inhibit mitogen-induced mouse and human T cell proliferation with a potency similar to that of cyclosporin A (14).
However, unlike cyclosporin A, SR 31747A does not alter early cellular
events, but rather interferes at steps further along the pathway
leading to proliferation, most probably during the S phase (14).
Multiple receptors have been described (8, 15-19). Sigma 1 designates
a high affinity binding site, which is stereoselective for (+)-optical
enantiomers of pentazocine, SKF 10,047, and
3-(3-hydroxyphenyl)-N-(1-propyl)-piperidine (3-PPP).1 Sigma 2 refers to a
site that binds these drugs with lower affinity, and which is selective
for ( )-optical enantiomers of pentazocine, SKF 10,047, and 3-PPP. A
lower affinity sigma 3 site has been reported in rat and guinea pig
brain (20). More recently, a novel binding site was discovered that
binds all sigma ligands with two notable exceptions: haloperidol and
1,3-di(2-tolyl)guanidine (21, 22).
Pharmacological studies with SR 31747A cannot discriminate among sigma
1, sigma 2, sigma 3, and the novel sigma/opioid binding sites since
multiple types of sigma receptors can coexist on cells (19). Moreover,
the cross-reactivity of many drugs that bind with high affinity to
other receptors has impeded efforts to define precisely the sites for
SR 31747A binding.
Recently, we examined the effect of this drug in the yeast
Saccharomyces cerevisiae. We showed that SR 31747A arrested
cell proliferation by inhibiting an enzyme of the sterol biosynthetic pathway, namely C8-C7 sterol isomerase (23).
In the present work, we undertook a biochemical characterization of a
molecular entity that specifically binds SR 31747A using [3H]SR 31747A as the specific probe and the human T
leukemia cell line Ichikawa as the biological source. We purified the
protein carrying the SR 31747A binding site and cloned the
corresponding cDNA, which was shown to be homologous to the yeast
ERG2 gene. Expression of SR-BP cDNA in yeast S. cerevisiae led to high affinity binding sites for SR 31747A
indistinguishable from mammalian sites. We also present the tissue
distribution and subcellular localization and discuss the structural
features of this receptor and its possible functions.
MATERIALS AND METHODS
Reagents
[3H](+)-Pentazocine (NET 1056-1550 GBq/mmol) was
supplied by NEN Life Science Products (Paris, France). SR 31747A,
(Z)-N-cyclohexyl-N-ethyl-3-(3-chloro-4-cyclohexylphenyl)-propen-2-ylamine hydrochloride, and [3H]SR 31747A (2109 GBq/mmol) were
synthetized by Sanofi Recherche. 1,3-di(2-tolyl)guanidine, (+)-3-PPP,
( )-3-PPP, (+)-SKF 10,047, ( )-SKF 10,047, and (+)- and
(-)-pentazocine were supplied by Research Biochemicals Inc. (Natick,
MA). Digitonin, haloperidol, ifenprodil, and the anti-bleaching reagent
DABCO were supplied by Sigma. Fenpropimorph and tridemorph were a
generous gift of Dr. A. Akers (BASF Aktiengesellshaft, Limburgerhof,
Germany). LH2O, DEAE-Sepharose, Mono Q HR 10/10, Superdex
200 HR, and CNBr-Sepharose 4B were purchased from Pharmacia (Orsay,
France). Q Hyper D column was from Biosepra (Frankfurt, Germany).
Strains, Media, and Growth Conditions
EMY43 (MAT , ura3 , trp1-4,
erg2::TRP1) and EMY47 (MAT , ura3 , trp1-4,
erg2::TRP1, fen1::LEU2) were isogenic
derivatives of S. cerevisiae wild type FL100 (ATCC-28383).
C13-ABYS86 (EMY761, MAT , ura3 5 leu2-3 leu2-112 his3 pra1
prb1 prc1 cps1) was kindly provided by Heinemeyer et
al. (24). Yeast culture media were YPD medium and synthetic
minimal (SD) medium containing 2% glucose (25). Anaerobic conditions
were obtained using an anaerobic glove box (La Calhène,
Vélizy, France) under
N2-H2-CO2 (85-10%-5%) atmosphere. For anaerobic growth, media were supplemented with 0.1%
Tween 80 and 50 mg/liter ergosterol.
Drug Binding Assay
SR 31747A Binding Assays on Soluble Receptor
To monitor SR
31747A binding activity during the purification process, a SR 31747A
binding assay on soluble receptor was developed. Briefly, 2 nM [3H]SR 31747A was incubated with 10 to 50 µl of each fraction in a final volume of 250 µl in 50 mM Tris-HCl, pH 7.4, 0.1% BSA for 30 min at 20 °C.
Separation of bound from free ligands was obtained by gel filtration
with a 1-ml LH 20 column. Samples (200 µl) were loaded onto the
column and eluted with 1.8 ml of 50 mM Tris-HCl, pH 7.4. The 2-ml volume containing bound [3H]SR 31747A was mixed
with 10 ml of scintillation liquid and counted for radioactivity.
In competition studies using purified receptor, various concentrations
(0.4-1000 nM) of unlabeled ligands were incubated for 2 h at 20 °C with 1 nM [3H]SR 31747A
in 500 µl of binding buffer (50 mM Tris-HCl, pH 7.4, containing 0.1% BSA, 0.02% digitonin, 0.02% Tween 20). For
saturation analysis, purified receptor was incubated for 2 h at
20 °C with increasing concentrations of [3H]SR 31747A
(0.03-3 nM) in the presence or absence of 1 µM SR 31747A in binding buffer.
SR 31747A Binding Studies on Yeast Cell Membranes
Yeast
cells were treated with zymolyase as described previously (26) and
homogenized at 4 °C in 50 mM Tris-HCl buffer, pH 8.0, for membrane preparation. Receptor binding assays for
[3H](+)-pentazocine and [3H]SR 31747A were
performed according to the methods described by Paul et al.
(13).
Purification of the Human SR 31747A-binding Protein (SR-BP)
Human T leukemia Ichikawa cells (2 × 1010
cells) were suspended in 200 ml of a buffer containing 70 mM sucrose, 210 mM D-mannitol, 2 mM EDTA, 1 mM 4-(2-aminoethyl-1)-phenylsulfonyl
fluoride, and 2 mM Hepes, pH 7.4, then homogenized using a
Turrax homogenizer. The crude homogenate was centrifuged at 650 × g for 20 min, and the supernatant was further centrifuged at
100,000 × g for 1 h. The membrane-containing
pellet was solubilized at 10 mg/ml in 50 mM Tris-HCl, pH
7.4, 1 mM 4-(2-aminoethyl-1)-phenylsulfonyl fluoride, 2%
digitonin. The suspension was centrifuged at 100,000 × g for 30 min, and the supernatant was then subjected to
chromatography successively on DEAE-Sepharose column (2.5 × 11 cm), Mono Q column (1 × 10 cm), Q Hyper D column (0.5 × 10 cm), and then Superdex 200 HR column (1 × 30 cm). These columns
were pre-equilibrated with TDG buffer (50 mM Tris-HCl, pH
7.4, and 0.1% digitonin). Bound proteins were eluted with linear NaCl
gradient (0-500 mM) in TDG buffer. Peak fractions
containing SR 31747-binding protein were monitored by
[3H]SR 31747 binding activity. Purified binding activity
from 200 HR column was used for generation of specific antibodies as
described below.
To immunopurify SR-BP, active peak from the DEAE-Sepharose was loaded
onto a 2-ml column of anti-SR-BP Sepharose obtained by coupling
purified monoclonal anti-SR-BP antibody (see below) to CNBr-activated
Sepharose (ratio: 0.5 mg of proteins/ml of Sepharose). Bound proteins
were eluted with 0.1 M glycine pH 3.0, 0.5 M
NaCl, 0.02% digitonin. The fractions containing binding activity were neutralized to pH 7.0 with 1 M Tris-HCl and concentrated
for further analysis.
Anti-SR-BP Monoclonal Antibody Obtention
Positive fractions from Q Hyper D chromatography were incubated
with 2 nM [3H]SR 31747A for 2 h at
20 °C and chromatographed on Superdex 200 HR as described above.
Fractions containing the maximum radioactivity were pooled and used as
tritiated SR-BP ([3H]SR-BP) for antibody screening.
Three mice were immunized by subcutaneous injection of 10 µg of
proteins of enriched SR-BP preparation from Superdex 200 HR chromatography in Freund's complete adjuvant. On days 30 and 60, mice
were boosted with 10 µg of proteins in incomplete Freund's adjuvant.
Sera were collected on days 38 and 68, diluted to 100 µl in PBS
buffer containing 0.1% BSA and 0.1% Tween 20, and then incubated for
16 h at 4 °C with 100 µl of solution containing 5000 dpm of
[3H]SR-BP. Separation of free and bound antibodies was
obtained by addition of 1 ml of 20% polyethylene glycol 4000, followed by a centrifugation at 4000 × g. The pellet containing
bound antibodies was dissolved in 1 ml of PBS mixed with 10 ml of
scintillation liquid and counted for radioactivity.
For the production of monoclonal antibodies, 3 days before fusion, mice
were boosted intravenously with 10 µg of proteins. Splenocytes were
collected and fused with P3 × 63Ag8.653 mouse myeloma cells.
Screening for anti-SR-BP antibodies was performed using
[3H]SR-BP. Antibodies were produced in mice and purified
from ascitic fluid by affinity chromatography on protein
A-Sepharose.
Electrophoresis and Immunoblot
SDS-PAGE was performed according to Laemmli (27). Proteins were
transferred electrophoretically to nitrocellulose membrane. The
membrane was incubated for 1 h at 20 °C in 5% nonfat dry milk in 0.1% Tween 20, 150 mM NaCl, 20 mM Tris-HCl,
pH 7.4, then for 1 h at 20 °C with monoclonal antibody at 0.5 µg/ml in the same buffer. Peroxidase-conjugated goat anti-mouse
antibodies were added, and protein detection was performed with ECL kit
(Amersham) as described in the manufacturer's protocol.
Partial Amino Acid Sequencing of SR-BP
Immunopurified SR-BP was subjected to SDS-PAGE. After gel
staining with Coomassie Blue G-250, the 28-kDa band was cut out and
subjected to trypsin hydrolysis, which generated six distinct peptides.
Edman's degradation was performed using an Applied Biosystems model
477A pulse-liquid sequenator connected on line to an RP-HPLC unit
(model 120A, Applied Biosystems) (28).
Molecular Cloning of Human SR-BP cDNA
Two degenerate oligonucleotides were designed based on the amino
acid sequence of the longer peptide (these were derived from GARGTNTTYTAYCCIGGIGARAC (sense) and from CATVCANGTRTTIGGICCCCAYTC (antisense)) (Fig. 3). PCR was performed using 100 ng of first strand
cDNA prepared from Daudi mRNA. The 80-bp PCR product was further subcloned into PGEM-T vector (Promega, Madison, WI) and sequenced. Two matched antisense primers (AS1:
5 -GCCCCACTCCACAGCTGTTGCCTC-3 ; AS2: 5 -ACCAGGCCCGTGTACTACCGTCTC-3 )
complementary to the middle of the sequence were used to amplify the 5
end of cDNA with the RACE system (Life Technologies, Inc.). A PCR
product of about 320 bp was subcloned into PGEM-T and sequenced. This
DNA fragment was used as a probe to screen a Daudi UniZAP XR
cDNA library. The longest isolated clone was fully sequenced, and
sequence analyses were performed with Blast (29). Amino acid sequence
alignment was produced by the clustal W program.
Fig. 3.
Sequence of human SR-BP cDNA and its
encoded protein. The deduced protein sequence of human SR-BP is
shown below the cDNA sequence. The numbers on the
left refer to the nucleotide sequence; numbers on
the right refer to the amino acid sequence. The
underlined sequences indicate the tryptic peptides. The ATG of the open reading frame and the consensus polyadenylation signal (AATAAA) are in bold letters. The asterisk
denotes the termination codon.
[View Larger Version of this Image (99K GIF file)]
Expression of SR-BP cDNA in S. cerevisiae
The open reading frame of SR-BP was cloned by PCR amplification
using two oligonucleotides, A and B. The oligonucleotide sequence of A
(forward, BamHI, SalI) was as follows:
ATCAGGATCCGTCGACAACATGCAATGGGCTGTTGGTAGACGGTGGGCGTGGGCC) and
corresponded to the first 12 codons of SR-BP with some modifications at
the DNA level to improve mRNA translation. The oligonucleotide sequence of B (reverse, BamHI, XbaI) corresponded
to positions +662 to +684 (relative to the first base of the initiation
codon). The amplified DNA fragment was cloned between the
SalI and BamHI sites of the pEMR1023 polylinker
(23) to yield pEMR1499, a multicopy E. coli-S. cerevisiae
shuttle vector containing URA3 as the selective marker. The
SR-BP open reading frame was expressed under the control of the PGK
promoter.
Northern Blot Analysis
The expression of SR-BP mRNA in human tissues was examined
by Northern blot analysis using membranes purchased from
CLONTECH (Palo Alto, CA). Hybridization was carried
out in Church buffer (30) with a 32P-labeled 300-bp probe
specific for SR-BP cDNA. Autoradiography was performed overnight
with an intensifying screen.
Analysis of Subcellular Localization of SR-BP by Confocal
Microscopy
Cells were fixed overnight with 1% formaldehyde at 4 °C,
washed once in PBS, and permeabilized for 10 min with a solution of
0.1% saponin in PBS containing 1% BSA. Biotinylated conjugated anti-SR-BP mAb, and anti-mitochondria M117 or anti-nuclear membrane AE-5 mAbs (Leinco Technologies Inc., St. Louis, MO) were simultaneously incubated with cells in the 0.1% saponin, 1% BSA solution for 30 min
at room temperature. After two washes, cells were simultaneously incubated for 30 min with fluorescein isothiocyanate-conjugated goat
anti-mouse IgG1 Abs (Southern Biotechnology Inc., Birmingham, AL) to
stain M117 or AE-5 mAbs, and with Cy5-conjugated streptavidin (from
Jackson Immunoresearch, West Grove, PA) to stain biotinylated conjugated anti-SR-BP mAb. Cell pellets were resuspended in 20 µl of
glycerol containing the anti-bleaching reagent DABCO at 50 mg/ml. A
laser-scanning confocal microscope (LSM410, Zeiss, Oberkochen, Germany)
equipped with a planapo oil (× 63) immersion lens (numerical
aperture = 1.4) was used to analyze the three-dimensional distribution of SR-BP as described previously (31).
In Vitro Lymphocyte Proliferation
Mouse splenocytes were cultured in 96-well flat-bottomed plates
in quadruplicate at 4 × 105 cells/well with 1 µg/ml
staphylococcal enterotoxin B. Cells were cultured in complete medium
for 4 days in the presence of various concentrations of SR 31747A or
(+)-pentazocine, then pulsed with 1 µCi/well
[3H]thymidine (Amersham, les Ulis, France), and harvested
4 h later on glass fiber papers using a Skatron harvester system
(Pharmacia). Incorporated radioactivity was measured by using a
Betaplate liquid scintillation spectrometer (Pharmacia).
RESULTS
Purification of Human SR-BP
Results of SR-BP purification
from human T leukemia Ichikawa cells are summarized in Table
I. From the solubilized membrane preparation, the binding activity was eluted as a single peak with DEAE
anion exchange chromatography. A straightforward enrichment of SR-BP
was obtained using Mono Q gel followed by Q Hyper D gel. The apparent
size of SR-BP determined by gel filtration gave a value of
approximately 100 kDa (Fig. 1), whereas
electrophoresis revealed several bands between 80 and 100 kDa and a
band close to 30 kDa (Fig. 2, lane
5). At this stage, the enriched SRBP preparation was used to
immunize animals to generate specific monoclonal antibodies against
SR-BP for further purification.
Table I.
Purification of SR-BP from Ichikawa T cells
|
| Purification
stepsa |
Proteins
|
[3H]SR
31747A bindingb
|
|
Recovery |
|
Recovery |
Purification
factor |
Kdc |
|
|
mg
protein |
% |
pmol/mg |
%
|
| SDGa |
560 |
100 |
3.2 |
100 |
1
|
| DEAE |
76 |
13.0 |
7.7 |
32 |
2.4 |
| Mono
Q |
16 |
2.8 |
21 |
19 |
6.6 |
| Q Hyper
D |
1.4 |
0.25 |
153 |
12 |
48 |
| 200
HR |
0.19 |
0.068 |
510 |
5.4 |
160 |
0.24
± 0.05 |
| Anti-SRBP
Sepharosed |
0.018 |
0.0032 |
2925 |
3.0 |
914 |
0.22
± 0.04 |
|
|
a
Purification steps were as follows: SDG, crude
supernatant of membrane solubilization by digitonin; DEAE, pooled
active fractions from DEAE Sepharose column; Mono Q, pooled active
fractions from Mono Q column; Q Hyper D, pooled active fractions from Q
Hyper D column; HR 200, pooled active fractions from Superdex HR 200 column; anti-SR-BP-Sepharose, pooled active fractions from the affinity
anti-SR-BP column.
|
|
b
[3H]SR 31747A binding was determined as described
under "Materials and Methods."
|
|
c
Scatchard analysis of specific [3H]SR 31747A
binding to purified fractions; purified HR200 fraction (450 ng/ml) or
immunopurified fraction (144 ng/ml) were incubated for 2 h at
20 °C with [3H]SR 31747A (0.03-3.0 nM).
Nonspecific binding was determined in the presence of 1 µM SR 31747A.
|
|
d
Direct purification from DEAE fraction using anti-SR-BP
antibody.
|
|
Fig. 1.
Superdex HR 200 chromatography. The
active fractions from Q Hyper D were pooled, concentrated, and passed
through a Superdex HR200 column, either directly, the fractions being
assayed for [3H]SR 31747A binding ( ), or after a 2-h
preincubation with 20 nM [3H]SR 31747A, after
which the radioactivity was measured in each fraction ( ). The
arrows indicate the elution positions of molecular size
markers: 1, ferritin (440 kDa); 2, catalase (232 kDa); 3, aldolase (158 kDa); 4, bovine serum
albumin (67 kDa); 5, ovalbumin (43 kDa).
[View Larger Version of this Image (26K GIF file)]
Fig. 2.
SDS-PAGE during SR-BP purification.
Lane 1, molecular size markers; lane 2,
digitonin-solubilized membrane (40 µg); lane 3,
DEAE-Sepharose fraction (20 µg); lane 4, Mono Q-Sepharose fraction (20 µg); lane 5, Q Hyper D fraction (6 µg);
lane 6, HR 200 fraction (3 µg); lane 7,
affinity fraction (1 µg). The gel (12% acrylamide) was stained with
Coomassie Blue; lane 8, immunoblot of the immunopurified
fraction.
[View Larger Version of this Image (86K GIF file)]
We developed a screening test for antibody detection, taking advantage
of the fact that the binding of [3H]SR 31747A to
partially purified SR-BP was not dissociated upon gel filtration
chromatography. As shown in Fig. 1, Q Hyper D fraction incubated with
[3H]SR 31747A gave a single radioactive peak associated
with eluted proteins. We used this property to prepare a
[3H]SR 31747A/SR-BP complex (tritiated antigen) for
radioimmunoassay to detect antibody specific to SR-BP. The hybridoma
30G10 producing the antibody with the highest affinity was selected;
antibodies were produced in mice, purified, and linked to
CNBr-Sepharose. The subsequent immunopurification step drastically
improved the purity of SR-BP (Table I) since only a single band of 28 kDa could be detected by silver staining and immunobloting (Fig. 2). In
the purified preparation, the SR 31747A binding activity was enriched
914-fold over the crude digitonin extract. This preparation was used
for partial amino acid sequencing.
SR-BP cDNA Cloning
To isolate the human SR-BP-encoding
cDNA, we used the trypsic peptides obtained from the purified human
SR-BP protein. Based on amino acid sequence of the longest peptide,
reverse transcriptase-PCR and then 5 RACE experiments led us to clone
a 320-bp fragment.
This fragment was then used to screen an oligo(dT)-primed Daudi
cDNA library in UniZAP phage. The cDNA and deduced amino acid sequence of the largest clone are shown in Fig.
3. This cDNA contained a 669-bp open
reading frame with untranslated regions of 74 bp at the 5 -end, 906 bp
at the 3 -end, and a consensus polyadenylation signal (AATAAA) 16 bp
upstream from the poly(A) tail. Translation of this open reading frame
yielded a 223-amino acid protein with a calculated molecular mass of
24.8 kDa.
Comparisons to the GenBank data base revealed that human SR-BP
displayed 93% amino acid sequence identity with the predicted amino
acid sequence of a guinea pig protein called sigma 1 receptor (32) and
was further found identical to the recently published human sigma 1 receptor (33). In addition, a significant homology (29.9% amino acid
sequence identity) was found with the product of the gene
ERG2, a fungal gene encoding a sterol isomerase (34). It is
noteworthy that we have already shown that ERG2P is the molecular
target of SR 31747A in yeast (23). The three proteins shared the same
hydropathy plot, including a highly hydrophobic domain located at the N
terminus, with a second stretch of hydrophobic amino acids located in
the middle of these proteins. Multiple alignments showed that this
domain is highly conserved among human SR-BP, guinea pig sigma 1 receptor, and the ERG2 gene product from yeast S. cerevisiae
as well as from other fungi (Magnaportae grisea,
Ustilago maydis, Neurospora crassa) (Fig.
4).
Fig. 4.
Comparative analysis of human SR-BP amino
acid sequence. The alignment was done using the clustal W
alignment program. Identical amino acid residues conserved in three or
more sequences are in bold letters. The proteins listed
include the SR-BP, the guinea pig sigma 1 receptor (GP-sigma
1R) (32), and the sterol isomerase from the yeast (S. cerevisiae) (34), the rice blast fungus M. grisea (39),
the maize smut pathogen U. maydis (39), and N. crassa (GenBank data base accession number Z22775).
[View Larger Version of this Image (50K GIF file)]
SR-BP Expression
We next investigated SR-BP functions by
first transfecting SR-BP cDNA in a different host cell. We used a
ERG2 gene disruptant strain of S. cerevisiae
(EMY47), as host to express SR-BP. Untransformed EMY47 cells did not
detectably display any SR-BP binding sites. In contrast,
SR-BP-expressing cells exhibited SR 31747A binding sites at a high
level. Flow cytometry analysis showed a marked labeling in
SR-BP-expressing cells (data not shown). These results confirmed that
the cDNA sequence encoded the SR-BP protein.
Analysis of the SR-BP transcript expression by Northern blotting
identified a major band of 2 kilobases (Fig.
5A). The human tissues that
contained the highest amount of human SR-BP mRNA were liver along
with colon, prostate, placenta, small intestine, heart, and pancreas.
SR-BP mRNA is also present at a slightly lower level in spleen,
lung, thymus, ovary, peripheral blood leukocytes, and brain. These
observations were confirmed in the human Master Blot (Fig.
5B).
Fig. 5.
Northern blot analysis of human SR-BP
expression. A, commercial blots
(CLONTECH) containing 2 µg of
poly(A)+ mRNAs from human tissues shown above each lane
were hybridized with human SR-BP cDNA as described under
"Materials and Methods." Blots were stripped and rehybridized with
actin probe to assess levels of RNA between lanes (data not shown).
B, a human master blot (CLONTECH)
containing 50 different human tissues immobilized in separate dots was
hybridized with human SR-BP cDNA as described under "Materials
and Methods." The diagram on the left shows the nature and
the position of poly(A)+ RNAs and controls.
[View Larger Version of this Image (61K GIF file)]
Subcellular distribution of SR-BP was examined in the human
promonocytic cell line THP1 by immunological analysis using confocal microscopy. Cells were simultaneously labeled with anti-SR-BP mAb and
mAbs specific for different subcellular organelles. We clearly observed
SR-BP localized in association with the nuclear envelope (Fig.
6). This localization was also observed
on a variety of different cell types including freshly isolated
lymphocytes and monocytes. Another localization was found in the
cytosol distinct from mitochondria (Fig. 6) and might be the
endoplasmic reticulum.
Fig. 6.
Nuclear envelope localization of SR-BP in
THP1 cells by confocal microscopy. THP1 cells were simultaneously
labeled with anti-SR-BP and anti-nuclear envelope mAbs or with
anti-SR-BP and anti-mitochondria (anti-mt) mAbs as described
under "Materials and Methods." The red (Cy5) left
side corresponds to the labeling of SR-BP, the green
(fluorescein isothiocyanate) central part to the labeling of
subcellular organelles, and the right side represents the
merged images. A single optical section representative of each cell
type is shown in this image. Ab, antibody; mb,
membrane.
[View Larger Version of this Image (119K GIF file)]
Pharmacological Characterization of SR-BP
We studied the
binding properties of human SR-BP expressed in yeast and compared it to
the S. cerevisiae ERG2 gene product (Erg2p). Binding assays
were performed in transformed cells of the ERG2 disruptant strain
EMY47, which produce either Erg2p (control) or SR-BP. SR 31747A binding
assays were also carried out on purified SR-BP. A variety of competing
compounds were tested, including drugs with high affinity for sigma
receptors as well as compounds known to bind yeast sterol isomerase
(Table II). Among the various molecules
tested, the rank order of drug potency at SR 31747A sites was:
tridemorph = fenpropimorph > SR 31747A > haloperidol > (+)-pentazocine > ifenprodil. Purified
soluble SR-BP showed an essentially similar affinity profile for
various tested compounds when compared with membraneous SR-BP. Only
minor decreases in affinity were observed for haloperidol and
ifenprodil, instead of major decreases for (+)-pentazocine, which could
be related to a difference in protein conformation.
Table II.
Inhibition of [3H]SR 31747A or [3H](+)-pentazocine
binding to soluble SR-BP, SR-BP, and Erg2p expressed in yeast by
different drugs
Binding experiments were performed as described under "Materials and
Methods." The values shown are the mean ± S.E. of triplicate determinations. Data are from one representative experiment out of two
or three. Binding parameters were obtained by nonlinear curve fitting
of the inhibition data to the general dose-response equation (41).
|
| Compounds |
IC50 (nM)
|
| [3H]SR 31747A site soluble SR-BP |
Yeast
[3H]SR 31747A site SR-BP |
Yeast
[3H]-pentazocine site SR-BP |
Erg2p [3H]-SR
31747A site |
|
| SR 31747A |
1.5
± 0.3 |
1.7 ± 0.1 |
0.90 ± 0.02 |
2.8 ± 0.2
|
| Emopamil |
258 ± 12 |
1000 |
190
± 39 |
>1000 |
| Ifenprodil |
333
± 50 |
70 ± 5 |
16 ± 1 |
16 ± 2
|
| Fenpropimorph |
2.6 ± 0.2 |
0.17 ± 0.02 |
0.50
± 0.04 |
0.10 ± 0.01 |
| Tridemorph |
0.7 ± 0.04 |
0.16
± 0.01 |
0.91 ± 0.07 |
0.18 ± 0.01
|
| (+)-Pentazocine |
1000 |
18 ± 2 |
6.6
± 1.3 |
>1000
|
( )-Pentazocine |
10,000 |
>1000 |
290
± 20 |
>1000
|
| DTG |
2000 |
>1000 |
92
± 15 |
>10,000
|
| (+)-3-PPP |
1000 |
>1000 |
176
± 19 |
>1000
|
| (+)SKF10047 |
5000 |
>1000 |
310
± 58 |
>1000
|
( )SKF10047 |
>10,000 |
>1000 |
>10,000 |
>1000
|
| Haloperidol |
63 ± 2 |
5.3 ± 0.5 |
1.2
± 0.1 |
1.3 ± 0.1 |
|
Comparable ranking of tested ligands was observed with Erg2p:
tridemorph = fenpropimorph > haloperidol > SR
31747A > ifenprodil. Nevertheless, a major difference in the
pharmacology of SR-BP and Erg2p is that (+)-pentazocine inhibited the
binding of [3H]SR 31747A to SR-BP (IC50 = 18 nM) but not to Erg2p (IC50 > 1000 nM). We therefore examined the binding of
[3H]pentazocine to Erg2p and SR-BP. In agreement with the
above findings, [3H]pentazocine, which bound to
membraneous SR-BP, did not bind to Erg2p (data not shown).
As shown in Table II, the binding profile of
[3H]pentazocine to membraneous SR-BP corresponded to a
typical sigma 1 profile: (+)-pentazocine and (+)-SKF 10,047 having,
respectively, a 43-fold and >33-fold higher affinity than their
( )-counterparts. Unlike (+)-pentazocine and haloperidol, the sigma
ligands 1,3-di(2-tolyl)guanidine, (+)-3-PPP, and (+)-SKF 10,047 were
unable to displace [3H]SR 31747A. We also noted a low
efficiency of inhibition in the case of the sigma 1 ligand
emopamil.
Scatchard plot analysis (Fig.
7A) for membraneous SR-BP
using [3H]SR 31747A as labeled ligand revealed a single
high affinity site with a Kd value of 0.15 nM and a Bmax of 6195 fmol/mg protein. In these experiments, (+)-pentazocine acted as a competitive ligand (increased Kd with unchanged
Bmax). Comparatively, [3H](+)-pentazocine (Fig. 7B) bound with high
affinity to a single population of sites (Kd = 7.1 nM and Bmax = 3860 fmol/mg protein).
SR 31747A used at the concentration of 2 nM was competitive to this site (Kd = 11.7 nM and
Bmax = 3977 fmol/mg protein). The affinity of
[3H]SR 31747A for the SR-BP site was 50- fold higher
compared with that of [3H](+)-pentazocine.
Fig. 7.
A, Scatchard plots of
[3H]SR 31747A binding to membraneous SR-BP without or
with (+)-pentazocine. Yeast membranes (15 µg/assay) were incubated
with increasing concentrations of [3H]SR 31747A (0.03-3
nM) in the absence ( ) or presence of (+)-pentazocine (25 nM; ). Experiments were performed as described under
"Materials and Methods." Each value is represented as the mean of
triplicate determinations. Data are from one representative experiment
out of three performed in triplicate. The figure shows the Scatchard transformation of these data. The Kd and
Bmax values are for control 0.15 ± 0.01 (n[scapm) and 6195 ± 121 (fmol/mg proteins), respectively; and
in the presence of 25 nM (+)-pentazocine 0.32 ± 0.01 (n[scapm) and 5580 ± 94 (fmol/mg proteins). B:
Scatchard plots of [3H](+)-pentazocine binding to human
SR-BP without or with SR 31747A. Yeast membranes (50 µg/assay) were
incubated with increasing concentrations of
[3H](+)-pentazocine (0.02-20 nM) in the
absence ( ) or presence of SR 31747A (2 nM; ).
Experiments were performed as described under "Materials and
Methods." Each value is represented as the mean of triplicate
determinations. Data are from one representative experiment out of
three performed in triplicate. The figure shows the Scatchard
transformation of these data. The Kd and Bmax values are for control 7.1 ± 0.4 (n[scapm) and 3860 ± 126 (fmol/mg proteins) respectively; and in
the presence of 2 nM SR 31747A, 11.7 ± 0.01 (n[scapm) and 3977 ± 132 (fmol/mg proteins).
[View Larger Version of this Image (13K GIF file)]
We have shown previously (14) that SR 31747A is active at inhibiting
lymphocyte proliferation while pentazocine is inactive. Since
pentazocine does not block T lymphocyte proliferation while it prevents
[3H]SR 31747A binding, if SR 31747A is acting through
SR-BP to block T lymphocyte mitogenesis, pentazocine should thereby
prevent SR 31747A inhibition. We hence analyzed the effect of SR 31747A
on cell growth in the absence or presence of pentazocine. As shown in
Fig. 8A, cellular
proliferation was inhibited by SR 31747A and restored in the presence
of increasing pentazocine concentrations (Fig. 8B). Although
it is not known whether pentazocine could completely reverse the SR
31747A effect due to the high pentazocine concentration-induced
toxicity, this observation strongly suggests that the SR 31747A
antiproliferative effects could be mediated by SR-BP.
Fig. 8.
Effect of pentazocine on the inhibition of T
lymphocyte mitogenesis by SR 31747A. Spleen cells were isolated
from naive BALB/c mice and cultured (4 × 105/well)
for 96 h with 1 µg/ml staphylococcal enterotoxin B. [3H]thymidine was incorporated during the last 4 h.
A, effect of SR 31747A ( ) or (+)-pentazocine ( ) on
cell proliferation. Results are expressed as the percent of
[3H]thymidine incorporation of untreated cells (100% = 64983 cpm). B, (+)-pentazocine blocked the inhibitory effect
induced by SR 31747A. Spleen cells were treated with 27 nM
SR 31747A and with various concentrations of (+)-pentazocine. Results
are expressed as the percent of inhibition of SR 31747A effect.
[View Larger Version of this Image (16K GIF file)]
DISCUSSION
SR 31747A is an immunomodulating agent eliciting high affinity for
sigma receptors. It demonstrates immunosuppressive properties both
in vitro and in vivo (14). This compound, which
blocks the proliferation of lymphocytes at nanomolar concentrations, displays a spectrum of activity distinct from current immunosuppressive agents (35). However, these studies suffered from a lack of information
on the binding protein involved to relate the observed effects to a
biochemical process (36). In an attempt to decipher this, we have
purified, cloned, sequenced, and expressed the SR-BP. We also studied
the tissue distribution, subcellular localization, and pharmacological
properties of this protein.
Molecular Characterization of SR-BP
Partial purification of
the digitonin-solubilized SR-BP from cells of the human T leukemic
Ichikawa cell line was achieved by three successive ion-exchange
chromatographic steps followed by a gel filtration. The specific
activity obtained was 510 pmol/mg of protein, representing a 160-fold
increase over the specific activity of the crude extract. This
preparation was used to generate a monoclonal antibody anti-SR-BP,
which in turn enabled the subsequent purification of SR-BP.
Immunopurified SR-BP was used for partial amino acid sequence analyses,
after which the corresponding cDNA was cloned. The nucleotide
sequence of the SR-BP cDNA encodes a 223-amino acid protein.
Furthermore, the characterization of the heterologous expression of the
SR-BP cDNA in yeast demonstrates that the cloned cDNA encodes a
protein that has a high affinity [3H]SR 31747A-binding
domain and is specifically recognized by anti SR-BP-antibodies.
In the course of this study, we cloned the guinea pig and human sigma 1 receptor cDNA and found a 93% and 100% amino acid sequence
identity, respectively, with SR-BP (32, 33). We discuss below
successively (i) the relationship of SR-BP and sigma 1 receptor, and
(ii) the relationship of SR-BP and Erg2p.
Comparison of SR-BP and Sigma 1 Receptor
The sigma 1 receptor
was recently purified and characterized from guinea pig liver by Hanner
et al. (32) (see, for review, Moebius et al.
(37)). The high degree of homology between the two proteins suggests
that it could be the guinea pig counterpart of human SR-BP. We show
here that the SR 31747A binding profile fits with the pharmacological
definition of sigma 1 receptor: 1) SR-BP binds the sigma ligands,
pentazocine and haloperidol with high affinity; 2) only one
stereoisomer of pentazocine efficiently competed for
[3H]SR 31747A-labeled sites, which is a trait
characteristic of the sigma 1 receptor previously characterized in rat
spleen (10, 11, 12). Our results obtained with
[3H]pentazocine are in line with those of Hanner et
al. (32) on the sigma 1 receptor from guinea pig.
From saturation studies with SR 31747A and (+)-pentazocine binding on
SR-BP, we concluded that both ligands bound to a single population of
sites. As SR 31747A was competitively displaced by (+)-pentazocine and
reciprocally, it is very likely that SR 31747A and (+)-pentazocine bind
the same site. Nevertheless, Bmax values (6195 and 3860 fmol/mg proteins for SR 31747A and (+)-pentazocine, respectively) were slightly different and the SR 31747A affinity was
50-fold higher than that of (+)-pentazocine. We observed an irreversible (or very slowly dissociable) binding of
[3H]SR 31747A at SR-BP.
Comparison between SR-BP and Erg2p
SR-BP shares a significant
sequence identity with Erg2p (29.9%). We have shown that this latter
protein is the target that mediates the anti-proliferation effects of
SR 31747A in yeast (23). Results presented here as well as those of
Hanner et al. (32) show that yeast Erg2p and mammalian sigma
1 receptor or SR-BP, whether of guinea-pig or human source, are related
to one another not only structurally but also pharmacologically. In
fact, only pentazocine clearly distinguishes both proteins, whereas SR
31747A, haloperidol, ifenprodil, and drugs of the
N-substituted morpholine derivative family, like tridemorph
and fenpropimorph, all bind to both proteins with high affinity.
Tridemorph and fenpropimorph are known to inhibit C8-C7 sterol
isomerase, as well as other enzymes of the sterol biosynthetic pathway,
presumably by mimicking the high energy carbocationic reaction
intermediate (38). These drugs can therefore be considered as belonging
to a non-sterol class of sterol analogs that bind to the reactive
sterol-binding pocket of sterol biosynthesis enzymes. Sequence
alignment of the C8-C7 sterol isomerase from S. cerevisiae
(34), the rice blast fungus M. grisea (39), and the maize
smut pathogen U. maydis (39) show a strikingly high
percentage of similarity within the central hydrophobic region. For
this reason, this central domain has been suggested to contain the
sterol isomerase catalytic site. Interestingly, SR-BP, which displays a
hydropathy profile similar to that of fungal sterol isomerase, also
presents this highly conserved central domain. This observation raises
two hypotheses: first, the presumably catalytic domain of Erg2p, and
the equivalent central hydrophobic domain of SR-BP might contain the
sigma ligand binding site. This could be illustrated by the property of
fenpropimorph to competitively inhibit C8-C7 sterol isomerase and other
sterol biosynthesis enzymes (23, 38). The second hypothesis is that SR-BP may exhibit a C8-C7 sterol isomerase activity. This hypothesis is
supported by the high affinity of the sterol isomerase competitive inhibitors tridemorph and fenpropimorph to bind to SR-BP. However, it
is not supported by expression studies in yeast, since no
complementation of any of the Erg2p defect, i.e. C8-sterol
accumulation and ergosterol prototrophy, was observed by expressing
either the guinea-pig sigma 1 receptor (32) or the human SR-BP in an
ERG2 gene disruptant (this study). No ergosterol could be
detected in pEMR1499-transformed EMY47 cells (data not shown). We
cannot exclude that recombinant SR-BP produced in yeast is synthesized
in an active form but localized in subcellular compartments where
sterol biosynthesis does not take place, as has been suggested in the
case of recombinant human squalene synthase (40). Alternatively, the
enzymatically active form of SR-BP might require specific
post-translation modification events that do not occur in yeast cells.
Finally, one should not exclude that SR-BP function(s) might not
include the sterol isomerization reaction as performed by Erg2p in
yeast. It is worth noting that we have already cloned a mammalian
enzyme by complementation of the Erg2p defect in yeast (38). This
microsomal protein displays all the biochemical characteristics
expected for mammalian sterol isomerase, including sensitivity to drugs
that specifically inhibit the activity of this enzyme in mammals (38).
Surprisingly, this enzyme is absolutely not related phylogenetically to
Erg2p or SR-BP; it does not share any striking structural similarity
with any members of the Erg2p family including SR-BP. However,
mammalian sterol isomerase does contain a sigma ligand binding site
(32, 38). This observation supports the hypothesis that the
sterol-binding pocket present in sterol isomerase, whether belonging to
the Erg2p family or not, indeed constitutes the sigma ligand binding
site. It also suggests that other sterol metabolism enzymes might
present sigma ligand binding sites as well.
Distribution and Subcellular Localization of SR-BP
The
tissular distribution of human SR-BP mRNA revealed a major
transcript of 2 kilobases, which was found to be ubiquitous, although
its abundance varied among tissues. The transcript was most abundant in
the liver, and lower in brain. This latter observation clearly
contrasts with the high expression level of sigma 1 receptor mRNA
in brain guinea pig reported by Hanner et al. (32). This suggests a major difference in tissue expression of sigma 1 receptor or
SR-BP in guinea pig and human. Further investigations using specific
anti-SR-BP antibodies are required to document this in particular to
interpret the neurological activities of sigma ligands in rodent and
human.
In cells expressing SR-BP, the subcellular localization using specific
monoclonal antibodies showed that SR-BP is always associated with the
nuclear envelope, strongly suggesting that SR-BP is an ubiquitous
component of the nuclear membrane. We also observed that, when the
nuclear envelope disassembles at the onset of mitosis and reassembles
at the end of mitosis, the SR-BP follows the same dynamics (data not
shown). Our finding of a subcellular localization of SR-BP in nuclear
membrane was substantiated by the presence of a hydrophobic domain near
the N terminus. The cytosolic localization, which was also observed,
was different from one cell line to another and remains to be further
explored. Within the nuclear membrane, the lack of recognition of SR-BP
by mAbs applied to intact isolated nuclei indicates that the epitope
recognized by the mAb is not exposed to the cytoplasm. However, further
investigations are required to determine whether SR-BP belongs to the
inner or outer nuclear membrane.
Biological Effect of SR 31747A and SR-BP
We have shown
previously that SR 31747A blocks T lymphocyte proliferation. Several
findings from this study support the possibility that SR 31747A effects
are mediated by SR-BP.
1) We showed the presence of SR-BP in immune tissue at the mRNA
level. The expression of the protein in purified T cells as well as in
macrophages was also demonstrated by flow cytometry using an anti-SR-BP
antibody (data not shown). These results are in agreement with recent
studies from Wolfe et al. (22), who showed, using in
vitro receptor autoradiography in frozen sections of rat spleen,
that sigma 1 receptors were present throughout the spleen and
particularly concentrated in the T cell zones.
2) We demonstrated that the effect of SR 31747A on T cell proliferation
was blocked by the competitive ligand (+)-pentazocine. This finding is
consistent with a sigma 1 receptor-mediated event. Although the clear
definition of agonist and antagonist at the sigma 1 receptor is
difficult, these results suggest that SR 31747A and pentazocine display
opposite biological effects.
We have already established that SR 31747A affects a late event in the
activation process of T lymphocytes which occurs during the
S/G2/M phases of the cell cycle (14). This suggests that the function of SR-BP could be essential for T lymphocyte mitogenesis. Furthermore, and taking into account (i) the nuclear membrane localization of SR-BP, (ii) the dramatic changes in nuclear membrane during mitosis, (iii) the homology of SR-BP with sterol isomerase, and
(iv) the known effects of cholesterol on the activity of membrane proteins, one may speculate that some of the effects of SR 31747A on T
cell mitogenesis could be mediated by changes in membrane lipids.
Even though our study does not definitively prove that SR-BP is the
site through which SR 31747A modulates immune functions, we cannot rule
out that SR 31747A could be effective through other sites not yet
identified. An accurate structure-activity relationship study should
help to elucidate such an important question.
In conclusion, we have identified and characterized a high affinity
binding protein for SR 31747 and shown that this protein is the human
sigma 1 receptor. We also demonstrated that both binding and activity
of SR 31747 could be reversed by (+)-pentazocine. This important
property strongly suggests that the sigma 1 receptor displays
biological functions and provides new tools for further mechanistic
investigations.
FOOTNOTES
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) U79528.
§
Both authors contributed equally to this work.

To whom correspondence should be addressed: Tel.:
33-4-67-10-62-90; Fax: 33-4-67-10-68-83; e-mail:
pierre.casellas{at}tls1.elfsanofi.fr.
1
The abbreviations used are: 3-PPP,
3-(3-hydroxyphenyl)-N-(1-propyl)-piperidine; mAb, monoclonal
antibody; SR-BP, SR 31747A-binding protein; BSA, bovine serum albumin;
RACE, rapid amplification of cDNA end; PCR, polymerase chain
reaction; PBS, phosphate-buffered saline; SKF 10,047, norallylmetazocine; PAGE, polyacrylamide gel electrophresis; bp, base
pair(s).
ACKNOWLEDGEMENTS
We thank Dr. Nadir Mechti (Institut de
Génétique Moléculaire, Montpellier, France) for the
gracious gift of Daudi UniZAP XR cDNA library and Prof. Dr.
Gerhard Groß (Knoll AG, Ludwigshafen, Germany) for kindly providing us
with emopamil.
REFERENCES
-
Martin, W. R., Eades, C. G., Thomson, J. A., Hoppler, R. E., and Gilbert, P. E.
(1976)
J. Pharmacol. Exp. Ther.
197,
517-532
[Abstract/Free Full Text]
-
Su, T.-P.
(1981)
Eur. J. Pharmacol.
75,
81-82
[CrossRef][Medline]
[Order article via Infotrieve]
-
Su, T.-P.
(1982)
J. Pharmacol. Exp. Ther.
223,
284-290
[Abstract/Free Full Text]
-
Gundlack, A. L., Largent, B. L., and Snyder, S. H.
(1996)
J. Neurosci.
6,
1757-1770
[Abstract]
-
Wolfe, S. A., Jr., Culp, S. G., and De Souza, E. B.
(1989)
Endocrinology
124,
1160-1172
[Abstract/Free Full Text]
-
Roman, F. J., Pascaud, X., Chomette, G., Buéno, L., and Junien, J. L.
(1989)
Gastroenterology
97,
76
[Medline]
[Order article via Infotrieve]
-
Samovilova, N. N., Nagornaya, L. V., and Vinogradov, V. A.
(1988)
Eur. J. Pharmacol.
147,
259-264
[Medline]
[Order article via Infotrieve]
-
Hellewell, S. B., Bruce, A., Feinstein, G., Orringer, J., Williams, W., and Bowen, W. D.
(1994)
Eur. J. Pharmacol. Mol. Pharmacol.
268,
9-18
[CrossRef][Medline]
[Order article via Infotrieve]
-
Wolfe, S. A., Jr., Kulsakdinun, C., Battaglia, G., Jaffe, J. H., and De Souza, E. B.
(1988)
J. Pharmacol. Exp. Ther.
247,
1114-1119
[Abstract/Free Full Text]
-
Wolfe, S. A., Jr., and De Souza, E. B.
(1992)
in
Multiple Sigma and PCP Receptor Ligands: Mechanisms for Neuro-modulation and Neuroprotection? (Kamenka, J. M., and Domino, E. F., eds), pp. 927-958, NPP Books, Ann Arbor, MI
-
Wolfe, S. A., Jr., and De Souza, E. B.
(1994)
in
Sigma Receptors (Itzhak, Y., ed), pp. 287-317, Academic Press Inc., San Diego
-
Liu, Y., Whitlock, B. B., Pultz, J. A., and Wolfe, S. A., Jr.
(1995)
J. Neuroimmunol.
59,
143-154
[CrossRef][Medline]
[Order article via Infotrieve]
-
Paul, R., Lavastre, S., Floutard, D., Floutard, R., Canat, X., Casellas, P., Le Fur, G., and Brelière, J.-C.
(1994)
J. Neuroimmunol.
52,
183-192
[CrossRef][Medline]
[Order article via Infotrieve]
-
Casellas, P., Bourrié, B., Canat, X., Carayon, P., Buisson, I., Paul, R., Brelière, J.-C., and Le Fur, G.
(1994)
J. Neuroimmunol.
52,
193-203
[CrossRef][Medline]
[Order article via Infotrieve]
-
Bowen, W. D., Hellewell, S. B., and McGarry, K. A.
(1989)
Eur. J. Pharmacol.
163,
309-318
[CrossRef][Medline]
[Order article via Infotrieve]
-
Hellewell, S. B., and Bowen, W. D.
(1990)
Brain Res.
527,
244-253
[CrossRef][Medline]
[Order article via Infotrieve]
-
Karbon, E. W., Naper, K., and Pontecorvo, M. J.
(1991)
Eur. J. Pharmacol.
193,
21-27
[Medline]
[Order article via Infotrieve]
-
Rothman, R. B., Reid, A., Mahboubi, A., Kim, C.-H., de Costa, B. R., Jacobson, A. E., and Rice, K. C.
(1991)
Mol. Pharmacol.
39,
222-232
[Abstract]
-
Wu, X.-Z., Bell, J. A., Spivak, C. E., London, E. D., and Su, T.-P.
(1991)
J. Pharmacol. Exp. Ther.
257,
351-359
[Abstract/Free Full Text]
-
Myers, A. M., Charifson, P. S., Owens, C. E., Kula, N. S., McPhail, A. T., Baldessarini, R. J., Booth, R. G., and Wyrick, S. D.
(1994)
J. Med. Chem.
37,
4109-4117
[CrossRef][Medline]
[Order article via Infotrieve]
-
Whitlock, B. B., Liu, Y., Chang, S., Saini, P., Ha, B. K., Barrett, T. W., and Wolfe, S. A., Jr.
(1996)
J. Neuroimmunol.
67,
83-96
[Medline]
[Order article via Infotrieve]
-
Wolfe, S. A., Jr., Ha, B. K., Whitlock, B. B., and Saini, P.
(1997)
J. Neuroimmunol.
72,
45-58
[Medline]
[Order article via Infotrieve]
-
Silve, S., Leplatois, P., Josse, A., Dupuy, P.-H., Lanau, C., Kaghad, M., Dhers, C., Picard, C., Rahier, A., Taton, M., Le Fur, G., Caput, D., Ferrara, P., and Loison, G.
(1996)
Mol. Cell. Biol.
16,
2719-2727
[Abstract]
-
Heinemeyer, W., Kleinschmidt, J. A., Saidowski, J., Escher, C., and Wolf, D. H.
(1991)
EMBO J.
10,
555-562
[Medline]
[Order article via Infotrieve]
-
Guthrie, C., and Fink, G. R.
(1991)
Methods Enzymol.
194,
1-863
[Medline]
[Order article via Infotrieve]
-
Yaffe, M. P.
(1991)
Methods Enzymol.
194,
627-643
[Medline]
[Order article via Infotrieve]
-
Laemmli, U. K.
(1970)
Nature
227,
680-685
[CrossRef][Medline]
[Order article via Infotrieve]
-
Hewick, R. M., Hunkapiller, M. W., Hood, L. E., and Dreyer, W. J.
(1981)
J. Biol. Chem.
256,
7990-7997
[Abstract/Free Full Text]
-
Altschul, S. P., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J.
(1990)
J. Mol. Biol.
215,
403-410
[CrossRef][Medline]
[Order article via Infotrieve]
-
Church, G. M., and Gilbert, W.
(1984)
Proc. Natl. Acad. Sci. U. S. A.
81,
1991-1995
[Abstract/Free Full Text]
-
Dussossoy, D., Carayon, P., Feraut, D., Belugou, S., Combes, T., Canat, X., Vidal, H., and Casellas, P.
(1996)
Cytometry
24,
39-48
[CrossRef][Medline]
[Order article via Infotrieve]
-
Hanner, M., Moebius, F. F., Flandorfer, A., Knaus, H.-G., Striessnig, J., Kempner, E., and Glossmann, H.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
8072-8077
[Abstract/Free Full Text]
-
Kekuda, R., Prasad, P. D., Fei, Y. J., Leibach, F. H., and Ganapathy, V.
(1996)
Biochem. Biophys. Res. Commun.
229,
553-558
[CrossRef][Medline]
[Order article via Infotrieve]
-
Ashman, W. H., Barbuch, R. J., Ulbright, C. E., Jarrett, H. W., and Bard, M.
(1991)
Lipids
26,
628-632
[Medline]
[Order article via Infotrieve]
-
Derocq, J.-M., Bourrié, B., Ségui, M., Le Fur, G., and Casellas, P.
(1995)
J. Pharmacol. Exp. Ther.
272,
224-230
[Abstract/Free Full Text]
-
Bourrié, B., Bouaboula, M., Benoît, J.-M., Derocq, J.-M., Esclangon, M., Le Fur, G., and Casellas, P.
(1995)
Eur. J. Immunol.
25,
2882-2887
[Medline]
[Order article via Infotrieve]
-
Moebius, F. F., Striessnig, J., and Glossmann, H.
(1997)
Trends Pharmacol. Sci.
18,
67-70
[Medline]
[Order article via Infotrieve]
-
Silve, S., Dupuy, P. H., Labit-Lebouteiller, C., Kaghad, M., Chalon, P., Rahier, A., Taton, M., Lupker, J., Shire, D., and Loison, G.
(1996)
J. Biol. Chem.
271,
22434-22440
[Abstract/Free Full Text]
-
Keon, J. P. R., James, C. S., Court, S., Baden-Daintree, C., Bailey, A. M., Burden, R. S., Bard, M., and Hargreaves, J. A.
(1994)
Curr. Genet.
25,
531-537
[CrossRef][Medline]
[Order article via Infotrieve]
-
Robinson, G. W., Tsay, E. Y., Kienzle, B. K., Smith-Monroy, C. A., and Bishop, R. W.
(1993)
Mol. Cell. Biol.
13,
2706-2717
[Abstract/Free Full Text]
-
De Lean, A., Munson, P. J., and Rodbard, D.
(1978)
Am. J. Physiol.
4,
E97-E102
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
A. Gioti, J. M. Pradier, E. Fournier, P. Le Pecheur, C. Giraud, D. Debieu, J. Bach, P. Leroux, and C. Levis
A Botrytis cinerea Emopamil Binding Domain Protein, Required for Full Virulence, Belongs to a Eukaryotic Superfamily Which Has Expanded in Euascomycetes
Eukaryot. Cell,
February 1, 2008;
7(2):
368 - 378.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Pal, A. R. Hajipour, D. Fontanilla, S. Ramachandran, U. B. Chu, T. Mavlyutov, and A. E. Ruoho
Identification of Regions of the {sigma}-1 Receptor Ligand Binding Site Using a Novel Photoprobe
Mol. Pharmacol.,
October 1, 2007;
72(4):
921 - 933.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Martina, M.-E. B. Turcotte, S. Halman, and R. Bergeron
The sigma-1 receptor modulates NMDA receptor synaptic transmission and plasticity via SK channels in rat hippocampus
J. Physiol.,
January 1, 2007;
578(1):
143 - 157.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Aydar, C. P. Palmer, and M. B. A. Djamgoz
Sigma Receptors and Cancer: Possible Involvement of Ion Channels
Cancer Res.,
August 1, 2004;
64(15):
5029 - 5035.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Vidal, G. Mondesert, S. Galiegue, D. Carriere, P.-H. Dupuy, P. Carayon, T. Combes, E. Bribes, J. Simony-Lafontaine, A. Kramar, et al.
Identification and Pharmacological Characterization of SRBP-2: A Novel SR31747A-binding Protein
Cancer Res.,
August 15, 2003;
63(16):
4809 - 4818.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Souter, J. Topping, M. Pullen, J. Friml, K. Palme, R. Hackett, D. Grierson, and K. Lindsey
hydra Mutants of Arabidopsis Are Defective in Sterol Profiles and Auxin and Ethylene Signaling
PLANT CELL,
May 1, 2002;
14(5):
1017 - 1031.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. J Lupardus, R. A Wilke, E. Aydar, C. P Palmer, Y. Chen, A. E Ruoho, and M. B Jackson
Membrane-delimited coupling between sigma receptors and K+ channels in rat neurohypophysial terminals requires neither G-protein nor ATP
J. Physiol.,
August 1, 2000;
526(3):
527 - 539.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Rozman, M. Fink, G. M. Fimia, P. Sassone-Corsi, and M. R. Waterman
Cyclic Adenosine 3',5'-Monophosphate(cAMP)/cAMP-Responsive Element Modulator (CREM)-Dependent Regulation of Cholesterogenic Lanosterol 14{alpha}-Demethylase (CYP51) in Spermatids
Mol. Endocrinol.,
November 1, 1999;
13(11):
1951 - 1962.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
R. Paul, S. Silve, N. De Nys, P.-H. Dupuy, C. L.-L. Bouteiller, J. Rosenfeld, P. Ferrara, G. Le Fur, P. Casellas, and G. Loison
Both the Immunosuppressant SR31747 and the Antiestrogen Tamoxifen Bind to an Emopamil-Insensitive Site of Mammalian Delta 8-Delta 7 Sterol Isomerase
J. Pharmacol. Exp. Ther.,
June 1, 1998;
285(3):
1296 - 1302.
[Abstract]
[Full Text]
|
 |
|
Copyright © 1997 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|