Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jump, D. B.
Right arrow Articles by Thelen, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jump, D. B.
Right arrow Articles by Thelen, A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 44, Issue of October 31, 1997 pp. 27778-27786

The CCAAT Box Binding Factor, NF-Y, Is Required for Thyroid Hormone Regulation of Rat Liver S14 Gene Transcription*

(Received for publication, June 23, 1997, and in revised form, August 6, 1997)

Donald B. Jump Dagger , Maria V. Badin § and Annette Thelen

From the Departments of Physiology and Biochemistry, Michigan State University, East Lansing, Michigan 48824

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES


ABSTRACT

Triiodothyronine (T3) activates rat liver S14 gene transcription through T3 receptors (TRbeta ) binding distal thyroid hormone response elements located between -2.8 and -2.5 kilobase pairs upstream from the transcription start site. Previous studies suggested that proximal promoter elements located between -220 to -80 base pairs upstream from the 5' end of the S14 gene were involved in hormone activation of the S14 gene. This report identifies an inverted CCAAT box (or Y box) at -104ATTGG-100 as a core cis-regulatory element. Gel shift studies using rat liver nuclear proteins show that at least three CCAAT-binding factors interact with this region as follows: NF-Y and c/EBP-related proteins formed major complexes, whereas NF-1/CTF forms a minor complex in gel shift assay. Mutation of the Y box indicated that loss of NF-Y binding, but not c/EBP or NF-1, correlated closely with a decline in basal activity and a loss of T3-mediated transactivation. Substitution of the S14 Y box in reporter genes with elements binding only NF-Y elevated basal activity and T3-mediated transactivation, whereas substitution with elements binding c/EBP-related proteins or SP1 displayed low basal activity and T3-mediated transactivation. These studies indicate that NF-Y and TRbeta functionally interact to confer T3 control to the S14 gene.


INTRODUCTION

Thyroid hormone, i.e. triiodothyronine (T3),1 receptors are members of the steroid/thyroid supergene family (1). T3 receptors mediate changes in gene expression by binding thyroid hormone response elements (TREs) as heterodimers with the retinoid X receptor (RXR). Transfection and cell-free transcription studies have shown that artificial promoters containing a TATA box and hormone response element (HRE) are sufficient to achieve hormone-regulated transcription (2-4). T3 receptors interact directly with the preinitiation complex (PIC) through general transcription factors (GTFs), like TFIIB or indirectly through co-activators, e.g. SRC-1 or TRIP1 and co-integrators, e.g. CBP/p300 or co-repressors, e.g. SMRT or N-CoR (5-9).

In natural promoters, however, nuclear receptor regulation of gene transcription is more complex. HREs are frequently found at a distance from the TATA box requiring chromatin folding to facilitate receptor-PIC interaction (10-15). Moreover, receptors functionally interact with other transcription factors, often binding in the vicinity of the HRE (12-24). Such interaction can synergistically induce or repress transcription. Regulation of the activity of these ancillary transcription factors can significantly impact overall promoter activity (16).

The rat liver S14 gene has served as a model for multifactorial regulation of hepatic gene transcription. Hepatic S14 gene transcription is induced by T3, dietary carbohydrate, and insulin (14, 15, 25-36). Starvation, diabetes, polyunsaturated fatty acids, and elevation of intracellular cAMP suppress hepatic S14 gene transcription (26, 31, 32). T3 induces mRNAS14 in liver, lactating mammary gland, and white adipose tissue but not cultured 3T3-L1 or 3T3-F442A adipocytes (25, 33, 34). Instead, glucocorticoids and retinoic acid replace T3 as the major transcriptional activator of S14 in cultured fat cells (33, 34). In brain, heart, kidney, lung, spleen, testes, and pituitary, mRNAS14 is expressed at <1% of the liver level and is not regulated by T3 (14). The cis-regulatory targets for the hormonal, nutritional, and tissue-specific regulation are located within two upstream enhancers and the proximal promoter. Three TREs are found within the thyroid hormone response region (TRR) located between -2.8 and -2.5 kb upstream from the transcription start site. Each TRE binds TR/RXR heterodimers and functionally interacts to confer T3 control to the cis-linked gene (15, 25, 29, 30). The targets for carbohydrate, insulin, retinoic acid, and glucocorticoid control are found in a second enhancer located between -1.6 and -1.4 kb (28, 32). Since glucocorticoids and retinoic acid do not regulate hepatic S14 gene transcription,2 this region is designated a carbohydrate response region (CHO-RR).

In addition to these upstream enhancers, proximal promoter elements located between -220 and -80 bp upstream from the 5' end of the gene have also been found to contribute to the tissue-specific expression of the gene (35, 36). This region is upstream from the transcription start site and a functional TATA box at -27/-21 bp and NF-1 site at -63/-48 bp. It binds tissue-specific factors that augment the rate of initiation of gene transcription (35, 36) as well as serving as a target for fatty acid-regulated transcriptional suppression (31). In this report, we have identified a key cis-acting element within this region and the transcription factor that binds this element. These studies show that this factor interacts functionally with T3 receptors to control hepatic S14 gene transcription.


EXPERIMENTAL PROCEDURES

Construction of S14 Promoter Deletions

Construction of S14CAT fusion genes containing the full-length S14 promoter (-4315/+19) or the S14TRR (-2.8/-2.5 kb) fused upstream from proximal promoter deletions (-290/+19; -220/+19; -120/+19; -80/+19; -40/+19) were described previously (31).

Block and Linker-scanning Mutations within the S14 Proximal Promoter

Block mutations within the S14 proximal promoter were constructed by using a modification of a two-step PCR-based approach (37). All oligonucleotides for PCR were synthesized by the MSU Biochemistry Department Macrostructure Facility. A block mutation was installed within the S14 proximal promoter by PCR to give a reporter plasmid containing the S14 promoter (-2900/+19) with a deletion from -69/-130 bp. The template plasmid contains +19 to -2900 bp within pCATAN with an NsiI restriction site at -129 bp (Nat or S171). The NsiI site was installed during the course of preparing linker-scanning mutants and does not inhibit S14CAT activity (see below and Fig. 2). The template was digested with NsiI and amplified (Perkin-Elmer, Gene Amp-XL-PCR Kit) using primers containing an NsiI site to generate the block mutation. The primers used to synthesize S14CAT-BL1 were as follows: DJ 64, AAAATGCATAT-130TATCAGGCGATCCATCTACCCAGGG; and DJ107, TTTATTATATGCATTA-69TGGGTTTTGGCGTCCTGTCA. The amplified products were digested with NsiI, ligated, and used to transform Escherichia coli DH5alpha . Purified plasmids were characterized by restriction digestion, and mutations were verified by DNA sequence analysis (38).


Fig. 2. Effect of block and linker-scanning mutations within the proximal promoter on S14 gene transcription. The diagram illustrates the native (Nat, -2897/+19 bp) promoter and the location of a block mutation between -129/-69 bp (Bl1). The location of the five linker-scanning mutations is also illustrated as follows: MUT1 (-129/-120), MUT2 (-111/-102), MUT3 (-103/-94), MUT4 (-95/-86), and MUT5 (-79/-70). Primary rat hepatocytes were transiently transfected and treated with T3 as described in Fig. 1. Cells were co-transfected with MLVTRbeta 1 along with a S14CAT reporter gene: native (Nat1) S14CAT (-2897/+19), block (Bl1) or mutant (Mut 1-5) S14CAT fusion genes. After 48 h of T3 treatment cells were harvested for measurement of protein and CAT activity. The data are taken from two separate studies involving triplicate samples. The results are represented Fold Induction by T3 as mean ± S.E., n = 6.

[View Larger Version of this Image (17K GIF file)]


Construction of Linker-scanning Mutations

Linker-scanning mutations within the S14 promoter were constructed using a modification of the two-step PCR-based method (37). Briefly, two PCR primers were synthesized to contain S14 sequences located at the 5' and 3' ends of the S14 gene along with the cloning sites, BamHI and XhoI, respectively. The S14CAT124 plasmid was used as template, and Vent polymerase was used for DNA synthesis via PCR. The 5' primer (DJ29(sense), 5' TATTATTBamHIGGAT-2900CCTGACGTAGCGGAGGATAGAAGAT) contains an artificial BamHI site, and the authentic sequence begins at -2900 bp. The 3' primer DJ44(antisense), 5' ATATATXhoICTCGAGG+19TGCTTCCTTCTCAGAG) contains an artificial XhoI downstream from +19 bp. This 2930-bp fragment resulting from PCR was digested with BamHI and HindIII (cuts at -2111 bp) to generate a 819-bp fragment that was cloned into S14CAT126 containing sequences from -2111 to +19 bp. The result of this construction was a S14 promoter extending from -2930 to +19 bp cloned upstream from CAT. This construct contains the native S14 sequence.

Linker-scanning mutations were created using two oligonucleotides containing an artificial NsiI (ATGCAT) site. There are no NsiI sites within the S14 promoter (between -2930 and +19 bp). To construct a linker-scanning mutation between -119 to -130 bp, the 5' sense primer (primers DJ63, AAANsiIATGCATAT-119CGACCAAACGCTGGGATTGGCTCAA) in conjunction with DJ44 primer (see above) was used to synthesize a DNA fragment that was cloned into the NsiI/XhoI site of BL-CATAN(BH-NsiI) (multicloning site: 5' BamHI-HindIII-SphI-PstI-SalI-NsiI-XhoI 3'). A second fragment was synthesized using the 5' sense primer DJ29 (see above) and the 3' antisense primer (DJ64, AAANsiIATGCATAT-130TATCAGGCGATCCATCTACCCAGGG). The product of this second synthesis containing BamHI/NsiI ends was cloned into the plasmid containing the -119/+19-bp element. The result of this construction was the introduction of a 10--bp block mutation from -130 to -119 bp upstream from the 5' end of the S14 gene, designated Mut1. Additional ~10-bp mutations were made as follows: Mut 2, mutation from -111 and -102 bp using primers DJ87, ATATATGCATAA-101GGCTCAAAACAAGGCCGTGT; and DJ88, TTATATGCATAA-111TTTGGTCGCCAGTGTCCGTAT; Mut 3, mutation from -103 and -94 bp using primers DJ97, AATAATTTATGCATTT-95ACAAGGCCGTGTTGATCC; and DJ104, ATTATTATATGCATTT-104TCCCAGCGTTTGGTCGCC; Mut 4, mutation from -95 and -86 bp using primers DJ113, TTTATTTTATGCATAA-85GTGTTGATCCAGTGACTG; and DJ105, TAATTTAAATGCATAA-96TGAGCCAATCCCAGCGTT; and Mut 5, mutation from -79 and -70 bp using primers DJ107, TTTATTATATGCATTA-69TGGGTTTTGGCGTCCTGTCA; and DJ106, AATAATACATGCATTC-80CAACACGGCCTTGTTTTGAG. The presence of the NsiI site along with the mutation was verified by regenerating the NsiI site and by DNA sequence analysis (38).

Construction of S14-Rous Sarcoma Virus (RSV)CAT Fusion Genes

An RSVCAT fusion gene containing only the promoter (without enhancer) from -60 to +20 bp was synthesized using primers DJ50(sense) 5' ATATAPstICTGCAGACCACTGAATTCCGCATTGCAGAGAT and DJ49(antisense) 5' ATATAXhoICTCGAGTGGTGAATGGTCAAATGGCGTTTATT and RSVCAT containing both enhancer and promoter regions as template (39). The 5' and 3' primers contained artificial restriction sites (PstI and XhoI) for directional cloning in BL-CATAN to generate RSVCAT103. Insertion of a single S14TRR (-2.9/-2.5 kb) at an upstream BamHI site generated RSVCAT127. S14 promoter elements from -220/-80 and -220/-120 were generated using PCR amplification and the primer pairs DJ51(sense) 5' ATATAHindIIIAAGCTTAGCAGTTGGCCGCCCACTGA and DJ52(antisense) 5' ATATAPstICTGCAGCAACACGGCCTTGTTTTGAGCCAAT) or DJ51 and DJ53(antisense) 5' ATATPstICTGCAGTGTCCGTATCAGGCGATCCATC) to give R134 and R116, respectively. Oligo 54(upper) 5' AGCTTCAAACGCTGGGATTGGCTCAAAACAAGGCCTGCA and oligo 55(lower) 5' GGCCTTGTTTTGAGCCAATCCCAGCGTTTGA were annealed and ligated directionally into the R127 plasmid to give R117, i.e. a plasmid containing the S14 -120/-80-bp region. RSVCAT126 (R126) was constructed by replacing the S14 TRR in R117 with a canonical TRE, i.e. a tetramer of a DR + 4, gatcctcAGGTCACAGGAGGTCAgag.

Oligonucleotides containing 3-bp mutations between -113 and -88 bp, or the albumin C-region (5' AGCTTGGGTAGGAACCAATGAAATCTGCA) and albumin D-region (5' AGCTTTGGTATGATTTTGTAATGGGGTACTGCA) were synthesized with HindIII/PstI ends. Complementary pairs of oligonucleotides were annealed and ligated to R127. All the mutations were verified by DNA sequence analysis.

Hepatocytes and Transfection

Rat primary hepatocytes were prepared and plated into 60-mm dishes Primaria culture plates at 3 × 106 cells/plate (31). After a 2-4-h attachment period in Williams E media (Life Technologies, Inc.) supplemented with 10% fetal calf serum, 10 nM dexamethasone, 1 µM insulin, and 25 mM glucose, cells were washed with phosphate-buffered saline, switched to a serum-free Williams E media, and co-transfected with cesium chloride-purified reporter genes and the MLV-thyroid hormone receptor beta 1 expression vector (MLV-TRbeta 1). Cells were transfected using Lipofectin (Life Technologies, Inc.) at a ratio of 6.6 µg of Lipofectin to 1 µg of DNA. Two µg of CAT reporter gene and 1 µg of MLV-TRbeta 1 were added per plate. Some studies involved assessment of transfection efficiency using a luciferase expression vector (MamNeoLuc, Clontec, Inc.). MamNeoLuc was co-transfected with S14CAT/MLV-TRbeta 1 at 0.1 µg/well.

Cells were treated without and with T3 (1 µM) for 48 h with 1 media change after 24 h. Harvested cells were assayed for CAT and protein. Results are expressed as CAT activity in units (1 unit of CAT activity = 1 cpm 14C-acetylated chloramphenicol/h/100 µg protein) mean ± S.E. where the number of samples will be indicated in the figure. Expression of luciferase activity was measured using a Luciferase Assay System (Promega, Inc) and a Turner luminometer. Levels of luciferase activity ranged from 0.02 to 0.1 lumin units/100 µg of protein/min.

Gel Shift Analysis

Nuclear extracts used for gel shift analysis were prepared from rat liver (35, 36). Gel shift analysis using rat liver nuclear extracts was carried out using the following conditions: DNAs were 32P-labeled at the 5' end using T4 polynucleotide kinase. Rat liver nuclear extract was mixed with ~5000 cpm of 32P-DNA in 25 mM Tris-Cl, pH 7.5, 40 mM KCl, 0.1% Nonidet P-40, 1 µg of poly(dI·dC), 10% glycerol, incubated for 20 min at room temperature, and electrophoresed in 8% acrylamide:bisacrylamide (75:1) with 25 mM Tris borate, pH 8.3, 0.5 mM EDTA, 0.1% Nonidet P-40, and 25 mM Tris borate, pH 8.3, 0.5 mM EDTA as buffer (35). Supershift studies using NF-Y (Rockland Immunochemicals, Gilbertsville, PA), c/EBP (Santa Cruz Biotechnology, Santa Cruz, CA) or ARP-1 (S. Karathanasis, Cyanamid, Pearl River, NY) antibodies used ~3 µl of antibody (~100 µg/ml)/reaction. Antibodies were preincubated with rat liver nuclear protein for 2 h on ice prior to addition of label DNA. Twenty min after addition of 32P-DNA, samples were electrophoretically separated (200 V for 2 h, 4 °C), and the gels were dried and exposed to x-ray film.


RESULTS

Deletion Analysis of the S14 Proximal Promoter

Fig. 1 illustrates the organization of functional elements known to control S14 gene transcription in rat liver. Previous studies have shown that elements between -220 and -80 bp of the transcription start site are important for overall promoter activity (31, 35). DNase I footprints of this region revealed a major site of DNA-protein interaction at -113/-88 bp (B-region) (35) and minor sites of interaction at -145 and -165 bp.2 To localize the cis-acting elements that function in both basal and T3-stimulated gene transcription, the S14 proximal promoter was sequentially deleted, and the S14TRR (-2.9/-2.5 kb) was placed immediately upstream from each truncated promoter construct. Primary rat hepatocytes were co-transfected with S14CAT fusion genes and a T3-receptor expression vector (MLVTRbeta 1) to examine T3 control of the S14CAT gene (31).


Fig. 1. Effect of proximal promoter deletions on T3 activation of S14 gene transcription. The S14 promoter with its upstream regulatory elements fused to a CAT reporter gene is illustrated. Each fusion gene is given an identification number from S124 to S159. The full-length plasmid, S124, contains three cis-regulatory regions between -4315 and +19 bp. The proximal promoter region (to -290 bp) contains a TATA-binding complex and binds a preinitiation complex (PIC), NF-1 and DNase I-footprinted regions for unknown factors, designated B- and C-regions (35). Two enhancers are located upstream and are labeled carbohydrate response region (CHO-RR, at -1.6/-1.4 kb) and the thyroid hormone response region (TRR, at -2.9/2.5 kb). S149, S155, S156, S158, and S159 have the S14 TRR (-2.9/-2.5 kb) fused upstream from S14 proximal promoter deletions. The 5' end point of the proximal promoter is -290, -220, -120, -80, and -40 bp, respectively. Primary rat hepatocytes were transiently transfected with a S14CAT reporter gene and a thyroid hormone receptor expression vector (MLVTRbeta 1), see "Experimental Procedures." Hepatocytes were treated with vehicle (10 µM NaOH) or T3 (1 µM) for 48 h, harvested, and assayed for CAT activity. The results are expressed in tabular form as basal S14CAT expression (CAT Units) and fold induction by T3. The data are taken from four separate studies involving triplicate samples. The results are represented as mean ± S.E., n = 12.

[View Larger Version of this Image (24K GIF file)]


In the absence of T3, basal S14CAT activity is very low in most constructs. Deletion of elements between -290 and -2500 bp leads to a ~70% decline in basal CAT expression and deletion to -80 or -40 bp leads to >95% decline in CAT activity. Analysis of luciferase activity in hepatocytes co-transfected with MamNeoLuc indicated that changes in CAT activity cannot be explained by differential transfection efficiency (not shown). The location of these deletions correlate with the presence of key cis-regulatory elements. Deletion of the -290/-2500-bp regions excises the CHO-RR, and deletion of the -80 to -120-bp region excises the B-region of the S14 proximal promoter. The B-region was previously reported to represent a key cis-regulatory element involved in the hepatic-specific initiation of S14 gene transcription (35, 36).

In the presence of T3, the full-length S124 plasmid (-4315/+19 bp) is induced 50-fold (from 127 ± 27 to 6396 ± 740 units). Moving the TRR closer to the proximal promoter increases the level of T3-mediated transactivation to 140-fold (S156). However, the constructs containing the NF-1 and the PIC sites (S158 or S159) show the same response to T3 as the full-length plasmid. Because the basal activity is reduced by >95% in the S158 and S159 constructs when compared with the full-length construct, the overall CAT activity is similarly reduced, i.e. from ~6400 CAT units in S124 to <= 250 units in S158 and S159. These findings indicate that proximal promoter elements affecting basal activity significantly impact the overall level of T3-stimulated S14CAT activity. The cis-acting elements within the proximal promoter region mediating the greatest change in both basal and T3-stimulated expression are located between -120 and -80 bp.

Block and Linker-scanning Mutations of the -120/-80-bp Region

The promoter deletion studies described in Fig. 1 placed the S14TRR immediately adjacent to the proximal promoter region. Because the S14 TRR is normally at -2.5 to -2.8 kb such a change in position may not accurately reflect the role proximal promoter elements play in hormonal control of the S14 gene. Consequently, a block mutation of the B-region was installed to assess its effect on transcription of this gene (Fig. 2). The full-length native S14CAT construct extends from -2897 bp to +19 bp (Nat1) and is induced 54-fold by T3. However, deletion of the -130/-69-bp region (Bl1) results in low basal CAT activity (31 ± 13 units) and a marginal (45%) augmentation following T3 treatment.

Because the Bl1 mutation spanned nearly 60 bp and the footprinted region (35) spanned ~25 bp, a linker scanning approach was used to localize better the key cis-regulatory elements. Accordingly, five linker-scanning mutations of ~10 bp in length were made extending from -129 to -70 bp (Fig. 2). Although mutations flanking the footprinted region (-113/-88 bp), i.e. Mut1 (-129/-120 bp) and Mut5 (-79/-70 bp) induced marginal changes in S14 CAT activity, mutations within the footprinted region had a significant effect on S14CAT activity. Mut2 (-111/-102 bp) and Mut3 (-103/-94 bp) showed very low CAT activity in the presence of T3 (10 ± 3 and 70 ± 14 CAT units, respectively), whereas Mut 4 (-95/-86) displayed an 8-fold response to T3. These studies suggest that the region between -111 and -94 bp is critical for both basal and T3-mediated activation of S14CAT activity. Co-transfection with MamNeoLuc indicated that these differences were not attributed to changes in transfection efficiency (not shown).

Mutation Analysis of the -120/-80 bp

During the course of our studies, we discovered that placing the S14TRR immediately upstream from the RSV basal promoter (-60/+20 bp; R127), which contains only a TATA box (39), led to a marginal 3-fold increase in CAT activity following T3 treatment (Fig. 3). Inserting the S14 proximal promoter elements -220/-80 bp (R134) or the -120/-80-bp region (R117) between the RSV TATA box and the S14 TRR increased both basal CAT activity and T3-mediated transactivation (12-14-fold). In contrast, inserting the -220/-120-bp region (R116) augmented basal activity but had no effect on T3-mediated transactivation when compared with R127. Replacing the S14 TRR in R117 with a canonical TRE (a tetramer of a DR + 4; R126) confers the same level of T3-mediated transactivation (12-fold) as seen with R117. However, if the -120/-80-bp region is deleted from this construct, the level of transactivation is comparable to that seen in R127 (not shown). These studies indicate that TREs are poor transcriptional enhancers in the context of the RSV TATA box. Insertion of the S14 B-region (-120/-80 bp) elevates basal expression and enhances T3-mediated transactivation from the TREs.


Fig. 3. T3 activation of the S14TRR in the context of the RSV basal promoter. A series of S14-RSVCAT reporter genes are illustrated. R103 contains a basal RSV promoter (-60 to +20 bp, RSVp) with only a TATA box, and R127 contains the RSV promoter and the S14TRR (TRR). R134, R117, and R116 contain the S14 promoter elements -220/-80, -120/-80, and -220/-120 bp, respectively, inserted between the RSV promoter and the S14 TRR. RSV126 contains the RSV promoter, the S14 -120/-80-bp region, and a tetramer of a canonical TRE, DR + 4 (cTRE). The figure illustrates the CAT activity of control and T3-treated cells. The table on the right indicates the Fold Induction by T3. The data are taken from three separate studies involving triplicate samples. The results are represented as mean ± S.E., n = 9.

[View Larger Version of this Image (23K GIF file)]


The RSVCAT model was used to define further the cis-regulatory elements within the B-region (-120/-80 bp) that function in T3-mediated transactivation of the S14 gene. The DNase I footprinting and linker-scanning mutations suggested that critical elements were located between -111 and -94 bp (Fig. 2). Accordingly, oligonucleotides with 3-bp mutations spanning the -113/-92-bp region were constructed and inserted between the S14 TRR and the RSV promoter to generate seven mutant constructs (Fig. 4). Three base pair mutations at either end of the -113/-92-bp region had no effect on T3 induction. However, mutations M4 and M5 showed a marginal 2-fold induction. This level of expression was comparable to that seen with R127, a construct containing no -120/-80 element (Fig. 3). The M4 and M5 mutations span the sequence -104ATTGGC-99, which is an inverted CCAAT box or Y box.


Fig. 4. Effect of 3-bp mutations on S14 promoter function. The schematic illustrates R117 (see Fig. 3) and the DNA sequence of the B-region. The locations of the Mut2 and Mut3 linker-scanning mutations (Fig. 2) are indicated. The B-region between -115 and -86 bp was mutated at 3-bp intervals (underlined sequence). The general scheme was to convert purines to pyrimidines (see "Experimental Procedures"). The mutated -115/-86-bp element was substituted for the B-region in the RSVCAT reporter gene; plasmid designations are native (NAT) and mutants 1-7; (M1-M7). Hepatocytes were transfected as described in Fig. 3, and the results are expressed as Fold Induction by T3. The data are taken from two separate studies involving triplicate samples. The results are represented as mean ± S.E., n = 6.

[View Larger Version of this Image (27K GIF file)]


DNA Sequence and Gel Shift Analysis of the B-region

Fig. 5A illustrates the DNA sequence for the B-region (-113/-88 bp), the inverted CCAAT box at -104/-100 bp, the location of the linker scanning, and 3-bp mutations. Gel shift analysis was used to identify proteins binding this region. Rat liver nuclear proteins (RLNP) bind 32P-B-region and form five slow migrating bands with increasing protein concentrations (Fig. 5B). Competition with a 100-fold molar excess of the native (N) sequence eliminates all shifting, whereas competition with oligonucleotides corresponding to the Mut2 (M2) and Mut3 (M3) mutations (see Fig. 2) show partial competition for bands 1-3 and no competition for bands 4 and 5. No competition was detected using a thyroid hormone response element (DR + 4). This pattern of competition along with the functional studies (Fig. 2) suggest that factors leading to the formation of bands 4 and 5 might be important for S14 promoter function.


Fig. 5. Gel shift analysis of the S14 B-region. A, the native -113/-88-bp region of the S14 B-region is illustrated along with the location of the linker-scanning mutations (Mut2-4) and the 3-bp mutations (m1-7). The inverted CCAAT box (or Y box) is outlined in a box. B, the S14 B-region (-113/-88) was 32P-labeled and used in gel shift assay with rat liver nuclear extract (RLNP); 0-4 µg RLNP/reaction. The DNA-protein complexes (bands 1-5) were electrophoretically separated as described ("Experimental Procedures"). In competition assays, RLNP (4 µg) was mixed with competing DNAs (100-fold molar excess) prior to addition of 32P-labeled B-region. B, competitor oligonucleotides were the native (N) sequence (5' GATCCAAACGCTGGGATTGGCTCAAAACAAGGCG), the MUT2 (M2: sense, 5' GATCCAA ATTATGCATAAGG CTCAAAACAAGGCG) and the MUT3 (M3: GATCCAAA CGCTGGGA AAATGCATTTAACAAGGCG) mutations functionally tested in Fig. 2. D4 is a DR + 4, (gatcctcAGGTCAGGAAGGTCAgag). This gel shift is representative of at least four separate studies with at least three different preparations of RLNP. C, a competition binding assay with 32P-labeled B-region and native (N) and mutant B-region (m1-7) as competitors (100-fold molar excess). In four out of five assays, m6 and m7 compete fully for DNA binding to 32P-labeled B-region. The sequence for the 3-bp mutations (m1-7) is shown in Fig. 4.

[View Larger Version of this Image (78K GIF file)]


Better resolution of the elements required for the formation of the specific complexes was obtained by using the oligonucleotides containing 3-bp mutations (Fig. 4). Competition gel shift analysis (Fig. 5C) with native (N) and mutant (m1, m2, m3, m6, and m7) oligonucleotides showed nearly identical competition patterns, i.e. all five bands were lost with a 100-fold competitor concentration. In contrast, oligonucleotides m4 and m5 failed to compete for the formation of bands 4 and 5. Oligonucleotide m4 competed fully for band 1 and partially for bands 2 and 3, whereas m5 competed fully for bands 1-3. The sequence of the m4 and m5 mutations covers the inverted CCAAT box (or Y box). This pattern of competition along with the functional studies shown in Fig. 4 suggest that the inverted CCAAT box and the factors leading to the formation of bands 4 and 5 are critical core elements for basal and T3-stimulated S14 gene transcription.

NF-Y, c/EBP, and NF-1 Bind the S14 CCAAT box

As an element containing a CCAAT box, we would expect CCAAT box binding factors (CBF) to bind the B-region. CBF include NF-Y (also known as CP1, CBF), c/EBP-alpha , c/EBP-beta (also know as LAP, CRP2, IL-6DBP, and NF-IL6), and c/EBP-delta (NF-IL6beta ), c/EBPgamma (Ig/EBP-1), and GADD153 (CHOP 10) (40, 41) and NF-1. NF-1 often binds these elements because a portion of the palindrome overlaps with the CCAAT box (42). To determine whether there is any specificity to binding, we used oligonucleotides that have been reported to selectively bind CBFs. The albumin promoter contains two regions binding CBFs (43). The C element binds NF-Y and the D element binds c/EBP-related proteins. We also use commercially available consensus oligonucleotides for c/EBP, NF-1, and SP1.

Using a competition gel shift approach (Fig. 6B), the albumin C element competed fully for formation of bands 4 and 5 with some effect on bands 1-3. In contrast, the albumin D element or a consensus c/EBP oligonucleotide competed for bands 2 and band 3 but not bands 4 or 5. A consensus NF-1 oligonucleotide effectively competed for band 1 and partially for bands 2 and 3. A consensus SP1 oligonucleotide failed to compete any band. For comparison, the m5 mutation (Figs. 4 and 5) failed to compete for bands 4 and 5. This profile of competition suggests that formation of band 1 is due to NF-1; band 2 and possibly 3 is due to c/EBP (or related proteins), and bands 4 and 5 form when NF-Y binds.


Fig. 6. NF-Y, c/EBP, and NF-1 bind the S14 B-region. A, the DNA sequence used in competitive gel shift analysis. The S14 B-region sequence along with the albumin C, albumin D elements, c/EBP, NF-1, and SP1 consensus sequences are shown. B, RLNP (4 µg) was used to shift 32P-labeled B-region as described in Fig. 5. Non-radioactive competitor oligonucleotides were added at a 100-fold molar excess. The competitors were albumin C-region (Alb-C), albumin D-region (Alb-D); a consensus c/EBP, NF-1, and SP-1 (Santa Cruz Biotechnology) and M5, Fig. 4. Other studies established that thyroid hormone receptors, AP1, AP2, AP3, NFkappa B, SP1, RXRalpha , PPARalpha , and HNF-4 did not bind the B-region. The results are representative of at least three gel shift assays.

[View Larger Version of this Image (41K GIF file)]


NF-1 binding (band 1) was competed by all mutations. The lack of correlation between NF-1 binding and abrogated T3-mediated transactivation (Figs. 4 and 5) suggested that NF-1 binding does not play a role in S14 promoter function at the Y box. Accordingly, our studies focused on NF-Y and c/EBP binding to the B-region. Specific antibodies were used in gel shift assays (Fig. 7). NF-Y is a heterotrimeric transcription factor composed of three subunits, A, B, and C (40). Treatment of RLNP with antibodies directed against either the A- or B-subunit led to a decline in the formation of bands 4 and 5 and the formation of slower migrating "supershifted" bands. In contrast, addition of an anti-ARP-1 antibody did not consistently affect bands 4 or 5. Based on this analysis, both bands 4 and 5 contain the A- and B-subunits of NF-Y.


Fig. 7. Antibodies to NF-Y and c/EBP interact with proteins binding the B-region. A, NF-Y antibodies (Rockland Immunochemicals) were used to test NF-Y association with the B-region. RLNP (2 µg) was incubated with 5 µg of antibodies to the NF-Y A-subunit (NF-YA), B-subunit (NF-YB), or ARP-1 for 2 h on ice. The m5 oligonucleotide was added to enhance formation of bands 4 and 5. 32P-Labeled B-region was added, and after 20 min at room temperature, the preparation was electrophoretically separated. The apparent decline in bands 4 and 5 intensity following ARP-1 antibody treatment is not seen consistently, e.g. see ARP-1 effects in B or Fig. 7. NF-Y antibodies had no consistent effect on the formation or mobility of bands 1-3 indicating specificity of the NF-Y antibodies used in these studies. B, c/EBP antibodies (Santa Cruz Biotechnology) were used to examine the association of c/EBPalpha and beta  with the S14 B-region. Native (Native) and heated (70 °C, 10 min) RLNP (4 µg) were reacted with 2 µg of antibody against c/EBP alpha  (c/EBP-A), c/EBP beta  (c/EBP-B), or ARP1, and the products were separated as described above. The autoradiogram for the Native and Heated 70 °C gel shifts were exposed for 1 and 2 days, respectively. These supershift studies are representative of three separate studies.

[View Larger Version of this Image (53K GIF file)]


A similar approach was used to examine the association of c/EBP with the S14 B-region (Fig. 7B). In the samples labeled Native, either anti-c/EBPalpha , anti-c/EBPbeta , or anti-ARP1 antibodies were added to rat liver nuclear proteins. Although anti-c/EBPalpha depleted band 2 only, no supershifted product was detected. Anti-c/EBPbeta or anti-ARP-1 antibody did not affect the mobility of any band. This observation suggests that band 2 may contain c/EBPalpha . To better resolve this issue, we took advantage of the fact that c/EBPs are heat-stable DNA-binding proteins (44). Heating rat liver nuclear proteins to 70 °C for 10 min prior to adding DNA leads to a loss of bands 1, 4, and 5 indicating that these factors are heat-sensitive. NF-1 and NF-Y are heat-labile proteins (40, 42).

Addition of the c/EBPalpha antibodies to the nuclear proteins after heating/cooling led to a selective depletion of bands 2 and 3 and a shift to a slow migrating position coincident with band 4 (Native). c/EBPbeta antibodies also produced a faint supershifted band; however, the origin of this shift cannot be determined. ARP-1 antibodies did not induce consistent changes in band intensity or mobility. These results support the competition binding studies by showing that c/EBPalpha and c/EBPbeta bind the S14 B-region to form band 2 and possibly band 3.

NF-Y, but Not c/EBP-related Proteins, Augments S14 Promoter Activity

The gel shift studies indicate that both NF-Y and c/EBP-related proteins bind the S14 B-region. To determine which factor is functional within the S14 promoter, the B-region in the R117 reporter gene was replaced with either the albumin C-region, the albumin D-region, or a composite element derived from the thymidine kinase promoter containing binding sites for Sp1 and NF-Y (Fig. 8). Substitution of the albumin C element both augments basal CAT activity and stimulates T3-mediated transactivation comparable to the RSVCAT reporter gene containing the native S14 B-region (R117). In contrast, substitution of the albumin D element led to a decline in both basal activity and T3-mediated transactivation. The composite element containing two Sp1 sites flanking an NF-Y site (Sp1-NFY-Sp1: SNS) was nearly identical to the construct containing the native S14 B-region. Substitution of a single Sp1 element failed to induce promoter activity (not shown). Based on this analysis, c/EBP-related factors and Sp1 do not function in the context of the S14 proximal promoter. In contrast, elements binding NF-Y either alone (i.e. Alb-C) or in combination with other elements (i.e. SNS) augment both basal and T3-mediated transactivation of the S14 gene. These studies indicate a specific requirement for NF-Y within the S14 proximal promoter.


Fig. 8. NF-Y, but not c/EBP, can substitute for the S14 B-region in the S14 promoter. The S14 B-region in R117 (S14-B) was replaced with either the albumin C (Alb-C), albumin D (Alb-D), or and composite element from the thymidine kinase promoter containing 2-SP1 flanking an NF-Y site (SNS). After transfection, cells were treated with T3 as described in Fig. 3. Open bars, no T3 treatment; closed bars, T3 treatment. Results are representative of two separate experiments with triplicate samples. Mean ± S.E., n = 6.

[View Larger Version of this Image (20K GIF file)]



DISCUSSION

We previously reported that elements within the S14 proximal promoter B-region (-157/-88 bp) were important for tissue-specific regulation of hepatic S14 gene transcription (35, 36). In this report, a combination of deletion and block mutations along with linker analysis and 3-bp mutations was used to localized a key cis-regulatory element within this region to an inverted CCAAT box, -105GATTGGC-100 (or Y box). Mutations within this element lower basal activity and essentially abrogate T3-mediated transactivation of the S14 gene (Figs. 2, 3, 4). The Y box and immediate flanking sequences (-107GGGATTGG CTCAAAACAAG-89) show 80% identity to an NF-Y consensus sequence (CTGATTGGYY), ~44% identity to a c/EBP consensus sequence (ATTGCNNAA), and ~83% identity to a NF-1 palindromic recognition site (TTGGCTN3AGCCAA, reverse) (20, 45-48). At least three CBFs, i.e. NF-Y, NF-1, and c/EBP-related proteins, bind this element (Fig. 5-7). However, only NF-Y augments basal activity and stimulates T3-mediated transactivation (Fig. 8). Substituting a single Sp1 site for the B-region also failed to elevate basal or enhance T3-mediated transactivation.2 Such results indicate that although several CBF can potentially bind the B-region, there is a specific requirement for NF-Y for both basal and T3-mediated transactivation. The Y box, together with the distal TREs, forms a functional T3-regulatory unit. The functional synergy between the TREs and the Y box indicates that proximal promoter elements play an important role in hormone-activated gene transcription.

NF-Y (also known as CBF, CP1, and YEBP) is a heterotrimeric transcription factor composed of three subunits (A, 42 kDa; B, 35 kDa; C, 40 kDa) (40, 43, 45, 47, 49-57). NF-Y shows a wide tissue distribution and is highly conserved. The A- and B-subunits show homology to the yeast CCAAT box binding transcription factors HAP 3 and 2, respectively. Formation of a complex between the A- and C-subunits is required to bind the B-subunit, and together, the heterotrimeric complex binds DNA (57). The B-subunit has a glutamine-rich area and a serine/threonine-rich region on the amino-terminal end; both are required for full transcriptional activation (54). The hydrophilic carboxyl-terminal end is rich in basic residues and contains distinct subunit interaction and DNA binding domains.

NF-Y binds CCAAT boxes located within ~100 bp of the transcription start sites, and these elements are known to be important for early functions in preinitiation complex formation (43, 49). The B-subunit may interact with the preinitiation complex through TAF110 (54). NF-Y also has been reported to interact with transcription factors binding upstream elements. For example, c/EBPalpha and NF-Y both bind within a 40-bp element of the albumin promoter. These factors functionally interact to enhance the rate of initiation of albumin gene transcription (43). Similar results have been reported for the major histocompatibility complex DRA and Ii promoters (46, 52, 56). Although these studies implicate a functional interaction between NF-Y and other transcription factors, a specific role for NF-Y in transcription remains to be established.

The interaction between NF-Y and other transcription factors is reminiscent of the role ancillary factors play in nuclear receptor action. Nuclear receptors interact directly with the preinitiation complex through general transcription factors (GTFs) or indirectly through co-activators, co-integrator or co-repressors (5-9). However, numerous reports have indicated a requirement for ancillary factors in nuclear receptor control of gene transcription (12-24). The HREs and the ancillary factor binding sites are typically located within a 200-bp region and form hormone-responsive units. For example, the glucocorticoid response unit in the phosphoenolpyruvate carboxykinase promoter has a specific requirement for HNF-3 (23, 24). T3 control of gene transcription involves interaction between TRbeta and c/EBPalpha (17, 18). The proximity of the HRE to the ancillary factor binding sites and restraints on spacing between binding sites implicates protein-protein interaction as a possible explanation for ancillary factor involvement in nuclear receptor action. How these interactions translate into enhanced hormone-mediated transactivation has not been resolved.

The S14 TRR consists of three TREs each binding TRbeta /RXR heterodimers within a 200-bp region. Since the S14 TRR and a canonical TRE give nearly identical results when fused to the RSV (Fig. 3) or TK2 promoters, there would appear to be no requirement for additional factors binding within this region. Interestingly, neither the S14TRR nor DR + 4s confer robust T3 control to the RSV promoter in the absence of a Y box suggesting that a functional S14 T3 response unit consists of the TRE and Y box. Since other T3-responsive genes do not contain Y boxes, e.g. the phosphoenolpyruvate carboxykinase promoter, the NF-Y/Y box is likely not a general requirement for T3 activation of gene transcription. Some clue to the role the Y box plays in S14 gene transcription may be the fact that TRR and the Y box are separated by >2.5 kb. Such a separation argues against cooperative binding and implicates a requirement for chromatin looping to bring the S14 TRR into juxtaposition to the TATA box so that TRbeta /RXR heterodimers can interact with GTFs. The Y box is situated within a DNase I-hypersensitive site that forms just prior to hepatic S14 gene activation during post-natal development (58). T3 administration to the pre-weaned rat cannot activate this gene prior to weaning despite the presence of functional T3 receptors (59). Whether NF-Y functions to maintain this open chromatin structure or facilitates TR/RXR-GTFs interaction will require additional experimentation.

An important outcome of these studies was the finding that T3-mediated transactivation could be controlled by the composition of the proximal promoter region. The S14 proximal promoter is a target for tissue-specific factors that augment hepatic gene transcription (35, 36) and fatty acid-regulated factors that attenuate S14 gene transcription (31). The Y box and NF-Y are key functional elements within this region. The ubiquitous tissue distribution of NF-Y cannot account for the hepatic specific augmentation in the initiation of S14 gene transcription (35, 36). Moreover, NF-Y, per se, is likely not the target of fatty acid control because fatty acids do not suppress TK promoter activity, a promoter binding NF-Y (31). Preliminary studies have indicated that elements upstream from the Y box are also important for S14 gene transcription.2 We speculate that these upstream elements bind tissue-specific factors that together with NF-Y will be important for tissue-specific and fatty acid-regulated control of S14 gene transcription.

In conclusion, T3-mediated transactivation of the S14 gene requires NF-Y as a crucial factor binding the S14 proximal promoter. Despite the fact that the TR/RXR and NF-Y binding sites are separated by >2.5 kb, NF-Y and TR/RXR functionally interact to confer T3 control to the hepatic S14 gene. Although several CBFs bind this element, only NF-Y was found to enhance both basal and T3-stimulated transactivation. This represents the first report of NF-Y participation in T3-regulated gene transcription. Further experimentation should clarify the role NF-Y plays in these processes.


FOOTNOTES

*   This work was supported in part by National Institutes of Health Grant DK43220.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Dagger    To whom correspondence should be addressed. Tel.: 517-355-6475 (ext. 1246); Fax: 517-355-5125; E-mail: Jump{at}pilot.msu.edu.
§   Recipient of a National Science Foundation Graduate Research Fellowship.
1   The abbreviations used are: T3, triiodothyronine; TR, thyroid hormone receptor; TRE, thyroid hormone response element; TRR, thyroid hormone response region; CHO-RR, carbohydrate response region; RXR, retinoid X receptor; GTF, general transcription factors; CBF, CCAAT box binding factors, PIC, preinitiation complex; CAT, chloramphenicol acetyltransferase; HRE, hormone response element; bp, base pair(s); kb, kilobase pair(s); PCR, polymerase chain reaction; RLNP, rat liver nuclear extract; MLV, murine leukemia virus; RSV, Rous sarcoma virus.
2   A. Thelen and D. B. Jump, unpublished observations.

ACKNOWLEDGEMENTS

We thank R. Miksicek and K. Olson for critical review of the manuscript.


REFERENCES

  1. Beato, M., and Sanchez-Pacheco, A. (1996) Endocr. Rev. 17, 587-609 [Abstract/Free Full Text]
  2. Schatt, M. D., Rusconi, S., and Schaffner, W. (1990) EMBO J. 9, 481-487 [Medline] [Order article via Infotrieve]
  3. Elliston, J. F. S., Fawell, S. E., Klein-Hitpass, L., Tsai, S. Y., Tsai, J. J., Parker, M. G., and O'Malley, B. W. (1990) Mol. Cell. Biol. 10, 6607-6612 [Abstract/Free Full Text]
  4. Tong, G.-X., Tanen, M. R., and Bagchi, M. K. (1995) J. Biol. Chem. 270, 10601-10611 [Abstract/Free Full Text]
  5. Baniahman, A., Ha, I., Reinberg, D., Tsai, S., Tsai, M. J., and O'Malley, B. W. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 8832-8836 [Abstract/Free Full Text]
  6. Tone, Y., Collingwood, T. N., Adams, M., and Chatterjee, V. K. (1994) J. Biol. Chem. 269, 31157-31161 [Abstract/Free Full Text]
  7. Onate, S. A., Tsai, S. Y., Tsai, M. J., and O'Malley, B. W. (1995) Science 270, 1354-1357 [Abstract/Free Full Text]
  8. Kami, Y., Xu, L., Heinzel, T., Torchia, J., Kurokawa, R., Gloss, B., Lin, S. C., Hayman, R. A., Rose, D. W., Glass, C. K., and Rosenfeld, M. G. (1996) Cell 85, 403-414 [CrossRef][Medline] [Order article via Infotrieve]
  9. Chakravarti, D., LaMorte, V. J., Melson, M. C., Kakajima, T., Schulman, I. G., Juguilon, H., Montminy, M., and Evans, R. M. (1996) Nature 383, 99-103 [CrossRef][Medline] [Order article via Infotrieve]
  10. Desvergne, B., Petty, K., and Nikodem, V. (1991) J. Biol. Chem. 266, 1088-1013
  11. Brent, G. A., Larsen, P. R., Harney, J. W., Koenig, R. J., and Moore, D. D. (1989) J. Biol. Chem. 264, 178-182 [Abstract/Free Full Text]
  12. Schule, R., Muller, M., Kaltschmidt, C., and Renkawitz, R. (1988) Science 242, 1418-1420 [Abstract/Free Full Text]
  13. Strahle, U., Schmid, W., and Schutz, G. (1988) EMBO J. 7, 3389-3395 [Medline] [Order article via Infotrieve]
  14. Jump, D. B., and Oppenheimer, J. H. (1984) Endocrinology 117, 2259-2266 [Abstract/Free Full Text]
  15. Jump, D. B., Bell, A., and Santiago, V. (1990) J. Biol. Chem. 265, 3474-3478 [Abstract/Free Full Text]
  16. Roesler, W. J., Graham, J. G., Kolen, R., Klemm, D. J., and McFie, P. J. (1995) J. Biol. Chem. 270, 8225-8232 [Abstract/Free Full Text]
  17. Park, E. S., Jerden, D. C., and Bahouth, S. W. (1995) Biochem. J. 309, 913-919
  18. Park, E. S., Song, S., Olive, M., and Roesler, W. J. (1997) Biochem. J. 322, 343-349
  19. Voz, M. L., Peers, B., Weidig, M. J., Jacquemin, P., Belayew, A., and Martial, J. A. (1992) Mol. Cell. Biol. 12, 3991-3997 [Abstract/Free Full Text]
  20. Scott, D. K., Mitchell, J. A., and Granner, D. K. (1996) J. Biol. Chem. 271, 31909-31914 [Abstract/Free Full Text]
  21. Harendza, S., Pollock, A. S., Mertens, P. R., and Lovett, D. H. (1995) J. Biol. Chem. 270, 18786-18796 [Abstract/Free Full Text]
  22. Mitchell, J., Noisen, E., Hall, R., O'Brien, R., Imai, E., and Granner, D. (1994) Mol. Endocrinol. 8, 585-594 [Abstract/Free Full Text]
  23. Wang, J.-C., Stromstedt, P.-E., O'Brien, R. M., and Granner, D. K. (1996) Mol. Endocrinol. 10, 794-800 [Abstract/Free Full Text]
  24. Cordingley, M. G., Riegel, A. T., and Hager, G. L. (1987) Cell 48, 261-271 [CrossRef][Medline] [Order article via Infotrieve]
  25. Jump, D. B. (1989) J. Biol. Chem. 264, 4698-4703 [Abstract/Free Full Text]
  26. Jump, D. B., Bell, A., Lepar, G., and Hu, D. (1990) Mol. Endocrinol. 4, 1655-1660 [Abstract/Free Full Text]
  27. Jacoby, D. B., Zilz, N. D., and Towle, H. C. (1989) J. Biol. Chem. 264, 17623-17626 [Abstract/Free Full Text]
  28. Shih, H. M., and Towle, H. C. (1992) J. Biol. Chem. 267, 13222-13228 [Abstract/Free Full Text]
  29. Zilz, N. D., Murray, M. B., and Towle, H. C. (1990) J. Biol. Chem. 265, 8136-8143 [Abstract/Free Full Text]
  30. Liu, H. C., and Towle, H. C. (1994) Mol. Endocrinol. 8, 1021-1037 [Abstract/Free Full Text]
  31. Jump, D. B., Clarke, S. D., MacDougald, O. A., and Thelen, A. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 8454-8458 [Abstract/Free Full Text]
  32. Sudo, Y., and Mariash, C. N. (1994) Endocrinology 134, 2532-2540 [Abstract/Free Full Text]
  33. Lepar, G. J., and Jump, D. B. (1989) Mol. Endocrinol. 3, 1207-1214 [Abstract/Free Full Text]
  34. MacDougald, O. A., and Jump, D. B. (1992) Biochem. Biophys. Res. Commun. 188, 470-476 [CrossRef][Medline] [Order article via Infotrieve]
  35. MacDougald, O. A., and Jump, D. B. (1990) Biochem. J. 280, 761-767
  36. MacDougald, O. A., Clarke, S. D., and Jump, D. B. (1992) Biochem. Biophys. Res. Commun. 182, 631-637 [CrossRef][Medline] [Order article via Infotrieve]
  37. Ho, S. H., Hunt, H. D., Horton, R. M., Pullen, J. K., and Pease, L. R. (1989) Gene (Amst.) 77, 51-59 [CrossRef][Medline] [Order article via Infotrieve]
  38. Sanger, F., Nickles, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A. 74, 5463-5467 [Abstract/Free Full Text]
  39. Yamamoto, T., Jay, G., and Pastan, I. (1980) Proc. Natl. Acad. Sci. U. S. A. 77, 176-180 [Abstract/Free Full Text]
  40. Maity, S. N., Sinha, S., Ruteshouser, E. C., and de Crombrugghe, B. (1992) J. Biol. Chem. 267, 16574-16580 [Abstract/Free Full Text]
  41. Sylvester, S. L., ap Rhys, C. M. J., Luethy-Martindale, J. D., and Holbrook, N. J. (1994) J. Biol. Chem. 269, 20119-20125 [Abstract/Free Full Text]
  42. Gronostajski, R. M. (1986) Nucleic Acids Res. 14, 9117-9129 [Abstract/Free Full Text]
  43. Milos, P. M., and Zaret, K. S. (1992) Genes Dev. 6, 991-1004 [Abstract/Free Full Text]
  44. Johnson, P. F., Landschulz, W. H., Graves, B. J., and McKight, S. L. (1987) Genes Dev. 1, 133-146 [Abstract/Free Full Text]
  45. Hatamochi, A., Golumbek, P. T., Van Schaftingen, E., and de Crombrugghe, B. (1989) J. Biol. Chem. 263, 5940-5947 [Abstract/Free Full Text]
  46. Wright, K. L., Moore, T. L., Vilen, B. J., Brown, A. M., and Ting, J. P.-Y. (1995) J. Biol. Chem. 270, 20978-20986 [Abstract/Free Full Text]
  47. Osawa, H., Robey, R. B., Printz, R. L., and Granner, D. K. (1996) J. Biol. Chem. 271, 17296-17303 [Abstract/Free Full Text]
  48. Jones, K. A., Kadonaga, J. T., Rosenfeld, P. J., Kelly, T. J., and Tjian, R. (1987) Cell 48, 79-87 [CrossRef][Medline] [Order article via Infotrieve]
  49. Dorn, A., Bollenkens, J., Staub, A., Benoist, C., and Mathis, D. (1987) Cell 50, 863-872 [CrossRef][Medline] [Order article via Infotrieve]
  50. Bucher, P. (1990) J. Mol. Biol. 212, 563-578 [CrossRef][Medline] [Order article via Infotrieve]
  51. Maity, S. N., Vuorio, T., and de Crombrugghe, B. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 5378-5382 [Abstract/Free Full Text]
  52. van Huijsduijnen, R. H., Li, X. Y., Black, D., Matthes, H., Benoist, C., and Mathis, D. (1990) EMBO J. 9, 3119-2127 [Medline] [Order article via Infotrieve]
  53. Vuorio, T., Maity, S. N., and de Crombrugghe, B. (1990) J. Biol. Chem. 265, 22480-22486 [Abstract/Free Full Text]
  54. Coustry, F., Maity, S. N., and de Crombrugghe, B. (1995) J. Biol. Chem. 270, 468-475 [Abstract/Free Full Text]
  55. Mantovani, R., Pessara, U., Tronche, F., Li, X. Y., Knapp, A. M., Pasquali, J. L., Benoist, C., and Mathis, D. (1992) EMBO J. 11, 3315-3322 [Medline] [Order article via Infotrieve]
  56. Wright, K. L., Vilen, B. J., Itho-Linstrom, Y., Moore, T. L., Li, G., Criscitiello, M., Cogwsell, P., Clarke, J. B., and Ting, J. P. Y. (1994) EMBO J. 13, 4042-4053 [Medline] [Order article via Infotrieve]
  57. Sinha, S., Maity, S. H., Lu, J., and de Crombrugghe, B. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 1624-1628 [Abstract/Free Full Text]
  58. Jump, D. B., Veit, A., Santiago, V., Lepar, G., and Herberholz, L. (1988) J. Biol. Chem. 263, 7254-7260 [Abstract/Free Full Text]
  59. Jump, D. B., Tao, T. Y., Towle, H. C., and Oppenheimer, J. H. (1986) Endocrinology 118, 1892-1896 [Abstract/Free Full Text]

Volume 272, Number 44, Issue of October 31, 1997 pp. 27778-27786
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
X. Luo, J. Xiao, H. Lin, Y. Lu, B. Yang, and Z. Wang
Genomic structure, transcriptional control, and tissue distribution of HERG1 and KCNQ1 genes
Am J Physiol Heart Circ Physiol, March 1, 2008; 294(3): H1371 - H1380.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
S.-k. Park, S.-Y. Oh, M.-Y. Lee, S. Yoon, K.-S. Kim, and J.-w. Kim
CCAAT/Enhancer Binding Protein and Nuclear Factor-Y Regulate Adiponectin Gene Expression in Adipose Tissue
Diabetes, November 1, 2004; 53(11): 2757 - 2766.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Pawar, D. Botolin, D. J. Mangelsdorf, and D. B. Jump
The Role of Liver X Receptor-{alpha} in the Fatty Acid Regulation of Hepatic Gene Expression
J. Biol. Chem., October 17, 2003; 278(42): 40736 - 40743.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Jackson-Hayes, S. Song, E. N. Lavrentyev, M. S. Jansen, F. B. Hillgartner, L. Tian, P. A. Wood, G. A. Cook, and E. A. Park
A Thyroid Hormone Response Unit Formed between the Promoter and First Intron of the Carnitine Palmitoyltransferase-Ialpha Gene Mediates the Liver-specific Induction by Thyroid Hormone
J. Biol. Chem., February 28, 2003; 278(10): 7964 - 7972.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
B. Zandieh Doulabi, M. Platvoet-ter Schiphorst, H. C. van Beeren, W. T. Labruyere, W. H. Lamers, E. Fliers, O. Bakker, and W. M. Wiersinga
TR{beta}1 Protein Is Preferentially Expressed in the Pericentral Zone of Rat Liver and Exhibits Marked Diurnal Variation
Endocrinology, March 1, 2002; 143(3): 979 - 984.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
P. Lichtlen, Y. Wang, T. Belser, O. Georgiev, U. Certa, R. Sack, and W. Schaffner
Target gene search for the metal-responsive transcription factor MTF-1
Nucleic Acids Res., April 1, 2001; 29(7): 1514 - 1523.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. Menendez-Hurtado, A. Santos, and A. Perez-Castillo
Characterization of the Promoter Region of the Rat CCAAT/Enhancer-Binding Protein {alpha} Gene and Regulation by Thyroid Hormone in Rat Immortalized Brown Adipocytes
Endocrinology, November 1, 2000; 141(11): 4164 - 4170.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. K. Mater, A. P. Thelen, D. A. Pan, and D. B. Jump
Sterol Response Element-binding Protein 1c (SREBP1c) Is Involved in the Polyunsaturated Fatty Acid Suppression of Hepatic S14 Gene Transcription
J. Biol. Chem., November 12, 1999; 274(46): 32725 - 32732.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
M. K . Mater, A. P. Thelen, and D. B. Jump
Arachidonic acid and PGE2 regulation of hepatic lipogenic gene expression
J. Lipid Res., June 1, 1999; 40(6): 1045 - 1052.
[Abstract] [Full Text]


Home page
Mol. Cell. Biol.Home page
U. Dressel, D. Thormeyer, B. Altincicek, A. Paululat, M. Eggert, S. Schneider, S. P. Tenbaum, R. Renkawitz, and A. Baniahmad
Alien, a Highly Conserved Protein with Characteristics of a Corepressor for Members of the Nuclear Hormone Receptor Superfamily
Mol. Cell. Biol., May 1, 1999; 19(5): 3383 - 3394.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. A. Park, S. Song, C. Vinson, and W. J. Roesler
Role of CCAAT Enhancer-binding Protein beta  in the Thyroid Hormone and cAMP Induction of Phosphoenolpyruvate Carboxykinase Gene Transcription
J. Biol. Chem., January 1, 1999; 274(1): 211 - 217.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. C. Thurmond, R. A. Baillie, and A. G. Goodridge
Regulation of the Action of Steroid/Thyroid Hormone Receptors by Medium-chain Fatty Acids
J. Biol. Chem., June 19, 1998; 273(25): 15373 - 15381.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. S. Jansen, G. A. Cook, S. Song, and E. A. Park
Thyroid Hormone Regulates Carnitine Palmitoyltransferase Ialpha Gene Expression through Elements in the Promoter and First Intron
J. Biol. Chem., November 3, 2000; 275(45): 34989 - 34997.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Wang, L. Yin, and F. B. Hillgartner
The Homeodomain Proteins PBX and MEIS1 Are Accessory Factors That Enhance Thyroid Hormone Regulation of the Malic Enzyme Gene in Hepatocytes
J. Biol. Chem., June 22, 2001; 276(26): 23838 - 23848.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. B. Jump, A. P. Thelen, and M. K. Mater
Functional Interaction between Sterol Regulatory Element-binding Protein-1c, Nuclear Factor Y, and 3,5,3'-Triiodothyronine Nuclear Receptors
J. Biol. Chem., September 7, 2001; 276(37): 34419 - 34427.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jump, D. B.
Right arrow Articles by Thelen, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jump, D. B.
Right arrow Articles by Thelen, A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1997 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement