|
|
|
|||||||
|
|||||||||
Volume 272, Number 45, Issue of November 7, 1997
pp. 28210-28217
(Received for publication, March 17, 1997, and in revised form, July 25, 1997)
From the U.325 INSERM, Département
d'Athérosclérose, Institut Pasteur,
59019 Lille, France
ABSTRACT Intracellular fatty acid (FA)
concentrations are in part determined by a regulated import/export
system that is controlled by two key proteins, i.e. fatty
acid transport protein (FATP) and acyl-CoA synthetase (ACS), which
respectively facilitate the transport of FAs across the cell membrane
and their esterification to prevent their efflux. The aim of this
investigation was to analyze the expression pattern of FATP and ACS and
to determine whether their expression was altered by agents that affect
FA metabolism through the activation of peroxisome
proliferator-activated receptors (PPAR) such as the fibrates and
thiazolidinediones. FATP mRNA was ubiquitously expressed, with
highest levels being detected in adipose tissue, heart, brain, and
testis. Fibrate treatment, which is known to preferentially activate
PPAR INTRODUCTION Transmembrane transport of
FAs1 is still poorly
understood despite intense investigation. Uncharged molecules and weak
acids such as fatty acids can cross membranes rapidly thanks to their lipid solubility. The rate of movement is controlled by mass action and
can be enhanced by proteins such as fatty acid-binding protein that act
as a cytoplasmic "sink." Recently, however, several studies provided evidence that in addition to these nonfacilitated systems, facilitated transport also contributes to FA transport (1). Several
proteins were hypothesized to be acting as FA transporters. Among
these, three deserve further attention. First, plasma membrane fatty
acid-binding protein, a protein related to the mitochondrial isoform of
aspartate aminotransferase, has been suggested to increase FA uptake in
cells (2). Since this protein has not yet been cloned, it is difficult
to determine its exact role in FA transport processes. The second
protein, fatty acid translocase is an 88-kDa membrane protein that has
been cloned in mouse and is homologous to the human CD36 cell surface
antigen (3). Although CD36 has been shown to bind FAs and might be
involved in signal transduction after binding of a specific ligand
(long chain fatty acids), it is until now not clear whether it is a
transport protein. The only candidate for a long chain FA transporter
for which functionality has been directly demonstrated is the fatty
acid transport protein (FATP) (4). FATP is a 63-kDa plasma membrane
protein with six predicted membrane-spanning domains that has been
cloned using a functional expression cloning technique. It increased
oleic acid uptake in FATP-transfected 3T3-L1 cells by >3-fold.
Interestingly FATP is suggested to act in concert with acyl-CoA
synthetase (ACS), an enzyme that prevents efflux of the incorporated
fatty acids by their conversion into acyl-CoA derivatives and hence
rendering the FA uptake process unidirectional. Furthermore, FATP shows a limited region of homology at the protein level (11 amino acids), with ACS leading to the hypothesis that this common region might reflect a common function, such as a binding site (4). These 11 amino
acids residues have also been found to be conserved in the rat and the
yeast FATP homologues (5).
Several aspects of intracellular lipid and FA metabolism in cells are
subjected to transcriptional control by the peroxisome proliferator-activated receptor (PPAR) family. PPARs are members of the
superfamily of nuclear hormone receptors that function as
ligand-dependent transcription factors. Three receptor
subtypes of PPAR termed In view of the convergence of FA import and PPARs in lipid and energy
metabolism, we investigated the effects of two distinct chemical
classes of PPAR activators, i.e. fibrates (PPAR EXPERIMENTAL PROCEDURES BRL 49653 and fenofibric acid were kind gifts of
Dr. De Chaffoy de Courcelles (Janssen Research Foundation, Beerse,
Belgium) and Dr. Alan Edgar (Laboratoires Fournier, Daix, France),
respectively.
Animal studies were carried out in
compliance with French and European union specifications regarding the
use of laboratory animals. Male Wistar rats (90 days old) were treated
for 7 days with fenofibrate (Laboratoires Fournier) mixed at the
indicated concentrations (by mass) in standard rat chow. The food
intake of the rats was recorded every day throughout the treatment
period. None of the treatments caused major changes in the amount of
food consumed by the animals. Since each rat consumed approximately 20 gm of chow/day, doses of 0.5, 0.05, and 0.005% (by mass mixed in rat
chow) correspond to 320, 32, and 3 mg/kg of body weight/day. Adult (95 day) Sprague-Dawley rats were group-housed and accustomed to a 12:12 h
day:night ratio illumination cycle (light from 8 am to 8 pm). Rats were
divided in groups of a minimum of three animals each and were treated
for either 7 or 14 days. The first group received BRL 49653 (5 mg/kg/day) by gavage. The second group of animals received 0.5% w/w of
fenofibrate (± 0.5 g/kg/day) mixed with their food, whereas the third
group of animals served as controls and received 10%
carboxymethylcellulose (vehicle for gavage) by gavage. In a separate
experiment, adult C57Bl6 male mice were either fed during 14 days with
a control chow (n = 3) or the same chow containing
0.5% w/w of fenofibrate. At the end of the treatment period, all
animals were weighed and sacrificed by exsanguination under ether
anesthesia between 8 and 10 a.m. Epididymal adipose tissue (in
rats) and liver (in rats and mice) was removed, weighed, rinsed with
0.9% NaCl, and frozen in liquid nitrogen until RNA preparation.
The mouse hepatoma and preadipocyte cell lines
Fa 32 (rat), ob 1771 (mouse) (22), and 3T3-L1 (mouse; ATCC) were
maintained in Dulbecco's modified Eagle's minimal essential medium
and supplemented with 10% delipidated and charcoal-treated fetal calf
serum, L-glutamine, and antibiotics unless stated
otherwise. AML-12 mouse hepatocytes (23) were maintained in Dulbecco's
modified Eagle's minimal essential medium/Ham's F-12 supplemented
with 10% delipidated and charcoal-treated fetal calf serum, insulin,
transferrin, and selenium (Collaborative Research), dexamethasone (0.1 µM), and gentamycin (50 µg/ml). Fenofibric acid and BRL
49653 (both in Me2SO) were added to the medium at the
appropriate concentrations and times indicated. Control cells received
vehicle only.
3T3-L1 cells were differentiated by a treatment of 2 days with
dexamethasone (0.1 µM), isobutylmethylxanthine (0.25 mM), and insulin (0.4 µM); the cells were
then maintained for an additional 8 days with insulin until complete
differentiation.
Radiolabeled
14[C]oleate fatty acid was mixed in water at 40 °C,
albumin (BSA; fraction V, fatty acid-free, Sigma) was then added from a
concentrated stock (20 g/100 ml) to give a final molar ratio of 1/1 by
gentle mixing. 2 × Hanks' solution was added to obtain a 1 × final solution. Incubation was carried out at 37 °C for 45 min.
The measurement of uptake of
1-14C-labeled oleate (about 50 mCi/mmol, NEN Life Science
Products) was carried out in 24- or 6-well plates with 106
cells/ml of medium. Before treatment, the cells were washed with 1 × Hanks' solution. BRL 49653 (100-250 nM) and fenofibric
acid (100-250 µM) were added in fresh Dulbecco's
modified Eagle's minimal essential medium containing 10% fetal calf
serum. After 48 h of treatment, cells were washed with Hanks'
solution and incubated for 1 additional h in serum-free, glucose-free
medium. Cells were then washed once at 37 °C and twice at 23 °C
with 1 × Hanks' solution containing BSA. Hanks' solution
without BSA was then added before the assay. A volume corresponding to
1 µCi of [14C]oleate albumin-bound solution was added
in each well, and cells were incubated for 1 min at room temperature.
The incubation was stopped after 1 min with 3 washes of ice-cold 1 × Hanks' solution without BSA. A complementary experiment has been
performed to verify whether aspecific cell surface binding of
[14C]oleate could interfere with the assay. For this
second assay, the cells were washed under more stringent conditions in
1 × Hanks' solution containing 2% BSA. Cells were then lysed in
400 µl of 0.1% SDS solution. The lysate was counted for 5 min with 4 ml of scintillation solution. The assay was performed on triplicate points.
RNA preparation, Northern blot hybridizations,
and quantification of total cellular RNA were performed as described
previously (24). A mouse FATP cDNA probe was obtained after cloning
a reverse transcription-polymerase chain reaction fragment from mouse
adipose tissue RNA using the primers 382 (ATGCGGGCTCCTGGAGCAGGACAGCC) and 399 (CTGCGTGTCAGGCAGGATGCTCTCAGGCCC) into pBS-KS. The insert was
sequenced and found to be identical to the reported mouse FATP
sequence. The rat ACS probe corresponds to the EcoRV
restriction fragment of the rat ACS cDNA. The human acidic
ribosomal phosphoprotein 36B4 (25) was used as a control probe.
RESULTS To determine whether
FATP expression was ubiquitous or restricted to certain tissues, we
hybridized both a mouse (Fig.
1A) and a rat (Fig.
1B) multiple tissue Northern blot with a radiolabeled FATP
probe. In both rat and mouse, adipose tissue, heart, brain, and testis
showed the highest level of expression. Intestine and muscle show
intermediate levels of expression, and low levels are expressed in the
liver, kidney, lung, and spleen.
[View Larger Version of this Image (63K GIF file)]
In addition to being building blocks and energy substrates,
fatty acids are also important signaling molecules. Besides being activated by peroxisome proliferators and certain thiazolidinediones, the transcriptional activity of PPARs can be activated by fatty acids
(reviewed in Refs. 16 and 17). Therefore, we were interested in
analyzing whether activation of these PPARs would affect FA uptake in
general and FATP expression in particular. To address this issue we
first assessed the effect of fibrates, potent PPAR
[View Larger Version of this Image (35K GIF file)]
Several
proteins are hypothesized to enhance fatty acid uptake into cells. In
contrast to FATP, which acts as an FA transport protein, ACS prevents
the efflux from the imported FAs by converting them into acyl-CoA
derivatives, which can subsequently be used in both anabolic and
catabolic pathways. Therefore, we next analyzed whether there was a
parallel between the induction of FATP and ACS after fibrate treatment
(Fig. 3). Fenofibrate induced liver and
kidney ACS mRNA expression, whereas no change in ACS expression was
observed in heart and intestine. Therefore both FATP and ACS mRNA
levels seem to be coordinately regulated in liver and heart, since
fibrates affect both parameters in a similar fashion. The regulation of
ACS and FATP in the kidney and intestine seems to be divergent, since
in these tissues only one of the respective mRNAs is regulated by
fibrate treatment.
[View Larger Version of this Image (74K GIF file)]
In
addition to the well established effects of peroxisome proliferators
such as the different fibrates on PPAR
[View Larger Version of this Image (54K GIF file)]
[View Larger Version of this Image (66K GIF file)]
To analyze whether the induction of FATP
and ACS mRNAs occurred at the transcriptional level, a nuclear
run-on assay was performed on liver nuclei obtained from
fenofibrate-treated rats (Fig. 6). In
comparison with control liver nuclei, the rate of FATP and ACS
transcription was respectively 3- and 3.5-fold higher in nuclei from
fenofibrate-treated animals. The transcription rate of acyl-CoA oxidase, a key enzyme in the peroxisomal
[View Larger Version of this Image (32K GIF file)]
To study the cellular mechanism of this induction, we
investigated the regulation of the FATP gene expression by
fibrates and BRL 49653 in hepatocyte (Fig.
7), adipocyte (Fig.
8), and muscle cells cell lines. FATP and
ACS mRNA were measured in mouse AML-12 and rat Fa 32 liver-derived
cell lines. A strong induction of expression of both FATP and ACS
mRNA levels was seen after treatment of these liver-derived lines
with fenofibric acid. Fenofibric acid induced both mRNAs optimally
within 24 h (Fig. 7A) at a dose of 250 µM
(Fig. 7B). The results of dose response and time course of
FATP and ACS induction after treatment with fibrates seem to show an
apparent difference between Fa 32 and AML-12 cells. The reason for this
apparent difference in induction of FATP and ACS in the two cell lines
is most likely caused by the difference in basal levels of FATP, which
in Fa 32 cells is barely detectable. In contrast, under basal
conditions, AML-12 expresses much higher levels of FATP transcript.
This difference between these cells will result in an overestimation of
the induction of the FATP in Fa 32 cells, explaining the discordance
between relative levels of induction between FATP and ACS in the two
cell lines.
[View Larger Version of this Image (21K GIF file)]
[View Larger Version of this Image (29K GIF file)]
To examine FATP and ACS regulation in adipocyte-like cell lines, 3T3-L1
preadipocyte cells were used. First, we analyzed the effects of BRL
49653 on nondifferentiated 3T3-L1 preadipocyte cells. As shown in Fig.
8A, a limited effect of BRL 49653 was observed in
undifferentiated 3T3-L1 cells. In differentiated 3T3-L1 adipocytes,
FATP and ACS mRNA levels were induced 5- and 9-fold after 4 days of
treatment with BRL 49653. The ob 1771 preadipocyte cell line (22) was
also analyzed (Fig. 8). The addition of BRL 49653 also induced FATP and
ACS mRNA levels in this cell line (Fig. 8), whereas fenofibric acid
had only a weak effect (data not shown).
Finally the effects of both BRL and fenofibric on L6 muscle cells were
analyzed. Unlike in adipocyte or hepatocyte cell lines, no change in L6
ACS and FATP mRNA levels were detected upon treatment with either
fenofibrate or BRL 49653 (data not shown).
To verify whether changes in mRNA levels of
FATP and ACS were correlated with alterations in fatty acid uptake, we
analyzed [14C]oleic acid uptake in Fa 32 and AML-12
hepatic cells, L6 muscle cells, and 3T3-L1 preadipocytes. As shown in
Fig. 9, fatty acid uptake of
[14C]oleic acid significantly increased after treatment
of the liver-derived AML-12 cells with fenofibric acid and after
treatment of the differentiated adipocyte-like 3T3-L1 cells with BRL
49653. In Fa 32 cells, fatty acid uptake was also increased (data not
shown). The increase, although statistically significant, was however
less pronounced than in AML-12 cells. As expected in view of the
absence of a major regulation of ACS and FATP mRNA in muscle cells,
no effects of either fenofibric acid nor BRL 49653 were observed on FA
uptake in L6 muscle cells. The regulation of FA uptake was hence
completely consistent with the regulation of respective mRNA levels
of FATP and ACS in the various cell models.
[View Larger Version of this Image (33K GIF file)]
DISCUSSION Both ACS and FATP have been suggested to play a crucial role in
the transport of fatty acids into the cell (4). FATP acts as a fatty
acid transport protein, whereas ACS prevents efflux of the newly
imported fatty acids by their esterification with coenzyme A. Fatty
acids are important cellular components that can function both as
metabolic substrates or as signaling molecules, by functioning as
second messengers and triggering signal transduction pathways or by
directly activating transcription factors such as the PPAR family of
nuclear receptors. Since FATP and ACS control, in part, the
intracellular availability of FAs, important PPAR activators, the aim
of the present investigation was to perform detailed analysis of FATP
and ACS expression and to establish whether FATP and ACS expression
themselves might be subject to control by PPARs.
In the liver, one of the major organs susceptible to peroxisomal
proliferation, FATP gene transcription is strongly induced upon fibrate treatment. This strong induction is not surprising if one
takes the strong induction of peroxisomal In the intestine, FATP was also induced by fibrates, albeit to a lesser
extent. The FATP induction in this tissue shows a striking parallel to
the induction of CD36 after fibrate treatment in this tissue (29). In
contrast to the liver and intestine, heart FATP mRNA levels did not
vary substantially under fibrate treatment. The basal levels of FATP
expression were, however, very high in heart, which almost exclusively
uses fatty acids as energy source. In this tissue, fatty acids are,
however, constitutively metabolized to provide energy necessary for the
contraction of the heart muscle. Unresponsiveness of FATP expression in
the heart to hormonal control could hence be physiologically
significant, since the continued function of the heart is far too
crucial to allow any form of major regulation of a transporter vital to
its energy supply. This would suggest that in the heart, the FATP promoter is maximally active, resulting in a high level of constitutive FATP gene expression, which would be consistent with the high basal
levels of FATP mRNA in this tissue. Similar to the heart, less
extreme changes were observed in adipose tissue FATP mRNA after
fibrate treatment. The absence of an effect of fibrates on FATP
expression in adipose tissue is most likely due to the lower levels of
PPAR The demonstration of the inducibility of the FATP and ACS genes by
PPAR The tissue-selective effects of the various PPAR activators/ligands are
highly intriguing and provide insight in their effects on triglyceride
metabolism. Fibrate treatment induced FATP and ACS expression strongest
in liver, whereas BRL 49653 had no effect on liver, but strongly
induced adipocyte FATP and to a lesser extent ACS expression. The
effects of fibrates (PPAR One remaining question is the relationship between PPAR In conclusion, FATP and ACS mRNA levels can be regulated in a
tissue-specific fashion by PPAR FOOTNOTES ACKNOWLEDGEMENTS Dr. D. de Chaffoy de Courcelles and Dr. J. C. Fruchart are acknowledged for stimulating discussions and suggestions
and D. Cayet and O. Vidal for excellent technical assistance. We thank Drs. A. Edgar and de Chaffoy de Courcelles for the gift of valuable materials.
REFERENCES
Coordinate Regulation of the Expression of the Fatty Acid
Transport Protein and Acyl-CoA Synthetase Genes by PPAR
and
PPAR
Activators*
,
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
, induced FATP mRNA levels in rat liver and intestine and
induced ACS mRNA levels in liver and kidney. The antidiabetic
thiazolidinedione BRL 49653, which is a high-affinity ligand for the
adipocyte-specific PPAR
form, caused a small induction of muscle but
a robust induction of adipose tissue FATP mRNA levels. BRL 49653 did not affect liver FATP and had a tendency to decrease heart FATP
mRNA levels. ACS mRNA levels in general showed a similar
pattern after BRL 49653 as FATP except for the muscle where ACS
mRNA was induced. This regulation of FATP and ACS expression by
PPAR activators was shown to be at the transcriptional level and could
also be reproduced in vitro in cell culture systems. In the
hepatocyte cell lines AML-12 or Fa 32, fenofibric acid, but not BRL
49653, induced FATP and ACS mRNA levels, whereas in the 3T3-L1
preadipocyte cell line, the PPAR ligand induced FATP and ACS
mRNA levels quicker than fenofibric acid. Inducibility of ACS and
FATP mRNA by PPAR or activators correlated with the
tissue-specific distribution of the respective PPARs and was
furthermore associated with a concomitant increase in FA uptake. Most
interestingly, thiazolidinedione antidiabetic agents seem to favor
adipocyte-specific FA uptake relative to muscle, perhaps underlying in
part the beneficial effects of these agents on insulin-mediated glucose
disposal.
, 
(or 
), and , have been
identified (6-15). These receptors heterodimerize with the retinoid X
receptor and alter the transcription of target genes after binding to
peroxisome proliferator response elements (PPREs), which consist of a
hexameric nucleotide direct repeat of the recognition motif
(TGACCT) spaced by 1 nucleotide (DR-1). Several genes with a
crucial role in FA metabolism have been shown to contain a peroxisome
proliferator response element in their upstream regulatory sequences
(reviewed in Refs. 16 and 17). Interestingly, the transcriptional
activity of the PPAR subtypes is enhanced by a multitude of chemical
compounds including fatty acids, thiazolidinedione antidiabetic agents, prostaglandins, peroxisome proliferators, and fibrate hypolipidemic drugs. In addition to activating PPARs, some of these compounds have
been shown to be direct ligands for them. PPAR directly binds
antidiabetic thiazolidinediones (18, 19) and prostaglandin derivatives
(18, 20) but not the other activators, whereas PPAR binds
leukotriene B4 and the powerful peroxisome proliferator Wy 14643 (21).
-specific) and the antidiabetic thiazolidinediones (PPAR-specific) on
tissue-specific FATP gene expression. Fibrate treatment
induced FATP and ACS expression strongest in liver, whereas BRL 49653, the high affinity ligand for PPAR, had no effect on liver but
induced adipocyte FATP and ACS expression in adipose tissue. The
induction of FATP and ACS by PPAR activators was at the level of
transcription and was associated with concomitant changes in cellular
FA uptake. Interestingly, the stronger effects of BRL 49653 on fatty
acid import in adipose tissue relative to the muscle might limit FA
uptake and oxidation in the muscle, an effect associated with an
improvement in muscle glucose disposal.
Fig. 1.
Tissue distribution of FATP mRNA
expression in mouse (A) and rat (B).
Twenty µg of total RNA from the respective tissues was analyzed by
Northern blot hybridization for FATP and 36B4 mRNA expression. RNA
extraction and analysis was performed as described under
"Experimental Procedures."
Activator, Induces FATP mRNA in
Vivo
activators, on
the expression of the fatp gene in rats. Rats were hence
treated with different doses of fenofibrate (14 days treatment at the
doses 0.005, 0.05, and 0.5% by mass) mixed in food. Next, RNA was
isolated from various organs and analyzed by Northern blot
hybridization. In liver, FATP mRNA levels increased gradually starting from 0.05% fenofibrate and reached a maximal 4.2-fold induction at the highest dose of 0.5% fenofibrate (Fig.
2, A and B). A
representative Northern blot showing the induction of FATP mRNA in
the liver is depicted in Fig. 2B. Next, the response of FATP
mRNA levels to fibrates was studied in intestine, skeletal muscle,
heart, and kidney. Only intestinal FATP mRNA expression was
slightly induced (2-fold) by the highest dose of fibrate treatment, whereas muscle, kidney, and heart FATP mRNA expression remained unchanged. Also in mice, administration of fenofibrate (0.5%) induced
FATP mRNA levels in liver (15-fold) (Fig. 2C).
Fig. 2.
Effect of fenofibrate on FATP mRNA
levels. A, graph showing the effects fenofibrate mixed with
food in the indicated concentrations on FATP mRNA levels. RNA
extraction and analysis was performed as described under
"Experimental Procedures." R.A.U., relative absorbance
units. B, effect of increasing amounts of fenofibrate on
liver FATP expression in rat. Twenty µg of total liver RNA was
analyzed by Northern blot hybridization for FATP and 36B4 mRNA
expression as indicated under "Experimental Procedures." C, effect of fenofibrate on liver FATP expression in mouse.
Twenty µg of total liver RNA tissues was analyzed by Northern blot
hybridization for FATP and 36B4 mRNA expression as indicated under
"Experimental Procedures."
Fig. 3.
FATP and ACS mRNA are in some tissues
coinduced by fenofibrate. A, graphs representing the effects
of three different concentrations of fenofibrate (0.005, 0.05, and
0.5% (w/w) during 14 days) mixed with food on FATP (open
squares) or ACS (filled squares) mRNA levels. The
results represent the mean of three independent samples. B,
Northern blot showing the regulation of FATP, ACS, and 36B4 mRNA
levels by fenofibrate administration. Animal treatment and preparation
and analysis of RNA is described under "Experimental Procedures."
R.A.U., relative absorbance units.
Activators Induce FATP mRNA in Adipose Tissue
activity, we next tested the
effects of the PPAR-selective ligand BRL 49653 on FATP and ACS
expression in various rat tissues after administration of these
compounds. Fenofibrate (0.5% (w/w), ±0.5 g/kg/day) induced FATP and
ACS mRNA in rat liver (Fig. 4,
A and B), confirming our previous observations
(26). By contrast, treatment with fenofibrate did not change FATP and
ACS mRNA levels significantly in adipose tissue, skeletal muscle,
or heart (Fig. 4, A and B). Administration of 5 mg/kg/day of BRL 49653 was associated with the expected decrease in
serum triglyceride levels (from 167 to 88 mg/dl). Furthermore, this
treatment with BRL 49653 resulted in a significant induction of adipose
tissue FATP (7-fold) and ACS (7-fold) mRNA levels (Fig. 4). This
induction of FATP and ACS mRNA by BRL 49653 was observed in
epididymal (Fig. 5) and omental (data not
shown) adipose tissue. In perirenal adipose tissue, however, only FATP
but not ACS mRNA was induced (Fig. 5). We observed a 1.6- and
3.1-fold induction of respective levels of FATP and ACS mRNA in
skeletal muscle after BRL 49653 administration. BRL 49653 did not
significantly influence the expression of FATP or ACS in liver, whereas
FATP mRNA levels showed a tendency to decrease in the heart after
BRL 49653 treatment.
Fig. 4.
Tissue-selective induction of FATP
(A) and ACS (B) mRNA in rat liver, adipose
tissue, skeletal muscle, and heart by fenofibrate and BRL 49653, respectively. A, expression of FATP mRNA in liver,
epididymal adipose tissue, skeletal muscle, and heart of animals
treated with fenofibrate (FF, 0.5% (w/w) during 7 days, approximately 0.5 g/kg/day) or BRL 49653 (5 mg/kg/day during 7 days).
The blots were stripped and rehybridized with the human acidic
ribosomal phosphoprotein 36B4 control cDNA. B,
expression of ACS mRNA in liver, epididymal adipose tissue,
skeletal muscle, and heart of animals treated with fenofibrate
(FF, 0.5% (w/w) during 7 days, approximately 0.5 g/kg/day)
or BRL 49653 (5 mg/kg/day during 7 days). The blots were stripped and
rehybridized with the human acidic ribosomal phosphoprotein 36B4
control cDNA. Animal treatment and preparation and analysis of RNA
is described under "Experimental Procedures." C, bar
graph summarizing the regulation of ACS and FATP mRNA in liver,
epididymal adipose tissue, skeletal muscle, and heart of animals
treated with or without BRL 49653. R.A.U., relative
absorbance units. Values statistically significant from controls
(Mann-Whitney; p < 0.05) are indicated by an
asterisk.
Fig. 5.
BRL 49653 induces FATP and ACS mRNA in
different adipose tissue depots. Expression of ACS and FATP
mRNA in epididymal (A), and perirenal (B)
adipose tissue of animals treated with BRL 49653 (5 mg/kg/day during 7 days). The blots were stripped and rehybridized with the human acidic
ribosomal phosphoprotein 36B4 control cDNA. Animal treatment and
preparation and analysis of RNA is described under "Experimental
Procedures."
oxidation pathway, a
positive control for fibrate action, was induced (5-fold), whereas the
glyceraldehyde phosphate dehydrogenase gene, a negative control, did
not change.
Fig. 6.
The induction of FATP and ACS by fibrates is
at the transcriptional level. Transcription rates were determined
for the FATP, ACS, acyl-coA oxidase (ACO) and
glyceraldehyde-3-phosphate dehydrogenase genes in rat liver nuclei
obtained from control, or BRL 49653 (BRL)- or
fenofibrate-treated rats (FF). A pUC-20 template was used as
a control (C). Densitometric scanning of the results is
depicted at the left panel. GAPDH,
glyceraldehyde-3-phosphate dehydrogenase, is used for relative values;
ACO, acyl-CoA oxidase; BS, BlueScript.
Fig. 7.
Regulation of FATP and ACS mRNA
expression in the liver-derived cell lines AML-12 hepatocytes
(A, rat) and Fa 32 (B, mouse) by fibrates.
A, AML-12 hepatocytes. Time course of FATP and ACS mRNA
induction in AML-12 cells treated with fenofibric acid (250 µM). A probe for 36B4 was used as a control.
R.A.U., relative absorbance units. B, Fa 32 hepatoma cells. Dose reponse of FATP and ACS mRNA induction in Fa
32 hepatoma cells treated for 24 h with the indicated
concentrations of fenofibric acid. Cells were grown and mRNA
analysis was performed as described under "Experimental
Procedures."
Fig. 8.
Regulation of FATP and ACS mRNA
expression in 3T3-L1 preadipocytes (A) and in ob 1771 preadipocytes (B) by thiazolidinediones. A,
3T3-L1 cells. Differentiated or undifferentiated 3T3-L1 cells were
treated with BRL 49653 (10 µM) for different time
periods. RNA was extracted and analyzed for FATP and ACS expression as described under "Experimental Procedures." A probe for 36B4 was used as a control to normalize the results. R.A.U., relative
absorbance units. B, ob 1771 cells. Differentiated ob 1771 cells were challenged during 3 days with BRL 49653 (10 µM) and FATP, and ACS mRNA levels were
analyzed.
Fig. 9.
Fatty acid uptake is increased in parallel
with the changes in FATP and ACS mRNA levels.
[14C]Oleic acid uptake in L6 muscle cells, 3T3-L1
preadipocytes, and AML-12 hepatic cells is shown. Cells were untreated
or incubated with either 100 or 250 µM fenofibric acid
(FF) or 100 or 250 nM BRL 49653 for 24 h.
[14C]Oleic acid uptake was then performed as described
under "Experimental Procedures." It is indicated whether cells were
washed without (
BSA) or with BSA (+BSA).
oxidation into account
after fibrate treatment. FATP is likely to be responsible in part for
the increased FA import necessary to sustain this increased oxidation. Furthermore, a striking parallelism exists between the
induction by fibrates of a number of genes involved in fatty acid
import in the liver. In fact, the mRNAs for lipoprotein lipase
(LPL) (27), ACS (this paper and Refs. 27 and 28), and FATP
genes are all induced after fibrate treatment in the liver. This
coinduction of genes seems to prime the cells for more efficient oxidation. Induced liver LPL expression will increase lipolysis in the
vascular bed of the liver, generating more fatty acids, which are then
avidly taken up by the cells thanks to the higher levels of FATP
expression. Efflux of these imported fatty acids is prevented by
induced ACS levels, which in addition, primes them for subsequent
metabolism. Therefore it seems that fibrates not only induce oxidation but also induce genes important for supplying the cells with
the extra fatty acids they need to sustain this increase in oxidation.
relative to PPAR. For kidney and intestine, the regulation
of ACS and FATP by fibrates is discordant. This is consistant with the
less crucial functions lipids play in kidney and intestinal metabolism.
Kidney expressed only low levels of FATP mRNA, and its expression
was furthermore refractory to induction by fibrates. Relative to heart
and liver, the kidney utilizes relatively little fatty acids, and
therefore a coordinate import mechanism is of lesser importance. In
intestine, fatty acids are primarily absorbed, but they are less
actively metabolized than in heart and liver. Therefore, intestine
apparently has an actively regulated transport mechanism, as evidenced
by regulation of the expression of both FATP and FAT, another transport
protein that is also expressed and highly regulated in this organ (29).
Since fatty acids are less actively metabolized and rather resecreted under the form of lipoproteins, there is less need for their conversion to acyl-CoA derivatives and hence less need for coordinated regulation of ACS together with these transport proteins suggested to be implicated in fatty acid transport.
ligands such as the thiazolidinedione BRL 49653 has important
implications for adipocyte physiology. PPAR has been shown to
promote preadipocyte determination as well as terminal differentiation
(13, 30), and its mRNA is itself induced in the earliest steps of
adipocyte differentiation before the induction of early marker genes
for adipocyte differentiation. Many of these genes induced during
adipocyte differentiation encode proteins involved in lipid storage and
metabolism. The increase in FATP and ACS expression in differentiated
adipocyte-like cells caused by PPAR ligands will result in an
increased delivery of fatty acids to the adipocytes, which possibly
sustains a positive regulatory feedback loop involving continued
PPAR activation of the FATP and ACS (28) genes and aimed at
promoting and maintaining the mature adipocyte phenotype. In fact, in
addition to the thiazolidinediones, certain fatty acid-derived
prostaglandin derivatives, whose delivery to the cell is increased by
FATP, bind to and/or activate PPAR (19, 20, 31). This hypothesis is
supported by the observation that fatty acids (including arachidonic
acid-derived prostaglandins) and fatty acid analogues induce the
expression of adipocyte-specific genes and enhance adipocyte conversion
(30, 32-35). In addition to being potent PPAR activators (7, 12, 31,
36, 37), fatty acids will provide the necessary building blocks for
triglyceride accumulation, ultimately enhancing adipocyte
differentiation. The PPAR-mediated activation of FATP and ACS
expression in cells of the adipogenic lineage might furthermore in part
be responsible for the previously reported capacities of
thiazolidinediones to induce adipocyte differentiation and induce the
development of obesity (38-46). In this context, it is interesting to
note that the PPAR-mediated effects of BRL 49653 on FATP and ACS
expression might act in concert with induced LPL expression and the
reduced leptin mRNA and protein levels and the associated increase
in caloric intake enhancing energy storage in the adipocytes observed with this compound (47, 48). Interestingly, FATP and ACS are not
coordinately regulated in perirenal and epididymal adipose tissue
stores. This differential regulation is consistent with the distinct
metabolic nature of the different adipose tissue depots (49-51).
Further studies are required to determine whether the role of FATP is a
consequence of or is causative of the physiologic differences between
the adipose tissue depots.
activators) on the liver and PPAR
ligands in adipose tissue correlates well with the tissue-specific
expression of the respective receptors and suggests that the FATP and
ACS genes show a tissue-selective activation similar to the one
previously described for the LPL gene (27). In this context,
we need however to address the discrepancy between ACS and FATP
regulation after BRL 49653 administration in skeletal muscle. Muscle
tissue expresses very low levels of PPAR,2 which is consistent
with the absence of an important regulatory effect of PPAR
activators in this tissue as observed for the LPL (27) or FATP (this
study) genes. In this context, the induction of ACS expression by BRL
49653 is however difficult to explain. One must however bear in mind
that not all of the effects of the thiazolidinediones are mediated via
PPAR activation, and it is has been shown that these agents activate
several other signaling pathways (52-54). Further investigations need
to address whether ACS expression, unlike FATP or LPL expression, is
subject to such a regulatory circuit.
,
thiazolidinediones, and insulin resistance. It is tempting to speculate that the increase of LPL, ACS, and FATP activity in adipose tissue is
related to the antidiabetic effects of the thiazolidinediones. Due to
the enhanced triglyceride clearance in adipose tissue, less
triglycerides will become available to be hydrolyzed to fatty acids in
the vascular bed of the muscle. Furthermore, relative to the strong
induction of FATP and ACS in adipose tissue by BRL 49653, very limited
inductions of both genes are observed in skeletal and heart muscle,
favoring uptake of fatty acids in adipose tissue relative to muscle. In
view of the inhibitory effects of fatty acids on insulin-mediated
glucose metabolism (55), the decrease in fatty acids delivered to the
muscle cells might be responsible for the improvement in insulin
sensitivity of this tissue.
activators and PPAR ligands. In
adipose tissue, the increase in FATP, ACS, and LPL (27) production after treatment with thiazolidinediones will enhance the clearance of
plasma triglycerides (27, 56) and provide the (pre)adipocytes with
additional fatty acids, which can further stimulate the transactivation capacity of PPAR or which can be stored under form of triglycerides. In
the liver, the enhanced production of FATP and ACS after fibrates together with the increase in oxidation and the reduced production of apoCIII (57), may contribute to the hypolipidemic action of these
compounds. This tissue-selective induction of FATP and ACS gene
transcription by activators of different PPARs, demonstrates the
feasibility of the development of highly specific PPAR subtype-specific agonists and antagonists, which can be used as drugs.
Supported by a fellowship from Institut Français pour la
Nutrition.
§
A research associate of the CNRS.
¶
A research director of the CNRS. To whom correspondence should
be addressed: U.325 INSERM, Institut Pasteur, 1 Rue Calmette, 59019 Lille Cédex, France. E-mail: Johan.Auwerx{at}pasteur-lille.fr; Fax:
33-320-877360.
1
The abbreviations used are: FA, fatty acid;
FATP, FA transport protein; ACS, acyl-CoA synthetase; PPAR, peroxisome
proliferator-activated receptor; BSA, bovine serum albumin; LPL,
lipoprotein lipase.
2
L. Fajas, G. Martin, L. Gelman, B. Starls, and
J. Auwerx, unpublished observation.
Volume 272, Number 45,
Issue of November 7, 1997
pp. 28210-28217
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  P. A. Watkins Very-long-chain Acyl-CoA Synthetases J. Biol. Chem., January 25, 2008; 283(4): 1773 - 1777. [Full Text] [PDF]
|
|
|
|
 |
|
 D. K. McGuire and S. E. Inzucchi New Drugs for the Treatment of Diabetes Mellitus: Part I: Thiazolidinediones and Their Evolving Cardiovascular Implications Circulation, January 22, 2008; 117(3): 440 - 449. [Full Text] [PDF]
|
|
|
|
 |
|
 W. Liao, M. T. A. Nguyen, T. Yoshizaki, S. Favelyukis, D. Patsouris, T. Imamura, I. M. Verma, and J. M. Olefsky Suppression of PPAR-{gamma} attenuates insulin-stimulated glucose uptake by affecting both GLUT1 and GLUT4 in 3T3-L1 adipocytes Am J Physiol Endocrinol Metab, July 1, 2007; 293(1): E219 - E227. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Michalik, J. Auwerx, J. P. Berger, V. K. Chatterjee, C. K. Glass, F. J. Gonzalez, P. A. Grimaldi, T. Kadowaki, M. A. Lazar, S. O'Rahilly, et al. International Union of Pharmacology. LXI. Peroxisome Proliferator-Activated Receptors Pharmacol. Rev., December 1, 2006; 58(4): 726 - 741. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. O. Li, D. G. Mashek, J. An, S. D. Doughman, C. B. Newgard, and R. A. Coleman Overexpression of Rat Long Chain Acyl-CoA Synthetase 1 Alters Fatty Acid Metabolism in Rat Primary Hepatocytes J. Biol. Chem., December 1, 2006; 281(48): 37246 - 37255. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. B Patle, J. A De Lemos, K. L Wyne, and D. K McGuire Thiazolidinediones and risk for atherosclerosis: pleiotropic effects of PPAR{gamma} agonism Diabetes and Vascular Disease Research, September 1, 2006; 3(2): 65 - 71. [Abstract] [PDF]
|
|
|
|
 |
|
 D. G. Mashek, L. O. Li, and R. A. Coleman Rat long-chain acyl-CoA synthetase mRNA, protein, and activity vary in tissue distribution and in response to diet J. Lipid Res., September 1, 2006; 47(9): 2004 - 2010. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Grun, H. Watanabe, Z. Zamanian, L. Maeda, K. Arima, R. Cubacha, D. M. Gardiner, J. Kanno, T. Iguchi, and B. Blumberg Endocrine-Disrupting Organotin Compounds Are Potent Inducers of Adipogenesis in Vertebrates Mol. Endocrinol., September 1, 2006; 20(9): 2141 - 2155. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Lord, B. D Murphy, J. A Desmarais, S. Ledoux, D. Beaudry, and M.-F. Palin Modulation of peroxisome proliferator-activated receptor {delta} and {gamma} transcripts in swine endometrial tissue during early gestation. Reproduction, May 1, 2006; 131(5): 929 - 942. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Schupp, U. Kintscher, J. Fielitz, J. Thomas, R. Pregla, R. Hetzer, T. Unger, and V. Regitz-Zagrosek Cardiac PPAR{alpha} expression in patients with dilated cardiomyopathy Eur J Heart Fail, May 1, 2006; 8(3): 290 - 294. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
U. Edvardsson, A. Ljungberg, D. Linden, L. William-Olsson, H. Peilot-Sjogren, A. Ahnmark, and J. Oscarsson PPAR{alpha} activation increases triglyceride mass and adipose differentiation-related protein in hepatocytes J. Lipid Res., February 1, 2006; 47(2): 329 - 340. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Li, P. A. Hansen, L. Xi, R. A. S. Chandraratna, and C. F. Burant Distinct Mechanisms of Glucose Lowering by Specific Agonists for Peroxisomal Proliferator Activated Receptor {gamma} and Retinoic Acid X Receptors J. Biol. Chem., November 18, 2005; 280(46): 38317 - 38327. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. I. Shulman and D. J. Mangelsdorf Retinoid X Receptor Heterodimers in the Metabolic Syndrome N. Engl. J. Med., August 11, 2005; 353(6): 604 - 615. [Full Text] [PDF]
|
|
|
|
 |
|
 W. T. Schaiff, I. Bildirici, M. Cheong, P. L. Chern, D. M. Nelson, and Y. Sadovsky Peroxisome Proliferator-Activated Receptor-{gamma} and Retinoid X Receptor Signaling Regulate Fatty Acid Uptake by Primary Human Placental Trophoblasts J. Clin. Endocrinol. Metab., July 1, 2005; 90(7): 4267 - 4275. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. L. M. Coort, W. A. Coumans, A. Bonen, G. J. van der Vusse, J. F. C. Glatz, and J. J. F. P. Luiken Divergent effects of rosiglitazone on protein-mediated fatty acid uptake in adipose and in muscle tissues of Zucker rats J. Lipid Res., June 1, 2005; 46(6): 1295 - 1302. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. C. DiRusso, H. Li, D. Darwis, P. A. Watkins, J. Berger, and P. N. Black Comparative Biochemical Studies of the Murine Fatty Acid Transport Proteins (FATP) Expressed in Yeast J. Biol. Chem., April 29, 2005; 280(17): 16829 - 16837. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Boden, C. Homko, M. Mozzoli, L. C. Showe, C. Nichols, and P. Cheung Thiazolidinediones Upregulate Fatty Acid Uptake and Oxidation in Adipose Tissue of Diabetic Patients Diabetes, March 1, 2005; 54(3): 880 - 885. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. P. Atshaves, A. L. McIntosh, H. R. Payne, J. Mackie, A. B. Kier, and F. Schroeder Effect of branched-chain fatty acid on lipid dynamics in mice lacking liver fatty acid binding protein gene Am J Physiol Cell Physiol, March 1, 2005; 288(3): C543 - C558. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. M. Huss and D. P. Kelly Nuclear Receptor Signaling and Cardiac Energetics Circ. Res., September 17, 2004; 95(6): 568 - 578. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Bogacka, H. Xie, G. A. Bray, and S. R. Smith The Effect of Pioglitazone on Peroxisome Proliferator-Activated Receptor-{gamma} Target Genes Related to Lipid Storage In Vivo Diabetes Care, July 1, 2004; 27(7): 1660 - 1667. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. J. Kim, T. E. Akiyama, F. S. Harman, A. M. Burns, W. Shan, J. M. Ward, M. J. Kennett, F. J. Gonzalez, and J. M. Peters Peroxisome Proliferator-activated Receptor {beta} ({delta})-dependent Regulation of Ubiquitin C Expression Contributes to Attenuation of Skin Carcinogenesis J. Biol. Chem., May 28, 2004; 279(22): 23719 - 23727. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Q. Shen, G. W. Cline, G. I. Shulman, M. D. Leibowitz, and P. J. A. Davies Effects of Rexinoids on Glucose Transport and Insulin-mediated Signaling in Skeletal Muscles of Diabetic (db/db) Mice J. Biol. Chem., May 7, 2004; 279(19): 19721 - 19731. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. T. Dalen, K. Schoonjans, S. M. Ulven, M. S. Weedon-Fekjaer, T. G. Bentzen, H. Koutnikova, J. Auwerx, and H. I. Nebb Adipose Tissue Expression of the Lipid Droplet-Associating Proteins S3-12 and Perilipin Is Controlled by Peroxisome Proliferator-Activated Receptor-{gamma} Diabetes, May 1, 2004; 53(5): 1243 - 1252. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Caviglia, L. O. Li, S. Wang, C. C. DiRusso, R. A. Coleman, and T. M. Lewin Rat Long Chain Acyl-CoA Synthetase 5, but Not 1, 2, 3, or 4, Complements Escherichia coli fadD J. Biol. Chem., March 19, 2004; 279(12): 11163 - 11169. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. S. Frederiksen, E. M. Wulff, P. Sauerberg, J. P. Mogensen, L. Jeppesen, and J. Fleckner Prediction of PPAR-{alpha} ligand-mediated physiological changes using gene expression profiles J. Lipid Res., March 1, 2004; 45(3): 592 - 601. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Fontaine, G. Dubois, Y. Duguay, T. Helledie, N. Vu-Dac, P. Gervois, F. Soncin, S. Mandrup, J.-C. Fruchart, J. Fruchart-Najib, et al. The Orphan Nuclear Receptor Rev-Erb{alpha} Is a Peroxisome Proliferator-activated Receptor (PPAR) {gamma} Target Gene and Promotes PPAR{gamma}-induced Adipocyte Differentiation J. Biol. Chem., September 26, 2003; 278(39): 37672 - 37680. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. D. Horton, I. Shimomura, S. Ikemoto, Y. Bashmakov, and R. E. Hammer Overexpression of Sterol Regulatory Element-binding Protein-1a in Mouse Adipose Tissue Produces Adipocyte Hypertrophy, Increased Fatty Acid Secretion, and Fatty Liver J. Biol. Chem., September 19, 2003; 278(38): 36652 - 36660. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Guerin, W. Le Goff, E. Frisdal, S. Schneider, D. Milosavljevic, E. Bruckert, and M. J. Chapman Action of Ciprofibrate in Type IIB Hyperlipoproteinemia: Modulation of the Atherogenic Lipoprotein Phenotype and Stimulation of High-Density Lipoprotein-Mediated Cellular Cholesterol Efflux J. Clin. Endocrinol. Metab., August 1, 2003; 88(8): 3738 - 3746. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. M. Wilmsen, T. P. Ciaraldi, L. Carter, N. Reehman, S. R. Mudaliar, and R. R. Henry Thiazolidinediones upregulate impaired fatty acid uptake in skeletal muscle of type 2 diabetic subjects Am J Physiol Endocrinol Metab, August 1, 2003; 285(2): E354 - E362. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C.-H. Lee, P. Olson, and R. M. Evans Minireview: Lipid Metabolism, Metabolic Diseases, and Peroxisome Proliferator-Activated Receptors Endocrinology, June 1, 2003; 144(6): 2201 - 2207. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Tordjman, G. Chauvet, J. Quette, E. G. Beale, C. Forest, and B. Antoine Thiazolidinediones Block Fatty Acid Release by Inducing Glyceroneogenesis in Fat Cells J. Biol. Chem., May 23, 2003; 278(21): 18785 - 18790. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. A. Wagner Early Clinical Development of Pharmaceuticals for Type 2 Diabetes Mellitus: From Preclinical Models to Human Investigation J. Clin. Endocrinol. Metab., December 1, 2002; 87(12): 5362 - 5366. [Full Text] [PDF]
|
|
|
|
 |
|
 O. Barbier, I. P. Torra, Y. Duguay, C. Blanquart, J.-C. Fruchart, C. Glineur, and B. Staels Pleiotropic Actions of Peroxisome Proliferator-Activated Receptors in Lipid Metabolism and Atherosclerosis Arterioscler. Thromb. Vasc. Biol., May 1, 2002; 22(5): 717 - 726. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Walczak and P. Tontonoz PPARadigms and PPARadoxes: expanding roles for PPAR{gamma} in the control of lipid metabolism J. Lipid Res., February 1, 2002; 43(2): 177 - 186. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. E. Schaffer Fatty acid transport: the roads taken Am J Physiol Endocrinol Metab, February 1, 2002; 282(2): E239 - E246. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Soria, C. Bocos, and E. Herrera Opposite metabolic response to fenofibrate treatment in pregnant and virgin rats J. Lipid Res., January 1, 2002; 43(1): 74 - 81. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. A. J. M. Van der Lee, P. H. M. Willemsen, S. Samec, J. Seydoux, A. G. Dulloo, M. M. A. L. Pelsers, J. F. C. Glatz, G. J. Van der Vusse, and M. Van Bilsen Fasting-induced changes in the expression of genes controlling substrate metabolism in the rat heart J. Lipid Res., November 1, 2001; 42(11): 1752 - 1758. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. D. Oakes, P. G. Thalén, S. M. Jacinto, and B. Ljung Thiazolidinediones Increase Plasma-Adipose Tissue FFA Exchange Capacity and Enhance Insulin-Mediated Control of Systemic FFA Availability Diabetes, May 1, 2001; 50(5): 1158 - 1165. [Abstract] [Full Text]
|
|
|
|
 |
|
 H. S. Ahuja, S. Liu, D. L. Crombie, M. Boehm, M. D. Leibowitz, R. A. Heyman, C. Depre, L. Nagy, P. Tontonoz, and P. J. A. Davies Differential Effects of Rexinoids and Thiazolidinediones on Metabolic Gene Expression in Diabetic Rodents Mol. Pharmacol., April 1, 2001; 59(4): 765 - 773. [Abstract] [Full Text]
|
|
|
|
|
|
J. M. Way, W. W. Harrington, K. K. Brown, W. K. Gottschalk, S. S. Sundseth, T. A. Mansfield, R. K. Ramachandran, T. M. Willson, and S. A. Kliewer Comprehensive Messenger Ribonucleic Acid Profiling Reveals That Peroxisome Proliferator-Activated Receptor {{gamma}} Activation Has Coordinate Effects on Gene Expression in Multiple Insulin-Sensitive Tissues Endocrinology, March 1, 2001; 142(3): 1269 - 1277. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-M. Ye, P. J. Doyle, M. A. Iglesias, D. G. Watson, G. J. Cooney, and E. W. Kraegen Peroxisome Proliferator--Activated Receptor (PPAR)-{alpha} Activation Lowers Muscle Lipids and Improves Insulin Sensitivity in High Fat--Fed Rats: Comparison With PPAR-{gamma} Activation Diabetes, February 1, 2001; 50(2): 411 - 417. [Abstract] [Full Text]
|
|
|
|
|
|
A. Minnich, N. Tian, L. Byan, and G. Bilder A potent PPAR{alpha} agonist stimulates mitochondrial fatty acid {beta}-oxidation in liver and skeletal muscle Am J Physiol Endocrinol Metab, February 1, 2001; 280(2): E270 - E279. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. M. Lapsys, A. D. Kriketos, M. Lim-Fraser, A. M. Poynten, A. Lowy, S. M. Furler, D. J. Chisholm, and G. J. Cooney Expression of Genes Involved in Lipid Metabolism Correlate with Peroxisome Proliferator-Activated Receptor {gamma} Expression in Human Skeletal Muscle J. Clin. Endocrinol. Metab., November 1, 2000; 85(11): 4293 - 4297. [Abstract] [Full Text]
|
|
|
|
|
|
C. Binnert, H. A. Koistinen, G. Martin, F. Andreelli, P. Ebeling, V. A. Koivisto, M. Laville, J. Auwerx, and H. Vidal Fatty acid transport protein-1 mRNA expression in skeletal muscle and in adipose tissue in humans Am J Physiol Endocrinol Metab, November 1, 2000; 279(5): E1072 - E1079. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. M. Peters, S. S. T. Lee, W. Li, J. M. Ward, O. Gavrilova, C. Everett, M. L. Reitman, L. D. Hudson, and F. J. Gonzalez Growth, Adipose, Brain, and Skin Alterations Resulting from Targeted Disruption of the Mouse Peroxisome Proliferator-Activated Receptor beta (delta ) Mol. Cell. Biol., July 15, 2000; 20(14): 5119 - 5128. [Abstract] [Full Text]
|
|
|
|
 |
|
 P. J. Cox, D. A. Ryan, F. J. Hollis, A.-M. Harris, A. K. Miller, M. Vousden, and H. Cowley Absorption, Disposition, and Metabolism of Rosiglitazone, a Potent Thiazolidinedione Insulin Sensitizer, in Humans Drug Metab. Dispos., July 1, 2000; 28(7): 772 - 780. [Abstract] [Full Text]
|
|
|
|
 |
|
 C. Huin, L. Corriveau, A. Bianchi, J. M. Keller, P. Collet, P. Krémarik-Bouillaud, L. Domenjoud, P. Bécuwe, H. Schohn, D. Ménard, et al. Differential Expression of Peroxisome Proliferator-activated Receptors (PPARs) in the Developing Human Fetal Digestive Tract J. Histochem. Cytochem., May 1, 2000; 48(5): 603 - 612. [Abstract] [Full Text]
|
|
|
|
|
|
A. Meirhaeghe, G. Martin, M. Nemoto, S. Deeb, D. Cottel, J. Auwerx, P. Amouyel, and N. Helbecque Intronic Polymorphism in the Fatty Acid Transport Protein 1 Gene Is Associated With Increased Plasma Triglyceride Levels in a French Population Arterioscler. Thromb. Vasc. Biol., May 1, 2000; 20(5): 1330 - 1334. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Martin, H. Poirier, N. Hennuyer, D. Crombie, J. C. Fruchart, R. A. Heyman, P. Besnard, and J. Auwerx Induction of the Fatty Acid Transport Protein 1 and Acyl-CoA Synthase Genes by Dimer-selective Rexinoids Suggests That the Peroxisome Proliferator-activated Receptor-Retinoid X Receptor Heterodimer Is Their Molecular Target J. Biol. Chem., April 21, 2000; 275(17): 12612 - 12618. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. A. J. M. VAN DER LEE, P. H. M. WILLEMSEN, G. J. VAN DER VUSSE, and M. VAN BILSEN Effects of fatty acids on uncoupling protein-2 expression in the rat heart FASEB J, March 1, 2000; 14(3): 495 - 502. [Abstract] [Full Text]
|
|
|
|
 |
|
 P. N. Black, N. J. Færgeman, and C. C. DiRusso Long-Chain Acyl-CoA-Dependent Regulation of Gene Expression in Bacteria, Yeast and Mammals J. Nutr., February 1, 2000; 130(2): 305 - 305. [Abstract] [Full Text]
|
|
|
|
|
|
N. R. Coe, A. J. Smith, B. I. Frohnert, P. A. Watkins, and D. A. Bernlohr The Fatty Acid Transport Protein (FATP1) Is a Very Long Chain Acyl-CoA Synthetase J. Biol. Chem., December 17, 1999; 274(51): 36300 - 36304. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Desvergne and W. Wahli Peroxisome Proliferator-Activated Receptors: Nuclear Control of Metabolism Endocr. Rev., October 1, 1999; 20(5): 649 - 688. [Abstract] [Full Text]
|
|
|
|
|
|
V. Giguère Orphan Nuclear Receptors: From Gene to Function Endocr. Rev., October 1, 1999; 20(5): 689 - 725. [Abstract] [Full Text]
|
|
|
|
|
|
M. J. McArthur, B. P. Atshaves, A. Frolov, W. D. Foxworth, A. B. Kier, and F. Schroeder Cellular uptake and intracellular trafficking of long chain fatty acids J. Lipid Res., August 1, 1999; 40(8): 1371 - 1383. [Abstract] [Full Text]
|
|
|
|
|
|
M. Febbraio, N. A. Abumrad, D. P. Hajjar, K. Sharma, W. Cheng, S. F. A. Pearce, and R. L. Silverstein A Null Mutation in Murine CD36 Reveals an Important Role in Fatty Acid and Lipoprotein Metabolism J. Biol. Chem., July 2, 1999; 274(27): 19055 - 19062. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. D. Oakes, A. Kjellstedt, G.-B. Forsberg, T. Clementz, G. Camejo, S. M. Furler, E. W. Kraegen, M. Ölwegård-Halvarsson, A. B. Jenkins, and B. Ljung Development and initial evaluation of a novel method for assessing tissue-specific plasma free fatty acid utilization in vivo using (R)-2-bromopalmitate tracer J. Lipid Res., June 1, 1999; 40(6): 1155 - 1169. [Abstract] [Full Text]
|
|
|
|
|
|
C. E. Gargiulo, S. M. Stuhlsatz-Krouper, and J. E. Schaffer Localization of adipocyte long-chain fatty acyl-CoA synthetase at the plasma membrane J. Lipid Res., May 1, 1999; 40(5): 881 - 892. [Abstract] [Full Text]
|
|
|
|
|
|
R. C. Cooksey, L. F. Hebert Jr., J.-H. Zhu, P. Wofford, W. T. Garvey, and D. A. McClain Mechanism of Hexosamine-Induced Insulin Resistance in Transgenic Mice Overexpressing Glutamine:Fructose-6-Phosphate Amidotransferase: Decreased Glucose Transporter GLUT4 Translocation and Reversal by Treatment with Thiazolidinedione Endocrinology, March 1, 1999; 140(3): 1151 - 1157. [Abstract] [Full Text]
|
|
|
|
|
|
B. I. Frohnert, T. Y. Hui, and D. A. Bernlohr Identification of a Functional Peroxisome Proliferator-responsive Element in the Murine Fatty Acid Transport Protein Gene J. Biol. Chem., February 12, 1999; 274(7): 3970 - 3977. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Ribon, J. H. Johnson, H. S. Camp, and A. R. Saltiel Thiazolidinediones and insulin resistance: Peroxisome proliferatoractivated receptor gamma activation stimulates expression of the CAP gene PNAS, December 8, 1998; 95(25): 14751 - 14756. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. J. Reginato, S. T. Bailey, S. L. Krakow, C. Minami, S. Ishii, H. Tanaka, and M. A. Lazar A Potent Antidiabetic Thiazolidinedione with Unique Peroxisome Proliferator-activated Receptor gamma -activating Properties J. Biol. Chem., December 4, 1998; 273(49): 32679 - 32684. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Staels, J. Dallongeville, J. Auwerx, K. Schoonjans, E. Leitersdorf, and J.-C. Fruchart Mechanism of Action of Fibrates on Lipid and Lipoprotein Metabolism Circulation, November 10, 1998; 98(19): 2088 - 2093. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Motojima, P. Passilly, J. M. Peters, F. J. Gonzalez, and N. Latruffe Expression of Putative Fatty Acid Transporter Genes Are Regulated by Peroxisome Proliferator-activated Receptor alpha and gamma Activators in a Tissue- and Inducer-specific Manner J. Biol. Chem., July 3, 1998; 273(27): 16710 - 16714. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C.-Y. Fan, J. Pan, N. Usuda, A. V. Yeldandi, M. S. Rao, and J. K. Reddy Steatohepatitis, Spontaneous Peroxisome Proliferation and Liver Tumors in Mice Lacking Peroxisomal Fatty Acyl-CoA Oxidase. IMPLICATIONS FOR PEROXISOME PROLIFERATOR-ACTIVATED RECEPTOR alpha NATURAL LIGAND METABOLISM J. Biol. Chem., June 19, 1998; 273(25): 15639 - 15645. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. H. Yan, W. G. Karam, J. L. Staudinger, A. Medvedev, B. I. Ghanayem, and A. M. Jetten Regulation of Peroxisome Proliferator-activated Receptor alpha -Induced Transactivation by the Nuclear Orphan Receptor TAK1/TR4 J. Biol. Chem., May 1, 1998; 273(18): 10948 - 10957. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. P. Beigneux, A. H. Moser, J. K. Shigenaga, C. Grunfeld, and K. R. Feingold The Acute Phase Response Is Associated with Retinoid X Receptor Repression in Rodent Liver J. Biol. Chem., May 19, 2000; 275(21): 16390 - 16399. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. J. Barbera, A. Schluter, N. Pedraza, R. Iglesias, F. Villarroya, and M. Giralt Peroxisome Proliferator-activated Receptor alpha Activates Transcription of the Brown Fat Uncoupling Protein-1 Gene. A LINK BETWEEN REGULATION OF THE THERMOGENIC AND LIPID OXIDATION PATHWAYS IN THE BROWN FAT CELL J. Biol. Chem., January 5, 2001; 276(2): 1486 - 1493. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. M. Lewin, J.-H. Kim, D. A. Granger, J. E. Vance, and R. A. Coleman Acyl-CoA Synthetase Isoforms 1, 4, and 5 Are Present in Different Subcellular Membranes in Rat Liver and Can Be Inhibited Independently J. Biol. Chem., June 29, 2001; 276(27): 24674 - 24679. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Guerre-Millo, P. Gervois, E. Raspe, L. Madsen, P. Poulain, B. Derudas, J.-M. Herbert, D. A. Winegar, T. M. Willson, J.-C. Fruchart, et al. Peroxisome Proliferator-activated Receptor alpha Activators Improve Insulin Sensitivity and Reduce Adiposity J. Biol. Chem., May 26, 2000; 275(22): 16638 - 16642. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Hashimoto, W. S. Cook, C. Qi, A. V. Yeldandi, J. K. Reddy, and M. S. Rao Defect in Peroxisome Proliferator-activated Receptor alpha -inducible Fatty Acid Oxidation Determines the Severity of Hepatic Steatosis in Response to Fasting J. Biol. Chem., September 8, 2000; 275(37): 28918 - 28928. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |