![]()
|
|
||||||||
Volume 272, Number 46, Issue of November 14, 1997
pp. 28948-28953
(Received for publication, June 27, 1997, and in revised form, July 30, 1997)
From the Department of Veterinary Pathobiology, University of
Missouri, Columbia, Missouri 65211
Serum amyloid A (SAA) is a plasma protein that is
associated with many inflammatory diseases including amyloidosis,
arthritis, and atherosclerosis. SAA level is significantly increased
during inflammatory condition, and such abnormal expression of this
protein is linked to the pathogenesis of the above-mentioned diseases. A promoter element, designated as SAA-activating sequence (SAS), located between Serum amyloid A (SAA),1
a member of the acute-phase group of proteins, is synthesized in the
body in response to inflammatory signals. Normally, SAA is expressed at
an undetectable level, but infection, tissue injury, or even a
prolonged high fat diet can highly induce the synthesis of this protein
(1-3). SAA synthesized in various cell types (liver being the major
source), circulates as constituents of high density lipoprotein (HDL).
Whereas HDL of a normal healthy individual may contain negligible
amount of SAA, under inflammatory conditions, concentration of SAA in
HDL can rise significantly and at the peak of inflammation may
constitute up to 80% of total HDL protein. Recent studies have
suggested that SAA may alter lipid metabolism because: (i) SAA has the
ability to displace apoA1 protein from HDL (4-6), (ii) SAA can itself bind to cholesterol (7), and (iii) SAA can modulate
lecithin-cholesterol acyltransferase activity associated with HDL
(8).
SAA is a well conserved protein among various species. In mammals, SAA
comprises multiple isoforms and is coded by multiple genes. Increase of
SAA biosynthesis is due primarily to its increased transcription (9).
In addition to transcriptional induction, several reports have
indicated that mRNA stability also contributes to the enhanced
expression of SAA in mouse (10) and human (11, 12). Studies have shown
that C/EBP and NF- Plasmid construct pSAS-CAT was prepared
by ligating SAA genomic DNA sequences from Monocyte cell THP-1 was
obtained from the American Type Culture Collection and maintained in
suspension in RPMI 1640 containing 10% fetal calf serum. For
induction, cells were stimulated with 10 µg of LPS/ml and were grown
for different lengths of time (as indicated). For transient
transfection of THP-1 cells, 2 × 107 cells were
transfected with 10 µg of plasmid DNA by the DEAE-dextran method
(23). Rabbit synoviocyte cells HIG-82, obtained from ATCC, were
transfected by calcium-phosphate method (24). Chloramphenicol acetyltransferase (CAT) activity of the transfected cells was performed
according to the method described before (16). All transfection
experiments were performed at least three times.
The
preparation of bacterial extracts containing SAF was carried out as
described (25). A Nuclear
extracts were prepared from uninduced and LPS-induced THP-1 cells
essentially following a method described previously (20). Protein
concentrations were measured as described (27). DNA binding assays were
performed following a standard protocol described earlier (17) with
32P-labeled double-stranded DNA probe. In some binding
assays, competitor oligonucleotides were included in the reaction
mixture. For antibody interaction studies, anti-Sp1 (Santa Cruz
Biotechnology) and anti-SAF antiserum (20) were added to the reaction
mixture during a preincubation period of 30 min on ice. Purified Sp1
protein was obtained from Promega Corporation.
SAA gene transcription is induced in monocyte/macrophage
cells by LPS (20, 28). We previously showed that nonhepatic
transcriptional induction of SAA is primarily regulated by SAS promoter
located between To assess the in vivo role of SAF in SAA gene transcription,
we used a transient expression system in which a cloned cDNA of SAF
transcription factor2 was overexpressed in THP-1
monocytic/macrophage cells. A reporter gene, pSAS-CAT, containing one
copy of the promoter element of the SAA gene from
[View Larger Version of this Image (24K GIF file)]
To test how LPS treatment of
monocyte cells affects DNA binding activity of SAF, gel mobility shift
assays were performed with untreated and LPS-treated THP-1
monocytic/macrophage cell nuclear extracts. As the DNA probe, we used a
minimal binding region, sequences from
[View Larger Version of this Image (88K GIF file)]
Because the above experiment indicated LPS-mediated increase
in the levels of multiple DNA-protein complexes, namely a, b, and d, we
sought to determine the kinetics of activation of these DNA-binding
proteins. Nuclear extracts were prepared from THP-1 cells that were
incubated in the presence of LPS for various lengths of time (Fig.
3, lanes 1-4). Intensity of
the complexes a, b, and d began increasing at 4 h post LPS
treatment and reached the maximum level at 24 h. The patterns of
DNA-protein complexes formed by LPS-24 h and LPS-48 h nuclear extracts
were not very different (compare between lanes 3 and
4). The level of complex c remained virtually unchanged
during LPS exposure of the cells. Some additional minor bands composed
of faster migrating DNA-protein complexes that are sequence-specific,
as judged from efficient competition by excess unlabeled homologous
probe (described earlier in Fig. 2), were also detected. Preincubation
of LPS-24 h nuclear extract with anti-SAF antibody completely inhibited
complexes b and d and partially blocked complex a formation (Fig. 3,
lanes 6 and 7). In the SAF DNA-binding element, a
Sp1 transcription factor DNA-binding sequence, a 5
[View Larger Version of this Image (76K GIF file)]
In light of the facts that Sp1 can interact with the SAS
promoter and Sp1 is present ubiquitously in almost all cell types, we
addressed whether Sp1 and SAF can simultaneously interact with SAS
element and, if so, what is the functional consequence of such an
interaction. In vitro interaction of these transcription factors was studied using a fractionated system where both of these
factors could be provided in different combinations. DNA binding assays
were performed with a SAF protein preparation obtained from a
[View Larger Version of this Image (41K GIF file)]
Because protein-protein interactions between transcription factors
often lead to both high level and cell-specific gene activation, we
evaluated the rate of heteromeric SAF-Sp1 complex formation with SAS
DNA. The rate of SAF-Sp1 heteromeric complex formation was favored
(Fig. 5, lanes 1-4) when a
constant amount of SAF was used in conjunction with increasing amounts
of Sp1. Addition of increasing levels of Sp1 recruited more SAF to form
the SAF-Sp1 heteromer, and because a constant amount of SAF was
provided, this somewhat lowered the level of SAF-specific complex
(lanes 2-4). In a reciprocal experiment, an
increasing dose of SAF in the presence of a constant amount of Sp1
again favored the formation of SAF-Sp1 heteromer rather than the
SAF-specific complex (lanes 5-8).
[View Larger Version of this Image (57K GIF file)]
To evaluate the in vivo effect of SAF and Sp1
interaction in the transcriptional activation of SAA gene, we performed
cotransfection experiments using pSAS-CAT reporter plasmid and
expression vectors encoding SAF and Sp1. Transfection assays were
conducted in HIG-82 cells because these cells have lower levels of
endogenous Sp1 and SAF activity than that present in THP-1 cells (data
not shown). Lower levels of endogenous SAF and Sp1 made it easier to
observe transactivation in these transfection experiments. Transfection of pSAS-CAT reporter gene with SAF expression plasmid yielded about
6-fold activation, whereas the same amount of Sp1 expression plasmid
transactivated the reporter gene about 2.5-fold over the control (Fig.
6). However, combination of equal
amounts of both SAF and Sp1 activated the pSAS-CAT reporter
gene at a level much higher than that expected from their additive
value (Fig. 6). The expression plasmid, pSVSp1-FX (containing a
frameshift mutation in the Sp1 coding region), had no positive
transactivating effect.
[View Larger Version of this Image (41K GIF file)]
The transactivation potential of the SAF-Sp1 heteromer was further
analyzed by cotransfecting cells with SAS-promoter containing reporter
plasmid plus a combination of a constant amount of SAF and increasing
amounts of Sp1 expression plasmids. The results, described in Fig.
7A, revealed a synergistic
dose-dependent transactivation of the reporter gene.
Western blot analysis (data not shown) was performed, which verified
that the increase of reporter gene expression was proportional to
increasing Sp1 protein expression in the transfected cells, whereas the
expression level of SAF protein remained same. In a reciprocal
experiment, similar synergistic transactivation was seen with a fixed
amount of Sp1 and an increasing dose of SAF expression plasmids (Figs.
7B). Western blot analysis verified that the increase in
reporter gene expression is proportional to increased SAF production
with similar levels of Sp1 production (data not shown). In both
experiments, the observed induction level of the reporter gene was
always higher than that achieved by a simple additive effect of the two
transcription factors. These results suggested that Sp1 may cooperate
with SAF and synergize its transactivating ability.
[View Larger Version of this Image (42K GIF file)]
SAA, a member of the acute phase protein group is gaining more
attention in the pathogenesis of atherosclerosis because recent studies
have suggested that SAA, by displacing apoA1 from HDL, is capable of
affecting lipoprotein metabolism (4). Also, SAA is found to be a
constituent of the atherosclerotic lesions (29), which is composed of
macrophage-derived foam cells. In an effort to control the SAA
production as a therapeutic measure against pathophysiological
inflammatory conditions, we undertook this investigation. The mechanism
of SAA gene induction was studied, particularly in monocyte/macrophage
cells, which play a key role in atherogenesis. In this report we have
shown that SAF, a zinc finger transcription factor is involved in the
regulation of SAA induction in THP-1 monocyte/macrophage cells. Also,
we provide evidence for physical and functional interactions between
the transcription factors SAF and Sp1 that have a synergistic
transactivating ability on SAS promoter.
SAS promoter containing We have also assessed the functional consequence of SAF and Sp1
interaction on SAA gene induction. SAF is a zinc finger transcription factor containing six zinc finger motifs. Although SAF and Sp1 both
contain zinc finger domains, SAF is structurally different from Sp1 and
from three of its family members, Sp2, Sp3, and Sp4. Sp1 alone does not
interact very efficiently with the SAS promoter but forms a stable
heteromeric SAF-Sp1 complex with SAS DNA. In fact, in vitro
DNA-binding studies suggested that SAF-Sp1 heteromeric complex is more
favorably formed than the SAF- or Sp1-specific complex (Figs. 4 and 5).
We also noticed that SAF-Sp1 heteromer has a higher affinity for the
SAS element than the SAF alone (Fig. 2). The fact that complex a, which
is composed of SAF-Sp1 heteromer, is readily competed by the SAS
oligonucleotide, suggests that this complex has high affinity for SAS
promoter sequence. In the competition assay, preincubation of nuclear
extract with unlabeled SAS oligonucleotide allows virtually
irreversible binding of only high affinity factors to the SAS
oligonucleotide, thus making these factors unavailable for binding to
radiolabeled SAS oligonucleotide, which is subsequently added in the
assay mixture. Rapid sequestration of complex a by the competitor SAS
oligonucleotide thus indicates high affinity binding for the involved
factors. Because the level of SAA gene activation with combined SAF and
Sp1 is much higher than that seen by these factors alone, this
suggested that SAF-Sp1 heteromer is a superior transactivator of SAA
than SAF or Sp1 alone. Accumulative evidence indicates that the
cell-specific high level expression of a gene is achieved through the
combined actions of a group of transcription factors. In fact, previous studies showed that under some inflammatory conditions NF- In summary, our data show that SAF activates SAA gene induction in
THP-1 monocyte/macrophage cells. The in vivo biological consequence of the fact that SAF can functionally cooperate with Sp1, a
ubiquitously present transcription factor, and synergistically transactivate SAA promoter remains to be determined.
We are grateful to Dr. J. Saffer for the
generous gift of pSVSp1-F and pSVSp1-FX plasmids.
Induction of Serum Amyloid A (SAA) Gene by SAA-activating
Sequence-binding Factor (SAF) in Monocyte/Macrophage Cells
EVIDENCE FOR A FUNCTIONAL SYNERGY BETWEEN SAF AND Sp1*

280 and
226 has been implicated in the induction mechanism and a nuclear factor, SAS-binding factor (SAF), has been
shown to bind to this region. In this report, using a cloned SAF gene
in transient transfection assay, we provide evidence that SAF
potentiates SAA gene expression through SAS element. Furthermore, we
show that during lipopolysaccharide-mediated induction of SAF,
heteromeric complex with transcription factor Sp1 is formed. Transfection assays using both transcription factor genes have demonstrated that SAF-Sp1 heteromer is a highly potent transactivator of SAA expression.
B are involved in regulating SAA gene expression
in human (13), mouse (14), rat (15), and rabbit (16-18). Recently, a
new promoter called SAA-activating sequence (SAS) is identified to
control expression of a rabbit SAA gene in some nonhepatic cells (19).
By promoter function analysis, we previously showed that SAS promoter
element can regulate LPS-mediated SAA gene induction in
monocyte/macrophage cells (20). This study, however, did not reveal
whether the SAS-binding factor (SAF) is directly involved in
potentiating SAA transcription. In the present study, we have used a
cloned cDNA of SAF transcription
factor2 and have shown that
transient overexpression of SAF can activate a rabbit SAA2 gene
promoter in monocyte/macrophage cells. We also present evidence for
heteromeric complex formation between SAF and Sp1. Furthermore, we
demonstrate that cooperative interaction between SAF and Sp1
synergistically activates SAA gene expression through the SAS
element.
Plasmid Constructs
280 to
226 into plasmid
vector pBLCAT2 (21). Plasmid pmtSAS-CAT, a mutant derivative of
pSAS-CAT, contained the mutated DNA sequence
(5
-CAAGACGGTCACTAGACTCCCAATGAGTCGAGACCGTCGACATCC-3
) ligated into pBLCAT2 vector. The underlined bases indicate
substitution. Plasmid p3XSAS-CAT was constructed by ligating three
tandem copies of the SAA promoter sequences from
254 to
226. The
selected clones were analyzed by DNA sequencing to verify their
authenticity and orientation. CMV (cytomegalovirus)-SAF contained
cDNA encoding rabbit SAF gene subcloned into pCMV4 vector.
pSVSp1-F and pSVSp1-FX expression plasmids contained
wild-type and mutated Sp1 cDNAs, respectively (22).
gt11 clone carrying SAF cDNA was isolated from
a
gt11-cDNA library of rabbit brain using ligand interaction or
Southwestern blot method as described (26). The selected
clone2 was lysogenized in host Escherichia coli
that was grown in LB medium, induced by
isopropyl-
-D-thiogalactopyranoside, and harvested by
centrifugation. The cells were resuspended in 10 mM
Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA, 0.5 mM PMSF, 0.5 mg/ml benzamidine, 2.5 M urea and
lysed by repeated freeze-thaw cycles. The cell extracts were partially
purified by passing through a DE-52 column. Flowthrough fractions that
contain SAF DNA binding activity were dialyzed against 20 mM HEPES, pH 7.9, 100 mM KCl, 0.2 mM EDTA, 0.5 mM dithiothreitol, 20% glycerol,
0.5 mM phenylmethylsulfonyl fluoride, 0.5 mg/ml
benzamidine.
Transactivation of SAA Promoter by SAF in Monocyte/Macrophage
Cells
280 and
226 nucleotide sequences (19). In keeping with the promoter activity, using THP-1 monocytic cell nuclear extract,
specific DNA-protein complex binding to this promoter was detected. The
DNA-binding factor was characterized as SAF (20). These studies,
although demonstrating involvement of SAF in DNA binding to SAA
promoter, did not determine the transactivation potential of this
factor in SAA gene expression.
280 to
226, was
transfected alone or with an expression plasmid containing SAF cDNA
under the control of CMV promoter. As shown in Fig.
1, overexpression of SAF increased the
reporter gene expression in a dose-dependent manner. The
level of reporter gene activation was much higher on a reporter gene containing multiple copies of the SAS sequence. The transactivating effect of pCMV-SAF was negligible on pmtSAS-CAT reporter gene containing mutated sequence of SAS element. These results indicate that
SAF is involved in the expression of SAA gene in monocyte/macrophage cells.
Fig. 1.
Transactivation of the pSAS-CAT promoter by
SAF. The reporter plasmid pSAS-CAT contains SAA DNA sequences from
280 to
226 base pairs. Plasmid p3XSAS-CAT contains three copies of the SAS element (
254 to
226). These SAA sequences were ligated in
front of the tk promoter in the pBLCAT2 vector. Identical
experiments were performed with a reporter plasmid, pmtSAS-CAT, which
contains mutated SAS element, and pBLCAT2 parent vector plasmids. The
reporter plasmids (10 µg) were cotransfected in THP-1 cells with
increasing amounts of the expression plasmid pCMV-SAF.
254 to
226 base pairs,
containing SAF-binding elements that produced a better resolution of
the DNA-protein complexes than that obtained with the larger probe
(
280/
226) used earlier (20). Interestingly, the shorter DNA-binding
element (
254/
226) gave rise to multiple DNA-protein complexes
designated as a, c, d, and e by the control untreated THP-1 nuclear
extract (Fig. 2, lane 1). It
is possible that nuclear proteins interacted less efficiently with the
larger probe (
280/
226) due to the steric hindrances posed by extra
5
-flanking sequences. Occasionally, we have seen a slightly higher
level of complex d in control untreated THP-1 cell extract than that
seen in lane 1. This pattern was changed when the probe was
incubated with same protein amount of LPS-treated (48 h) THP-1 cell
nuclear extract (lane 2). LPS treatment increased the
intensities of complexes a and d severalfold and caused the appearance
of a new complex designated as b that was not formed by untreated cell
nuclear extract (lane 1). The intensity of minor complex e,
seen in lane 1, was reduced in LPS-treated nuclear extract.
This complex often showed variability in its intensity; its level
decreased variably during LPS treatment of the cells. Intensity of
complex c remained virtually unchanged during LPS treatment.
Competition with a molar excess of a nonradioactive homologous probe
inhibited complexes a, b, and d but not complex c (Fig. 2, lanes
4-9). At a very high level of the homologous probe, some
reduction of the intensity of complex c was seen (data not shown). This
suggested that complex c was formed by a very low affinity DNA-protein
interaction between a nuclear factor and the SAA promoter. In some
experiments, we have noticed the appearance of some faster migrating
DNA-protein complexes that are sequence-specific, as judged from
efficient competition by excess unlabeled homologous probe.
Fig. 2.
Analysis of the DNA-protein complexes using
electrophoretic mobility shift assay. Nuclear extracts (10 µg of
protein) prepared from THP-1 cells, both uninduced (lane 1)
and LPS-induced for 48 h (lanes 2-9), were incubated with the SAS
DNA probe (
254 to
226) containing the following sequence
254CCCTTCCTCTCCACCCACAGCCCCCATGG
226. The
resulting complexes were resolved in a 6% nondenaturing polyacrylamide
gel. Five DNA-protein complexes (a-e) were seen with LPS-induced
nuclear extract. In some binding reactions (lanes 4-9),
increasing levels of unlabeled homologous probe were used for
competition analysis of the DNA-protein complexes formed by the LPS-48
h THP-1 cell nuclear extract. Lanes 1-3 contain no competitor DNA.
-CCACCC-3
sequence
element, is embedded (see legend of Fig. 2). To determine if any of
these complexes are formed by Sp1, we used anti-Sp1 antibody
(lane 8). Sp1 antibody partially supershifted the complex a
and had no effect on complexes b and d. The addition of nonspecific
preimmune serum also had no effect on any of these complexes
(lane 9). In a separate experiment when both anti-SAF and
anti-Sp1 antibodies were included in a single reaction, complete
inhibition of complex a as well as complexes b and d were noted (data
not shown). These results taken together indicated that complex a is
formed by the combined interaction of Sp1 and SAF, whereas complexes b
and d are formed by SAF only. It is noteworthy to mention that
complex a has a higher affinity for the SAS element because it
was most efficiently competed with the homologous probe (Fig. 2,
lanes 3-9).
Fig. 3.
Time course of activation and
characterization of the nuclear factors that form DNA-protein
complexes. Nuclear extracts (10 µg of protein) prepared from
THP-1 cells, both uninduced (lane 1) and LPS-induced for
4-48 h as indicated (lanes 2-4), were incubated with SAS
probe, a 32P-labeled SAA DNA fragment containing the SAA
promoter sequence from
254 to
226. The resulting complexes were
resolved in a 6% nondenaturing polyacrylamide gel. Characterization of
the DNA-protein complexes used various antisera. Lanes 5-9
contain 10 µg of LPS-48 h THP-1 nuclear extract. Lane 5 contains no antibody, lanes 6 and 7 contain 1 and
2 µl of anti-SAF antibody respectively, lane 8 contains
anti-Sp1 antibody, and lane 9 contains preimmune serum. The
arrow indicates the supershifted complex in lane
8.
gt11
recombinant phage containing SAF cDNA and affinity column purified
Sp1 available from a commercial source (Promega). As the probe we used
the SAS element, sequences from
254 to
226. The addition of
bacterially produced SAF fusion protein formed a single DNA-protein
complex (Fig. 4, lane 1). The
anti-SAF antibody considerably inhibited this complex formation
(lane 4), which indicated the specific nature of this
complex. It should be noted that the cloned SAF-
gal fusion protein
produced only one complex with SAS element as opposed to several
DNA-protein complexes (a, b, d, and e) formed by the crude nuclear
extract of THP-1 cells (Figs. 2 and 3). This difference could arise due
to the presence of either several different isoforms of SAF family in
THP-1 cells or due to other factors present in the THP-1 cells that may
have some influence in SAF binding or both. In comparison to SAF,
purified Sp1 protein interacted very weakly, almost at an undetectable level with SAS DNA (lane 2). This SAS-Sp1 complex was
detectable only after prolonged exposure of the autoradiogram (data not
shown). When we added both SAF and Sp1 proteins in the DNA binding
assay (lane 3), two DNA-protein complexes, one migrating
with SAF-specific complex and the other migrating quite slowly, were
detected. Although SAF antibody considerably reduced the levels of both
of these two complexes (lane 6), the Sp1 antibody
supershifted the slower migrating complex (lane 7). These
results indicated that the top complex in lane 3 is a
heteromer of SAF and Sp1 and the bottom complex is composed of only
SAF. It was interesting that although Sp1 alone could not form a very
visible complex with SAS promoter DNA, in the presence of SAF it formed
a heteromeric SAF-Sp1 complex that was readily detectable.
Fig. 4.
Binding of SAF and Sp1 with SAS
promoter. Radiolabeled SAS probe (
254 to
226) was incubated
with either purified SAF prepared from
gt11-lysogen or purified Sp1
(Promega Corporation) or both SAF and Sp1 as indicated. In some binding
reactions, anti-SAF antibody or anti-Sp1 antibody has been included.
The arrow indicates the supershifted complex in lane
7.
Fig. 5.
Effect of increasing concentrations of SAF
and Sp1 on the binding of homo- and heteromeric complexes of the two
transcription factors. Electrophoretic mobility shift assays were
performed using SAS element (
254 to
226) as probe. In lanes
1-4, a constant amount of SAF was incubated with increasing
concentrations of Sp1. In lanes 5-8, a constant amount of
Sp1 was incubated with increasing concentrations of SAF. The products
were fractionated in a native 6% polyacrylamide gel.
Fig. 6.
Transactivation potential of SAF and Sp1 from
SAS element. HIG-82 cells were cotransfected with pSAS-CAT
reporter plasmid and plasmids expressing either Sp1, mutated Sp1, SAF
or various combinations as indicated in the figure. pSAS-CAT reporter
plasmid (10 µg of DNA) was cotransfected with 2 µg each of pCMV
empty vector, pCMV-SAF, pSVSp1-F, pSVSp1-FX, pCMV-SAF+pSVSp1,
or pCMV-SAF+pSVSp1-FX. Control indicates pSAS-CAT
reporter plasmid only. Fold induction of the CAT activity in the
cotransfected cells relative to that of reporter plasmid alone was
determined and plotted as relative CAT activity.
Fig. 7.
Transcriptional synergy between SAF and
Sp1. HIG-82 cells were cotransfected with pSAS-CAT reporter
plasmid and plasmids expressing either Sp1 or SAF or in combination as
indicated in the figure. A, pSAS-CAT reporter plasmid (10 µg of DNA) was transfected alone or cotransfected with constant
amount of pCMV-SAF plasmid DNA (2 µg) plus increasing amounts of
pSVSp1-F plasmid DNA. B, pSAS-CAT reporter plasmid (10 µg of DNA) was cotransfected with pSVSp1-F (2 µg)
plus increasing amounts of pCMV-SAF plasmid DNA.
280 to
226 base pairs sequences of SAA gene
is induced in response to LPS treatment of THP-1 cells. SAF has been
found to interact with this element, and this protein was detected in
both hepatic and several nonhepatic cells (19, 20). In an effort to
understand whether such interaction of SAF with SAS element results in
transcriptional induction, we have studied the transactivation
potential of a cloned SAF gene on a reporter gene carrying a SAS
element. Increasing reporter CAT activity as more of the SAF cDNA is
included in the cotransfection assay (Fig. 1) confirmed that SAA gene
induction through SAS promoter is indeed regulated by SAF. Consistent
with the ability of SAF to induce expression via the SAS element, an
increase of the DNA binding ability of SAF in response to LPS-treatment
was seen (Figs. 2 and 3). Although control THP-1 cells contain a low
level of SAF, our results indicate that such a low level of SAF may not be sufficient to promote SAA gene expression.
B and C/EBP synergistically transactivate SAA expression (18). Sp1 was
recently shown to potentiate the transactivation role of GATA-1, a
major erythroid transcription factor (30). The mechanism by which Sp1
potentiates SAF activity is not yet known. It is tempting to speculate
that the SAF-Sp1 heteromeric complex establishes a stable contact with
basal transcription initiation complex with the help of Sp1 when
interacting with the SAS element via SAF. Indeed, the glutamine-rich
activation domains of Sp1 were found to bind to a glutamine-rich domain
of TAFII 110, which is a major protein component of basal transcription
initiation complex (31, 32), and such interaction helps to mediate
transcription activation possibly via conformational or covalent
modification of the basal transcription complex (reviewed in Ref. 33).
SAF-Sp1 interaction may play a critical role in this process where SAF
via interacting with the SAS promoter of SAA gene recruits Sp1 to the
vicinity of basal transcription complex formed at the TATA box and
facilitates Sp1 interaction to TAFII 110.
*
This work was supported by U. S. Public Health Service
Grant DK49205 and funds from the College of Veterinary Medicine,
University of Missouri.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed: Dept. of Veterinary
Pathobiology, University of Missouri, W104 Veterinary Medicine Bldg.,
Columbia, MO 65211. Tel.: 573-882-6728; Fax: 573-884-5414.
1
The abbreviations used are: SAA, serum amyloid
A; SAS, SAA-activating sequence; SAF, SAS-binding factor; LPS,
lipopolysaccharide; HDL, high density lipoprotein; CAT, chloramphenicol
acetyltransferase; CMV, cytomegalovirus.
2
B. K. Ray and A. Ray, manuscript in
preparation.
Volume 272, Number 46,
Issue of November 14, 1997
pp. 28948-28953
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
B. K. Ray, A. Shakya, J. R. Turk, S. S. Apte, and A. Ray Induction of the MMP-14 Gene in Macrophages of the Atherosclerotic Plaque: Role of SAF-1 in the Induction Process Circ. Res., November 26, 2004; 95(11): 1082 - 1090. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. K. Ray, R. Murphy, P. Ray, and A. Ray SAF-2, a Splice Variant of SAF-1, Acts as a Negative Regulator of Transcription J. Biol. Chem., November 22, 2002; 277(48): 46822 - 46830. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. A. Feister, B. J. Auerbach, L. A. Cole, B. R. Krause, and S. K. Karathanasis Identification of an IL-6 response element in the human LCAT promoter J. Lipid Res., June 1, 2002; 43(6): 960 - 970. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. R. Hughes, T. S. Tengku-Muhammad, S. A. Irvine, and D. P. Ramji A Novel Role of Sp1 and Sp3 in the Interferon-gamma -mediated Suppression of Macrophage Lipoprotein Lipase Gene Transcription J. Biol. Chem., March 22, 2002; 277(13): 11097 - 11106. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ray, G.-Y. Yu, and B. K. Ray Cytokine-Responsive Induction of SAF-1 Activity Is Mediated by a Mitogen-Activated Protein Kinase Signaling Pathway Mol. Cell. Biol., February 15, 2002; 22(4): 1027 - 1035. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. K. Ray, J. Chen, and A. Ray Catalytic Subunit of Protein Kinase A Is an Interacting Partner of the Inflammation-Responsive Transcription Factor Serum Amyloid A-Activating Factor-1 J. Immunol., August 15, 2001; 167(4): 2343 - 2348. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ray A SAF Binding Site in the Promoter Region of Human {gamma}-Fibrinogen Gene Functions as an IL-6 Response Element J. Immunol., September 15, 2000; 165(6): 3411 - 3417. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ray and B. K. Ray Persistent Expression of Serum Amyloid A During Experimentally Induced Chronic Inflammatory Condition in Rabbit Involves Differential Activation of SAF, NF-{kappa}B, and C/EBP Transcription Factors J. Immunol., August 15, 1999; 163(4): 2143 - 2150. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ray, H. Schatten, and B. K. Ray Activation of Sp1 and Its Functional Co-operation with Serum Amyloid A-activating Sequence Binding Factor in Synoviocyte Cells Trigger Synergistic Action of Interleukin-1 and Interleukin-6 in Serum Amyloid A Gene Expression J. Biol. Chem., February 12, 1999; 274(7): 4300 - 4308. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ray and B. K. Ray Isolation and Functional Characterization of cDNA of Serum Amyloid A-Activating Factor That Binds to the Serum Amyloid A Promoter Mol. Cell. Biol., December 1, 1998; 18(12): 7327 - 7335. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |