INTRODUCTION

Endo--D-mannosidase is unique among the processing enzymes involved in trimming newly attached N-linked glucosylated polymannose oligosaccharides in that it cleaves internally to release a Glc13Man disaccharide rather than excising single terminal sugar residues (1, 2). Since this enzyme also has the capacity to remove tri- and diglucosylated mannose (Glc₃Man and Glc₂Man) from nascent carbohydrate units, it provides an alternate processing pathway that can circumvent glucosidase blockades imposed by inhibitors or enzyme deficiencies and thereby make possible the continued synthesis of complex N-linked oligosaccharides (3-5).

In a previous report from this laboratory (6), purification of the endomannosidase from rat liver Golgi membranes was achieved by affinity chromatography on a Glc-Man-Affi-Gel¹ column and yielded a preparation that upon examination by SDS-polyacrylamide gel electrophoresis revealed two protein bands (molecular mass, 60 and 56 kDa) present in approximately equal amounts. Since the larger of the these two components has now been identified as the molecular chaperone, calreticulin, which like the endomannosidase has a high affinity for monoglucosylated polymannose oligosaccharides, it was presumed that the 56-kDa protein represents the enzyme (7).

Indeed, the purification achieved by the ligand affinity chromatography gave us the opportunity in the present investigation to isolate the endomannosidase and, from the amino acid sequences of several of its trypsin-generated peptides, synthesize primers for the preparation of a probe to screen a rat liver cDNA library. A clone isolated in this manner encompassed the unique open reading frame of the enzyme and permitted the formation of a vector for transfection of Escherichia coli. High endomannosidase levels were induced in these cells so that the protein carrying this activity could be isolated to electrophoretic purity. This permitted the generation of antibodies which reacted with the rat liver Golgi enzyme and provided a tool for future explorations of its biological function and subcellular distribution.

EXPERIMENTAL PROCEDURES

Endomannosidase was isolated from rat liver Golgi membranes by affinity chromatography on Glc-Man-Affi-Gel as described previously (6). The purified enzyme preparation was submitted to 12% polyacrylamide gel electrophoresis in SDS and then electroblotted onto a polyvinylidene difluoride membrane (Bio-Rad) for 6 h (60 V) at 4 °C in 10 mM CAPS, pH 10.6, buffer in a manner previously described (7). After visualization of the two protein bands by a brief exposure to 0.1% Ponceau S in 1% acetic acid, the 56-kDa component was excised, washed with water, and sent frozen to the Harvard University Microchemistry Facility. Under the direction of William S. Lane, solid phase trypsin digestion was carried out, followed by reverse phase-high performance liquid chromatography of the resulting peptides. Several of the latter were then selected for amino acid sequencing by automated Edman degradation (8).

Degenerate primers (9) based on the amino acid sequences for three peptides from the affinity purified endomannosidase were synthesized by the Midland Certified Reagent Co. and were used for PCR with rat liver cDNA as a template (CLONTECH, oligo(dt) primed mRNA from 10-12-week-old Sprague-Dawley rats). The reactions were performed in 100 µl of 20 mM Tris chloride, pH 8.3, buffer containing 0.2 mM mixed deoxynucleotides, 2 mM MgCl₂, 300 pmol of each primer, 1 ng of cDNA, and 2.5 units of Taq DNA polymerase (U. S. Biochemical Corp.) with a Techne Thermal Cycler. Cycles were carried out as follows: 3 min at 72 °C, 45 s at 94 °C, and 2 min at 46 °C; these were repeated 35 times with an 8-min extension at 72 °C following the final cycle. Products were ligated into a pCR-II vector (TA cloning kit, Invitrogen) for amplification in E. coli TOP10F cells (Invitrogen). After purification of plasmids on tip-500 columns (Qiagen), sequencing of the inserts utilized primers intrinsic to the vector (SP6, M13F, M13R, T7, and T3).

For isolation of the insert containing the sequence for all three peptides (EM1, Fig. 1), the plasmids were cleaved with EcoRI (Life Technologies, Inc.) followed by electrophoresis on low-melt agarose gel (Bio-Rad). Recovery of the EM1 from the gel was accomplished by digestion with -agarase (Calbiochem) at 45 °C followed by precipitation of the DNA with ethanol. The size of the electrophoresed DNA fragments was assessed with 123-bp and 1-kb ladders (Life Technologies, Inc.).

[View Larger Version of this Image (19K GIF file)]

A gt11 cDNA library prepared from adult male Sprague-Dawley rat liver by oligo(dt) and random priming was obtained from CLONTECH (5-Stretch Plus) and screened with the PCR-generated probe EM1 after radiolabeling with [-³²P]dCTP (NEN Life Science Products) using the Megaprime Labeling Kit (Amersham Corp.). Host cells (strain Y1090r, CLONTECH) and phage were grown on 150-mm plates; nitrocellulose filters were prehybridized in 50% formamide in 5 × Denhardt's solution containing 5 × SSPE, 0.1% SDS, and 100 µg/ml salmon sperm DNA and hybridized in the same solution for 20 h at 42 °C. Filters were washed at room temperature three times in 2 × SSC containing 0.5% SDS, followed by washes in 0.2 SSC, 0.1% SDS for 1 h at 50 °C, 1 h at 55 °C, and 30 min at 60 °C. A total of four rounds of screening were performed before selecting a single positive plaque. After amplification of the clone, purification of the  DNA was accomplished with Wizard Lambda columns (Promega).

Purified  DNA containing the endomannosidase sequences was digested with EcoRI (Life Technologies, Inc.), as was the phagemid, pBluescript II SK() (Stratagene); the latter was also digested with alkaline phosphatase. After electrophoresis on 0.8% agarose, the 5.4-kb DNA fragment representing EM2 was eluted from the appropriate gel segment by maceration in buffer, followed by centrifugation at 3,000 rpm for 10 min through a 1-ml Aerosol Block tip (Marsh). Ligation of EM2 into the vector was performed overnight at 14 °C using T4 ligase (Invitrogen).

Transfection of XL1-Blue cells (Stratagene) for subcloning was accomplished by the 42 °C heat-shock technique (10). Transformants were grown in SOC medium (20 g/liter tryptone, 5 g/liter yeast extract, 0.5 g/liter NaCl, and 20 mM glucose) for 1 h at 37 °C prior to spreading on agar plates that were prepared in Luria broth containing 50 µg/ml ampicillin and precoated with IPTG plus 5-bromo-4-chloro-3-indolyl -D-galactopyranoside. After overnight growth at 37 °C, white colonies were selected for streaking on fresh plates. From the second set of plates, several white colonies were chosen for growth overnight at 30 °C in Luria broth containing 100 µg/ml ampicillin. Plasmids purified using the Plasmid Mini kit (Qiagen) and digested with EcoRI were found to contain the 5.4-kb insert.

Sequencing was carried out using the automated fluorescent dye terminator technique (Perkin-Elmer ABI model 373) by the DNA core of the Joslin Diabetes Center. The primers utilized in this procedure, in addition to those representing sequences present in the several vectors (SP6, T3, T7, M13F, and M13R), were initially based on the endomannosidase peptides 1, 2, and 3 (Table I). Subsequent primers (Table II) were based on the DNA sequences determined for the PCR product, EM1, as well as for clone EM2 (Fig. 1) and were synthesized by the DNA core of the Joslin Diabetes Center.

Table I. Sequence of trypsin peptides from rat liver Golgi endomannosidase Peptidea Sequenceb Position in proteinc P-1 YGNHPAFYR 234-242 P-2 TWANLLTPSGSQXVR 266-280 P-3 YYEVGL(S)AALQTQP(S)LI(L)IT 370-389 a Peptides are designated by the order of their HPLC elution which coincided with their relative position in the peptide chain. b The amino acid symbols given in parentheses represented probable amino acids; the nucleotide sequence confirmed the presence of all except the (L) at position 387 which proved to be serine. c See Fig. 2 for the numbering of the amino acid sequence.

Table II. Primers utilized for PCR and sequencing Degenerate primers based on peptide sequencesa   PR-1S TAY GKI AAY CAY CCI GCN TTY TA   PR-1AS TA RAA NGC NGG RTG RTT   PR-2S ACI TGG GCI AAY YTI YTI ACI CCI WSI GGI WSI CAR III GTI CGI   PR-2AS TG ISW ICC ISW IGG IGT IAR IAR RTT IGC CCA IGA   PR-3S TAY TAY GAR GTI GGI CTN III GCI GCN CTI CAR ACN CA   PR-3AS GT IAT IAG IAT IAG III NGG YTG IGT YTG NAG NGC Modified peptide-based primersb   PRM-1S TAT GKS AAC CAT CCY GCC TTC TA   PRM-2S ACA TGG GCC AAT CTA TTA ACA CCC TCA GGA TCT CA   PRM-2AS CCC GCG AAC ACT CTG AGA TCC TGA GGG TGT TAA TAG ATT   PRM-3S CTA AGC GCT GCA CTC CAG AC EM clone sequence-based primersc   C1 (S 3-21) GGT TTT GGT GAG GGC ATT C   C2 (S 235-252) CTT CCA AAG GAG TGA TCG   C3 (S 285-304) AAG GGG CTG GTG TGA CTG TG   C4 (AS 398-379) GTG GGT TTC CAT ACC AAC TG   C5 (AS 514-495) ACT GGA GCC AAT GTC ATC TG   C6 (S 739-758) TCG AGA TGA CCA AAA CAT GC   C7 (AS 1314-1295) GCA GTT CTT TTG GGG ACA GC   C8 (S 1322-1341) GTA TAC CTG GAT TAC CGG CC   C9 (S 1426-1445) CAG CTG CCT GCT TCA TAA TG   C10 (S 1682-1701) GAA ATC TTA ATG GAG TTG CC   C11 (S 2015-2034) CTG TTA GCC ATG GTC TGT TG Primers for PCR generation of TrcHis insertd   IN-1 (S78-96) G GAT CCC AGG AAA AAC ATG GGA GC   IN-2 (AS1539-1520) ACA GTA GCA AGC ACA CAT TG a Degenerate sense (S) and antisense (AS) primers (PR) based on sequences obtained for peptides 1, 2, and 3 (Table I). The abbreviations used for nucleotides are: K for G or T; R for A or G; Y for T or C; W for A or T; S for C or G; N for A, C, G, or T; I, inosine. b Optimized primers (PRM) for peptides based on sequences determined for PCR product EM1. The abbreviations used for nucleotides are the same as in footnote a. c Sense and antisense primers (C) based on sense (S) and antisense (AS) sequences determined for 5.4-kb clone isolated from gt11 rat liver library. Numbers refer to the position of nucleotides relative to the start of the 5.4-kb clone (Fig. 1). For sequencing this clone, primers representing lambda regions were also synthesized: gt1-5(sense): GAC TCC TGG AGC CCG; gt11-3(antisense) GGT AGC GAC CGG CGC. d In order to prepare an appropriate PCR product with a BamHI site for insertion into the vector TrcHisB, a sense primer containing the 5 region of the 5.4-kb clone beginning 11 nucleotides prior to the ATG start of the EM open reading frame plus an additional restriction site-specific sequence (underlined). The antisense primer was based on the sequence starting 76 nucleotides beyond the TAA stop codon. The EcoRI recognition sequence for the 3 end of this insert was derived from the TA vector into which the PCR product was amplified.

Northern blotting was performed with a rat Multiple Tissue Northern blot (CLONTECH) representing 2 µg of purified poly(A) RNA from each of several rat tissues, using the PCR-generated probe, EM1 (Fig. 1), after radiolabeling with [³²P]dCTP by the Megaprime labeling system (Amersham Corp.).

Prehybridization and hybridization were performed at 68 °C for 30 and 90 min, respectively, utilizing ExpHyb buffer (CLONTECH). The blots were washed for 40 min at room temperature in 2 × SSC, 0.05% SDS, followed by two 50 °C rinses in 0.1 × SSC, 0.1% SDS prior to exposure to X-Omat AR film (Kodak) at 80 °C. The components visualized by autoradiography were quantitated by scanning with a laser densitometer (model 300A, Molecular Dynamics).

To produce the E. coli endomannosidase as a fusion protein containing in its NH₂-terminal region a polyhistidine tag suitable for nickel-affinity purification, as well as an enterokinase susceptible cleavage sequence, the pTrcHisB vector (Invitrogen), which contains the trp-lac promoter (11), was chosen and appropriate PCR primers designed. The 5 primer contained the nucleotide sequence of EM2 (Fig. 1) from positions 78-96 (CCAGGAAAAACATGGGAGC), which included the first in-frame ATG; additionally, the sequence GGATC was added to the 5 end to permit digestion with BamHI (Fig. 1). The antisense primer (ACAGTAGCAAGCACACATTG) was complementary to positions 1540 to 1521 of EM2. The template for PCR treatment was the pBluescript II plasmid pEM2 (160 ng) containing the 5.4-kb insert; the reaction volume was 100 µl and contained 50 mM Tris chloride, pH 9.2, 16 mM NH₂SO₄, 1.75 mM MgCl₂, 0.2 mM each dNTP, 1 µM each primer, and 2.5 units of Taq polymerase (Perkin-Elmer). All of the 27 cycles involved 45 s at 94 °C, 1 min at 52 °C, and 2 min at 72 °C. The PCR product was cloned into the pCR II vector of the TA Cloning System (Invitrogen) and its identity confirmed by sequencing.

After release of the insert by digestion of the TA plasmid with BamHI and EcoRI, ligation was carried with the similarly cleaved pTrcHisB vector to produce pTrcHisEM (Fig. 1) which was used to transform the competent E. coli strains TOP10F and JM109 (Invitrogen) using the heat-shock procedure (10). Similar transformations of the E. coli with the pTrcHisB vector itself were also performed to serve as controls. These transformed cells were streaked on ampicillin-containing plates, and colonies were selected for growth in SOB medium containing 50 µg/ml ampicillin.

The kinetics of expression were determined from a time course after initiation of induction. Cells were grown in SOB medium containing 100 µg/ml ampicillin at 37 °C to an absorbance of 0.6 at 600 nm. After addition of IPTG to a concentration of 1 mM, the cells were shaken vigorously at 27 or 37 °C, and samples were taken at various times. For determination of endomannosidase activity, cell pellets suspended in 20 mM phosphate, pH 7.8, with 500 mM NaCl were submitted to 4 × 10-s bursts of a Branson sonifier (setting 1) followed by four cycles of freeze-thawing; subsequent to centrifugation (4,000 × g for 30 min) aliquots of the supernatants were assayed for enzyme activity.

Large scale (250-500 ml) preparations of JM109 or Top10F cells containing the pTrcHisEM vector were grown in SOB medium containing 100 µg/ml ampicillin as above and induced with 1 mM IPTG. After centrifugation to recover the cells, extraction medium (20 mM phosphate, pH 7.8 containing 500 mM NaCl, 2 µg/ml leupeptin, 10 units/ml aprotinin, and 1 mM phenylmethylsulfonyl fluoride) was added, using 1 ml for each 10 ml of the cell culture which represented approximately 6 mg of protein. The suspended cells were then disrupted at 4 °C in 5-ml portions with 4 × 10-s bursts of a Branson sonifier (setting 1) and then subjected to four cycles of freeze-thawing (ethanol/dry ice followed by 37 °C water); this was followed by a 15-min room temperature digestion with DNase (10 µg/ml) in the presence of 1 mM magnesium acetate. After centrifugation (20,000 × g for 20 min) the lysates contained approximately 30% of the total cellular protein and 80% of the endomannosidase activity.

For purification of the polyhistidine-tagged fusion protein, nickel-affinity chromatography was carried out at a room temperature on a column (1 × 13 cm) of Ni-NTA resin (Qiagen), equilibrated with the extraction medium. The lysate from 250 to 500 ml of cell culture, after concentration (Centriprep 30, Amicon) to 12 ml, was applied to the column in 4-ml aliquots, each of which was allowed to equilibrate for 20 min. The column was then washed with extraction medium and subsequently was eluted with this medium containing 20 mM imidazole. The chromatography was carried out at room temperature, and aliquots were taken for endomannosidase assay and electrophoretic examination. The tubes containing the enzyme were pooled for further purification by Glc-Man-Affi-Gel affinity chromatography.

After concentration, the Ni-NTA column enzyme pool was applied to Glc-Man-Affi-Gel at 2 °C in the presence of 0.1% Triton X-100, 0.2 mM CST, and protease inhibitors as described previously (6). After a wash with the buffer containing 1 M NaCl, the enzyme was eluted with 0.1 M glycine HCl buffer, pH 3.0 (purified by filtration using a Centriprep-30 membrane), containing 0.1% Triton and 1 M NaCl (6) while 4-ml fractions were collected; these acidic fractions were immediately neutralized by the addition of solid NaMES. For evaluation of the NH₂-terminal region of the fusion protein the purified endomannosidase was digested with 1 unit of recombinant enterokinase (Novagen) at 25 °C for 16 h prior to examination by SDS-polyacrylamide gel electrophoresis.

Antiserum against peptide 2 (Table I), synthesized by the Joslin Diabetes Center Peptide Laboratory employing the Applied Biosystem Model 430A synthesizer and subsequently coupled to keyhole limpet hemocyanin through an NH₂-terminal cysteine (12), was prepared in a New Zealand White rabbit with a program of multiple intradermal injections. Polyclonal antibodies of highly purified endomannoside from transfected JM109 E. coli lysates were prepared in rabbits by intradermal injection of the enzyme (204 µg of protein) followed by two booster doses of 68 µg each of this protein.

Electrophoretic analysis of E. coli lysates and column fractions was performed by the procedure of Laemmli (13) on 10% gels (1.5 mm thick); protein bands were visualized by silver staining (14).

For immunological identification, the proteins were transferred to nitrocellulose membranes (Bio-Rad) at 60 V for 5 h at 2 °C (15). The membranes, after staining with 0.2% Ponceau S in 1% acetic acid and destaining in water, were blocked by treatment with 5% nonfat milk in Tris-buffered saline (0.1 M Tris chloride, pH 7.4, 0.1 M NaCl). Interaction of the antiserum against peptide 2 with the nitrocellulose sheet was followed by treatment with peroxidase-labeled goat anti-rabbit IgG (Kirkegaard & Perry Laboratories) and SuperSignal substrate (Pierce); detection was accomplished by chemiluminescence on X-Omatic AR film (Eastman Kodak Co.). For the visualization of the components that reacted with the polyclonal antibodies against the intact endomannosidase, a procedure utilizing ¹²⁵I-labeled protein A followed by autoradiography was employed as described previously (16).

For enzyme analysis of tissues from male rats (200 g, CD strain, Taconic, Inc.), homogenization was carried out in 4 volumes of 0.1 M MES buffer, pH 6.5, with a Polytron for three 10-s bursts at setting 5. Postnuclear supernatants (800 × g for 10 min) of the homogenates were then centrifuged for 60 min at 100,000 × g to obtain membrane pellets which, after a wash with the homogenizing buffer, were suspended in the same buffer at a protein concentration of about 18 mg/ml. Endomannosidase activity of the postnuclear membranes of the rat tissues as well as of E. coli lysates and column fractions was determined by incubations with ¹⁴C-labeled Glc₁Man₉GlcNAc substrate (10,000 dpm) in the presence of CST (1 mM) and DMJ (2 mM) in 60 µl of 0.1 M NaMES buffer, pH 6.5, containing 0.2% Triton X-100 at 37 °C for 2 h in a manner similar to that previously described (1). The released disaccharide (Glc13Man) was separated from the oligosaccharide substrate by thin layer chromatography of the desalted and deproteinized samples on plastic sheets precoated with cellulose (0.1-mm thickness, Merck) in pyridine/ethyl acetate/water/acetic acid, 5:5:3:1. The radioactive components were detected by fluorography and quantitated after elution with water as previously reported (1). One unit of endomannosidase activity is defined as the amount of enzyme that catalyzes the release of 1,000 dpm of Glc13Man per h.

Protein was determined by the dye-binding technique (17) with bovine serum albumin as a standard; for analysis of E. coli cell fractions, solubilization was accomplished by heating in 0.05 N NaOH at 100 °C for 5 min.

To visualize radioactive components after thin layer chromatography, the plates were sprayed with a mixture containing 2-methylnaphthalene (18) and exposed to X-Omat AR film (Kodak) at 80 °C. Scintillation counting of eluates from these thin layer chromatograms was performed in Monofluor (National Diagnostics) in a Beckman LS7500 instrument.

Nucleic acid and protein data base searching were performed utilizing primarily the Johns Hopkins University BioInformatics Web Server and the National Center for Biotechnology Information WWW Server (19, 20). Hydropathy plots according to Kyte and Doolittle (21) were calculated using the Protean software by DNASTAR, Inc.

RESULTS

As previously reported, the affinity purified endomannosidase preparation was found to consist of two protein components with values of 60 and 56 kDa (6). Since a previous study has indicated that the higher molecular mass component is identical to calreticulin (7), our attention was exclusively directed to the 56-kDa band which we assumed to carry the endomannosidase activity. Indeed, sequence determinations of three tryptic peptides from the latter component (Table I) were found to have no homology to any previously reported proteins and accordingly were used to design suitable primers for cloning of the endomannosidase.

When degenerate primers, both sense and antisense, based on the endomannosidase peptides (Table II) were used for PCR treatment of rat liver cDNA, a number of components were obtained and amplified by insertion into pCRII vectors. DNA sequencing of these inserts indicated that an endomannosidase-related product was obtained only with the primer pair representing peptide 1 sense (PR-1S) and peptide 3 antisense (PR-3AS); this 470-bp DNA (designated EM1) contained the sequences for the three endomannosidase peptides (Fig. 1).

Upon screening a total of 12 150-mm plates representing 1.8 × 10⁷ phage plaques with a radiolabeled EM1 probe, one positive clone was found, and this was carried through three additional rounds of screening before selecting a single positive plaque. After amplification of the clone, EcoRI digestion released a 5.4-kb insert, which was designated EM2 (Fig. 1). This DNA was ligated into pBluescript II (pEM2) for amplification and sequencing. Additional primers for DNA sequencing (Table II) were synthesized based on the nucleotide sequences obtained for both EM1 and EM2.

Although the EcoRI-released DNA segment EM2 was 5.4 kb in length, the automated DNA sequencing procedure provided reliable data only through nucleotide 2552 (Fig. 2); beyond this were several regions of poly(dT) that interfered with the sequence analysis. An untranslated 5 region (1-88 bp) preceded the first ATG of the open reading frame; this codon had an A at position 3 and a G at location +4, consistent with a Kozak consensus sequence for translation (22). At the 3 end, a substantially larger untranslated segment was found, with an additional 4-kb segment occurring after the TAA stop codon at 1442-1444 bp. The deduced open reading frame coded for a protein of 451 amino acids with an M_r value of 51,762 (Fig. 2). The three tryptic peptides (Table I) are contained in the open reading frame, and as anticipated each one is preceded by a Lys residue (Fig. 2). Polar and hydrophobic amino acids constituted 33 and 27 residues per 100 total residues, respectively. The hydropathy plot (Fig. 3) for the endomannosidase open reading frame indicated only a few hydrophobic regions, the most prominent occupying residues 25-36 and 375-390. The sequence (GALMAT), represented by residues 2-7, is consistent with N-myristoylation which would occur after removal of the NH₂-terminal methionine (23-25). No consensus sequences for N-linked glycosylation were found in this protein, which is consistent with the observation that its electrophoretic mobility was not affected by digestion with N-glycanase.²

[View Larger Version of this Image (69K GIF file)]

[View Larger Version of this Image (28K GIF file)]

After transfection of TopF10 E. coli with the TrcHisEM vector coding for the endomannosidase fusion protein (Fig. 1), endomannosidase assays conducted on cell lysates resulted in the release of the characteristic Glc13Man disaccharide from Glc₁Man₉GlcNAc substrate, although control cells containing the TrcHisB vector did not demonstrate such activity (cf. lanes 1 and 2; Fig. 4, left panel). However, when rat liver Golgi was added to the latter, the full activity known to be present in these membranes (1, 6) was evident (cf. lanes 2 and 3; Fig. 4). Like the purified enzyme from rat liver Golgi (6), the E. coli-expressed endomannosidase was unaffected by the exoglycosidase inhibitors CST and DMJ but was completely inhibited (Fig. 4, right panel) by Glc13DMJ, an analogue of the released disaccharide (26). The E. coli lysates did not demonstrate -mannosidase or -glucosidase processing activities as was evident from incubations with the Glc₁Man₉GlcNAc substrate in the absence of any inhibitor (Fig. 4, right panel).

[View Larger Version of this Image (51K GIF file)]

The time-dependent expression of the endomannosidase in the transfected cells after addition of IPTG was evident from the increasing level of endomannosidase activity as seen from the release of the Glc₁Man disaccharide (Fig. 5).

[View Larger Version of this Image (72K GIF file)]

A major portion of the enzyme activity (~80%) was solubilized by application of the combined sonication and freeze-thawing procedure to the E. coli cells, and the maximal level of enzyme induction was found to be similar at 27 and 37 °C although it appeared at a slower rate at the lower temperature. Transfected JM109 E. coli cells were consistently observed to produce a larger amount of IPTG-induced enzyme (approximately three times that of the TOP10F cells), and accordingly this strain was favored for high yield preparative purposes.

The presence of the polyhistidine region in the fusion protein permitted binding of the endomannosidase from E. coli lysates on the Ni-NTA resin (Fig. 6). Although some of the enzyme was only weakly bound, emerging in the buffer wash, 20 mM imidazole was required to achieve elution of most of the endomannosidase activity (Fig. 6). Since complete enzyme recovery was affected with 20 mM imidazole, this fractionation procedure could be abbreviated for preparative purposes by eluting the column with this histidine analogue as soon as the predominant protein peak had emerged.

[View Larger Version of this Image (26K GIF file)]

Further purification of the endomannosidase could be achieved by applying the Ni-NTA enzyme pool to Glc-Man-Affi-Gel from which it could be selectively eluted with pH 3.0 glycine buffer (Fig. 6). Indeed, polyacrylamide gel electrophoresis revealed only a single protein band (47 kDa) in the first fraction (G-1) emerging after application of the pH 3.0 buffer, and this coincided with enzyme peak which accounted for about 90% of the endomannosidase activity loaded onto the column (Fig. 7); other proteins present in Ni-NTA pool were not bound to the Glc-Man-Affi-Gel (Fig. 7). The endomannosidase identity of the component revealed by silver staining in fraction G-1 was further substantiated by the observation that antiserum directed against peptide 2 of the enzyme reacted with a single co-migrating band (Fig. 7). Furthermore, the molecular mass of this component was reduced by about 3 kDa after digestion with enterokinase (Fig. 7) as would be anticipated from the nature of the fusion protein. The average yield of purified endomannosidase from JM109 E. coli was 495 µg per liter of cultured cells, and its specific activity was 68 units/µg protein, which represented an approximately 280-fold purification over the cell lysate. This enzyme preparation was utilized for the preparation of polyclonal antibodies in rabbits.

[View Larger Version of this Image (55K GIF file)]

The polyclonal antibody against the Glc-Man-Affi-Gel purified enzyme also detected only a single component with a molecular mass of approximately 47 kDa (Fig. 8). This antibody provided us with the opportunity to explore the basis for the discrepancy in the size of the purified E. coli endomannosidase (47 kDa) and that anticipated from the fusion protein which would include the deduced open reading frame (52 kDa) plus its 3-kDa NH₂-terminal addition. Immunoblots of the E. coli lysates clearly showed that the expected 55-kDa protein was indeed present at early times subsequent to induction but was degraded to a 47-kDa component (Fig. 8); this proteolysis of the endomannosidase was observed in both TOP10F and JM109 cells. The observation that immunoblotting of rat liver Golgi membranes as well as the endomannosidase purified therefrom visualized exclusively a band (56 kDa) identical in size to that previously reported for the enzyme from this source (6) and served to confirm the relationship of the E. coli product with the mammalian enzyme.

[View Larger Version of this Image (66K GIF file)]

Endomannosidase was found to be present in all rat tissues examined (Fig. 9), with liver, in which this enzyme was first detected (1), having the highest specific activity. Hybridization of Northern blots with the radiolabeled probe EM1, which contains sequences for the three isolated trypsin peptides (P-1, P-2, and P-3) demonstrated an mRNA band at 4.9 kb in all of these tissues. Although this message is substantially larger than expected from the size of the protein, it is consistent with the 5.4-kb cDNA of the clone. The mRNA content exhibited a correlation with enzyme activity; the highest levels of message as well as enzyme activity were observed in liver and lung.

[View Larger Version of this Image (58K GIF file)]

DISCUSSION

The present study in which we have cloned, determined the open reading frame, and expressed rat liver endomannosidase has made it possible for this enzyme to take its place among the oligosaccharide processing hydrolases for which such information is currently available (27). Judging from nucleic acid and protein data base searches that we have carried out, it would appear that the deduced amino sequence of the endomannosidase codes for a unique protein that stands in contrast to the processing exomannosidases that have been grouped into two distinct classes on the basis of protein sequence homologies (27). The absence of a molecular relation with the other trimming glycosidases is not unexpected in view of the fact the endomannosidase is quite distinct in its catalytic properties, substrate specificities as well as response to inhibitors and divalent ions (1, 2, 26). Furthermore, it has recently become apparent that the endomannosidase, in contrast to the -glucoside and -mannoside processing hydrolases, is a recent evolutionary addition to the enzymatic machinery involved in N-linked oligosaccharide processing (28). Of possible future interest was our search finding that nucleotides 868-1165 of the endomannosidase had an 87% identity with nucleotides 2-299 of a yet uncharacterized Homo sapiens cDNA clone (H80483, clone 239648 5).

Our ability to express the endomannosidase in two strains of E. coli was particularly fortunate as not unexpectedly this enzyme is naturally absent in these cells. Indeed, even in the unfractionated lysate of JM109 cells the specific activity of the endomannosidase was about 10-fold higher than in rat liver Golgi membranes. Moreover, the purified E. coli-expressed endomannosidase had a substantially higher activity than the enzyme obtained from liver (6), and this can most likely be primarily attributed to the fact that the molecular chaperone, calreticulin, was not present in the bacterial preparation. The high purity of our E. coli-derived endomannosidase is to a large extent the result of the selective Glc-Man-Affi-Gel adsorption step, although the introduction of a polyhistidine tag onto the enzyme made possible an initial fractionation on a nickel resin.

The finding that the open reading frame of the endomannosidase represents a molecular mass (52 kDa) somewhat smaller than that of the rat liver enzyme as determined by SDS-polyacrylamide gel electrophoresis is most likely attributable to eukaryotic posttranslational biosynthetic events. Although N-glycosylation consensus sequences are not evident in the E. coli-expressed endomannosidase, an observation that is consistent with the lack of effect which N-glycosidase has on the rat liver enzyme, the possibility that O-linked oligosaccharides or other modifications may be present on the peptide chain of the latter protein has not been excluded. Indeed, the presence of a sequence suitable for myristoylation in the NH₂-terminal region of the enzyme would indicate that a posttranslational addition of this fatty acid could occur.

Even taking into account the possibility that the E. coli and rat liver endomannosidase differ from each other by posttranslational modification of the latter, the fusion protein (47 kDa), which as anticipated could be reduced in size by about 3 kDa by enterokinase excision of its NH₂-terminal polyhistidine tag, appeared to be smaller than expected from the open reading frame. It became apparent that this discrepancy can be attributed to some trimming of the COOH-terminal end of the enzyme's peptide chain by E. coli proteases (29, 30), since immunoblots of the lysates demonstrated a time-dependent degradation from 55 to 47 kDa in molecular mass. It is apparent that neither the active site of the endomannosidase nor the Glc-Man-Affi-Gel binding region is present in this cleaved 8-kDa COOH-terminal peptide.

The substantial yield of endomannosidase that could be isolated from the JM109 E. coli strain made possible the production of a high titer polyclonal antibody against the enzyme which reacted strongly with the 56-kDa component from rat liver Golgi. These antibodies promise to be useful in conducting further explorations of the biological function and subcellular localization of endomannosidase. Although previous studies have shown that the endomannosidase is associated with Golgi membranes (1) and functions in vivo prior to -mannosidase I in the processing sequence (31), the morphological situation of the enzyme, whether in cis-Golgi or in the endoplasmic reticulum-Golgi intermediate compartment, has not yet been determined either in liver or any of the various other tissues in which the enzyme was found to occur. The antibodies furthermore will be helpful in examining the postulated interrelationship (7) between endomannosidase and calreticulin in assisting proteins to fold or oligomerize in a post-endoplasmic reticulum cellular compartment.