|
|
|
|||||||
|
|||||||||
Volume 272, Number 48, Issue of November 28, 1997
pp. 30583-30588
(Received for publication, April 25, 1997, and in revised form, July 30, 1997)
From the Diabetes Branch, NIDDK, National Institutes of Health,
Bethesda, Maryland 20892-1770
ABSTRACT Leptin is a hormone that regulates metabolic
efficiency, energy expenditure, and food intake. Leptin is produced
chiefly in adipose cells, but in humans, mRNA encoding leptin is
also present in the placenta. Here we elucidate the basis for placental
leptin production. The same promoter is used for adipose and placental transcription. An upstream enhancer functions in the JEG-3 and JAR
choriocarcinoma cell lines but not in adipocytes or HeLa cells. The
minimal positive acting region is 60 base pairs in length. This region
is within a MER11 repetitive element, suggesting that human placental
expression of leptin is the result of insertion of this element.
Binding analyses demonstrated three protein binding sites, designated
placental leptin enhancer elements (PLE)1, PLE2, and PLE3. PLE2 binds
Sp1. Enhancer activity was reduced by mutation of the PLE1 or PLE3
sites but was unaffected by alteration of PLE2. Proteins binding to
PLE3 were present in JEG-3 and human placental nuclear extracts but not
in extracts from non-placental sources. Upon triplication, the PLE3
element was a strong enhancer in choriocarcinoma cells but not in HeLa
cells. The protein binding to the PLE3 motif appears to be a novel,
placenta-specific transcription factor.
INTRODUCTION Leptin is a hormone produced in adipose cells that is important in
the regulation of energy expenditure, food intake, and adiposity (1,
2). One function of leptin is that of a signal from adipose tissue to
the rest of the body reporting the degree of adiposity, and circulating
leptin levels correlate best with the amount of body fat (3, 4). Mice
lacking a functional leptin (formerly ob or
obese) gene become massively obese and develop diabetes
mellitus (5). Leptin treatment of ob/ob
(lepob/lepob) mice reverses all
these abnormalities, and in normal mice causes decreased food intake,
increased energy expenditure, and weight loss (6-8). Although much
studied for its role in regulation of increased adiposity, leptin is
probably of even greater importance in the metabolic adaptation to food
scarcity (9).
The infertility of ob/ob mice suggested that the missing
factor is needed for proper reproductive function (10). Recently, leptin was shown to induce completion of reproductive organ development and allow fertility in both female
(11)1 and male
ob/ob mice (12). Leptin treatment also causes precocious sexual maturity in wild-type mice (13, 14).
A number of laboratories have studied the regulation of the leptin gene
in adipose cells. Adipose leptin mRNA levels are increased by
glucocorticoids (15-17) and by insulin (18-20) and decreased by
EXPERIMENTAL PROCEDURES Northern blots were hybridized (Rapid-hyb, Amersham Corp.)
using probes (leptin, bp 463-3426 in GenBankTM/EBI accession number U43653, or JEG-3 (ATCC HTB-36) and HeLa cells (ATCC CCL-2)
were cultured in Dulbecco's modified Eagle's medium with 10% fetal
bovine serum, 2 mM glutamine, penicillin (100 units/ml),
and streptomycin (100 µg/ml) (Life Technologies, Inc.). JAR cells
(ATCC HTB-144) were grown in Waymouth's MB 752/1 medium (ICN)
supplemented as above.
The luciferase reporter constructs are
based on pGL3-basic or pGL3-promoter (Promega) and are shown
schematically in Figs. 2, 3, 4, 7, and 8. p1774 and p1779 were previously
named pGL3/3kb(+) and pGL3/0.3kb(+), respectively (28). Cloning details
are available from the authors. Transient expression using
electroporation in primary rat adipocytes was performed as described
(29). For JEG-3, JAR, and HeLa cells, typically 100 ng of luciferase
reporter, 5 ng of pRL-CMV internal control construct (Promega), and
carrier plasmid DNA to 1 µg were transfected using 5 µl of
LipofectAMINE (Life Technologies, Inc.). The medium was replaced after
5 h, and the cells were harvested 24 h later using 250 µl
of passive lysis buffer (Promega). Luciferase activity was measured
(Dual-Luciferase Reporter Assay System, Promega) and normalized to the
internal control. Transfections were performed in duplicate. Data are
the mean ± S.E., usually from three to five experiments.
[View Larger Version of this Image (27K GIF file)]
[View Larger Version of this Image (25K GIF file)]
[View Larger Version of this Image (21K GIF file)]
[View Larger Version of this Image (24K GIF file)]
[View Larger Version of this Image (21K GIF file)]
Binding reactions containing 3-5 µg of nuclear
extract protein (30), 20-40 fmol of kinase-labeled probe, 10 mM Tris-HCl, pH 7.5, 50 mM NaCl, 0.05% Nonidet
P-40, 1 mM EDTA, 0.5 mM DTT, 10% glycerol, and
1 µg of poly(dI:dC) were incubated (15 min, 23 °C) and
electrophoresed. Competitor oligonucleotides were added prior to the
addition of nuclear extract. Polyclonal antiserum to Sp1 (2 µg, Santa
Cruz Biotechnology) was added after the probe and incubated for 60 min
at 4 °C before electrophoresis. Methylation interference analysis
was performed essentially as described (31).
The following double-stranded oligonucleotides were used in gel
mobility shift assays (a lowercase letter indicates an introduced mutation): PLE1, CAGTACCCTCAGGCTTACTAGGGTGGTGAAAAACTC; mPLE1, CAGTACtagtAGGCTTACTAGGGTGGTGAAAAACTC; PLE2,
AGGGTGGTGAAAAACTCCGCCCTGGTAAATTTGTGG; mPLE2,
AGGGTGGTGAAAAACTCtagtCTGGTAAATTTGTGG; PLE3,
CCTGGTAAATTTGTGGTCAGACCAGTTTTCTGCTCT; mPLE3,
CCTGGTAAATTTGTGagtAGcttAGTTTTCTGCTCT; oligo D,
TGCTCTCGAACACTGTTTTCTGTTGTTTAAGATGTT; and Sp1,
GAATCCTAACTGGGCGGAGTTATGCTGGTG.
RESULTS Leptin expression in
adipose tissue (both white and brown) has been reported in a number of
species. The only other tissue identified as having significant amounts
of leptin mRNA is human placenta (27). However, we did not detect
leptin mRNA in mouse placenta,1 so a Northern blot was
performed to confirm that human placenta contains leptin mRNA (Fig.
1). Leptin RNA was detected in human placenta at a level roughly 100-fold lower than that in white adipose
tissue. It was the same size as in adipose tissue, ~4 kb. Additional
confirmation that leptin is expressed in placenta came from the
expressed sequence tag data base, which contains leptin cDNAs in
libraries from both 8-9 week and term placentas.
[View Larger Version of this Image (74K GIF file)]
Having established that human placenta contains leptin mRNA, we
performed 5 To search for DNA elements important for placental
expression, reporter constructs containing from 218 to 2922 bp of
5 Next, the 400-bp region was tested directly for enhancer activity using
the heterologous SV40 promoter to drive luciferase. In JEG-3 cells,
this DNA caused 8-9-fold enhancement, independent of its orientation,
at a distance of 2.1 kb from the promoter (Fig.
3). The 400-bp region could not increase
expression in the absence of a promoter and did not have promoter
activity itself. These data demonstrate that the DNA from 1951 to 1546 bp upstream of the leptin promoter contains an enhancer.
To identify the
boundaries of the enhancer, deletion constructs were tested for
enhancer activity (Fig. 4). Deletions
from the 3 Electrophoretic mobility shift assays were used to identify the
sequence elements and proteins responsible for the enhancer activity.
Four overlapping oligonucleotides (designated PLE1, PLE2, PLE3, and
oligo D) were used to screen the 100-bp region. With nuclear extracts
from JEG-3 cell and human placenta, protein binding was detected to
PLE1, PLE2, and PLE3 but not to oligo D (Fig.
5A). Nuclear extracts from
HeLa cells showed abundant binding to PLE2, slight binding to PLE1, and
none to PLE3. These data are consistent with the hypothesis that the
proteins binding to PLE3, and possibly PLE1, are placenta-specific.
Additional support comes from the observation that no PLE3 binding
activity was detected by mobility shift assays using nuclear extracts
from rat liver, undifferentiated 3T3-L1 preadipocytes, differentiated 3T3-L1 adipocytes, rat adipocytes, or erythroid K562 cells (data not
shown).
[View Larger Version of this Image (65K GIF file)]
Since the PLE2 oligonucleotide contains a canonical Sp1 sequence
(CCGCCC; Ref. 34), we tested whether Sp1 is responsible for the
observed protein binding to PLE2. An oligonucleotide with an authentic
Sp1 site gave the same pattern as PLE2 upon protein binding (Fig.
5A). Mutation of the Sp1 motif in PLE2 (mPLE2) abolished protein binding to PLE2 (Fig. 5A). Finally, antibodies to
Sp1 caused a decreased mobility of the protein-PLE2 complex (Fig. 5B). Thus, Sp1 is able to bind the PLE2 sequence and appears
to account for most of the binding activity to PLE2 in JEG-3 cells.
To identify specific residues in the PLE1 and PLE3 binding sites,
methylation interference analysis was performed. Methylation of
guanines at positions
[View Larger Version of this Image (50K GIF file)]
Since no protein binding to the 3 The contributions of the PLE1, PLE2, and PLE3 sites to the function of
the placental leptin enhancer was examined in the context of the 60-bp
enhancer. Mutation of the Sp1 site at PLE2 had no effect on activity
(Fig. 7). However, mutation of PLE1 reduced enhancement by 56%, and
mutation of PLE3 abolished enhancer activity. Similarly, constructs
containing only PLE1 (p1870) or PLE3 (p1871, p1877) did not have
enhancer activity. Triplication of the PLE3 motif created a construct
which showed 32-fold enhancement. Thus, as measured in JEG-3 cells, the
PLE3 motif is essential for enhancer activity and when multimerized is
a strong enhancer.
To examine the tissue specificity of the leptin enhancer, the reporter
plasmids were tested for activity in four different cell types (Fig.
8). Transient transfection expression
experiments confirmed that the enhancer works in the choriocarcinoma
cell lines (JEG-3, JAR) but not in adipocytes or HeLa cells. The
triplicated PLE3 element stimulated transcription in JEG-3 and JAR, but
not in HeLa cells. These results suggest that the enhancer and the transcription factor binding to the PLE3 site are
placenta-selective.
DISCUSSION Leptin is expressed predominantly in adipocytes where its
production correlates with the degree of adiposity. However, leptin is
also made by the placenta (27). We identified an enhancer located 1.9 kb upstream of the human leptin gene. It contains three protein binding
elements, PLE1-3, and transient expression experiments demonstrate
that the enhancer works in choriocarcinoma lines but not in adipose or
HeLa cells. The proteins binding to the PLE3 motif and possibly to the
PLE1 motif may be placenta-specific and contribute to the activity of
the enhancer in JEG-3 cells. Sp1 binds at the PLE2 motif but does not
contribute to enhancer activity in these cells. We concentrated on PLE3
which, when triplicated, constitutes a strong enhancer. Placental
enhancers have been identified for the chorionic somatomammotropin-B
(45) and glycoprotein hormone The enhancer is located within a MER11 (medium reiteration
frequency repeat) element (28). MER11 elements (which can be at least
1100 bp in length) are found 1500-3000 times in the human genome, but
are not present in the murine genome (49). This observation provides an
explanation of why the human, but not the murine, placenta expresses
leptin mRNA. The MER11 insertion introduced DNA elements in a
configuration that allowed interaction with the leptin promoter. (This
hypothesis can be tested using phylogenetic analysis, scoring placental
leptin expression, and the presence of the upstream MER11. Since the
MER11 upstream of the leptin gene is only 94% identical to a consensus
MER11, it is likely that the insertion event occurred at least several
million years ago.) The high degree of sequence similarity between the leptin enhancer and other MER11s suggests that the other MER11s have
the potential to be placental enhancers but require an accessible, compatible promoter for realization of this function. For example, 1.2 kb upstream of the human P450C17 gene (50) is a MER11 that matches the leptin PLE1-3 motifs exactly, yet the P450C17
gene is not expressed in the placenta (51). Insertion of repetitive elements in germline DNA is one of the major forces in evolution. Presumably, most insertions do not affect gene expression although sometimes insertion will disrupt a gene (52). Least commonly, introduction of a repetitive element results in a gain of function (53)
as apparently is the case with the human leptin enhancer. Thus, human
placental production of leptin appears to be an example of evolution in
action; ectopic expression of a gene is acquired coincidentally and
then is available for integration into the physiology of the
tissue.
The biology of leptin during gestation is not well understood. In
humans, the serum leptin concentration is increased 1.7-fold at the end
of pregnancy (corrected for fat mass; Ref. 54). Placental production is
a likely explanation for this increase although increased synthesis by
maternal adipose tissue is also possible. One might have expected that
a low leptin would be found during gestation since the
metabolic effects of high leptin levels are not observed (decreased
food intake) or would be undesirable (decreased metabolic efficiency)
when the mother is putting great effort into nutrition of the fetus and
into preparation for lactation. There is no information on either the
bioactivity/bioavailability of leptin, or on the responsiveness of the
body to leptin during pregnancy. If pregnancy is indeed a state of
leptin resistance, then the observed increase in leptin could be a
compensatory response. Alternatively, the increase in leptin levels
might be selectively important for the reproductive system, rather than
for general energy metabolism.
Some information about the role of leptin in pregnancy comes from
studies using the ob/ob mouse. Leptin is needed for
reproductive system maturation and fertility (11, 14) although this
requirement can be bypassed and pregnancy induced (inefficiently) by
gonadotropin treatment (10). Ongoing leptin treatment is not necessary
to maintain pregnancy, but leptin appears to be needed for parturition and nursing (11).1 However, comparison between humans and
mice is not straightforward. In humans, the serum leptin concentration
is increased 1.7-fold (54) compared with 20-fold in mice.1
In mice there is also an increase in expression of a high-affinity binding protein, which has not been observed in humans.1
While the increase in leptin during pregnancy in humans may be a random
evolutionary event without functional significance, another possibility
is that, in humans, placental leptin has a paracrine function, for
example preparing the uterus for parturition. This hypothesis has the
advantage of unifying the need for leptin during parturition in the
mouse, with the apparent attenuation of its systemic metabolic
effects.
In summary, we have identified an enhancer of the human leptin gene and
a placenta-selective element within the enhancer. This enhancer
mediates placental expression of leptin, which could explain the
increased leptin levels during human pregnancy. The biologic functions
of leptin in gestation are not known, but a role in the control of
pregnancy, parturition, or establishment of the lactating state seems
likely and merits further investigation.
FOOTNOTES ACKNOWLEDGEMENTS We thank G. Poy for excellent sequencing
support, Dr. J. Chou for discussions and for human placenta, and
Drs. Y. He, S. Taylor, and C. Trainor for comments on the
manuscript.
REFERENCES
Identification of a Placental Enhancer for the Human Leptin
Gene*
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
-adrenergic agonists (17, 21). Three motifs in the leptin promoter,
in addition to the TATA box, contribute to leptin transcription: a
C/EBP site at 
55 (22-26), a site at
87,2 and an Sp1 motif at
97.2 The observation that leptin RNA is also made by the
human placenta (27) motivated us to examine regulation of leptin
transcription in this tissue.
-Rapid Amplification of cDNA
Ends
-actin; labeled by random priming) and washed twice (0.5 × SSC, 20 min, 65 °C).
5-RACE3 was performed using
a commercial kit and human placental cDNA (CLONTECH). After amplification, the products were
cloned and sequenced.
Fig. 2.
Activity of the human leptin promoter.
Luciferase reporter plasmids containing 218 to 2922 bp of promoter and
5-flanking region were transfected into the indicated cell lines, and
expression was measured. The length of the 5-flanking region is shown
on the left, and luciferase activity (normalized to 218
construct in that cell line) is graphed at right. Luciferase
activity of the promoterless pGL3-basic reporter was 0.04 ± 0.02, 0.10 ± 0.05, 0.10 ± 0.03, and 0.02 ± 0.01 in JEG-3,
JAR, HeLa, and adipocytes, respectively. ND, not done.
Fig. 3.
An enhancer upstream of human leptin
gene. The fragment from 1951 to 1546 was inserted into various
luciferase (luc) reporters, as shown on the left
(not to scale). Luciferase activity upon transient expression in JEG-3
cells, normalized to pGL3-promoter is shown at right.
Fig. 4.
Luciferase expression of enhancer
deletions. Deletions of the 400-bp enhancer region, shown on the
left, were tested for enhancer activity by transient
expression in JEG-3 cells. Luciferase activity was normalized to
pGL3-promoter.
Fig. 7.
Transient expression of enhancer mutants in
JEG-3 cells. Reporter plasmids carrying the fragments and mutants
of the enhancer diagrammed on the left were tested.
Luciferase activity relative to pGL3-promoter is shown on the
right.
Fig. 8.
Cell specificity of the leptin enhancer.
Reporter plasmids (diagrammed on the left) were transfected
into the indicated cell lines. Luciferase activity, normalized to
pGL3-promoter in the same cell line, is shown to the right.
ND, not done.
Fig. 1.
Human leptin RNA levels. Northern blots
of poly(A)+ RNA (2 µg, CLONTECH) from
the indicated tissues and total RNA (20 µg; Ref. 28) from adipose
tissue were probed for leptin and -actin as indicated. The
leptin-probed multitissue blot was exposed ~3 × longer than the
adipose blot. Exposures of the actin-probed blots are comparable.
-RACE to determine if placenta and adipose tissue use the
same promoter. All six clones extending upstream of exon 2 agreed with
the reported sequence for exon 1 from adipose tissue (data not shown).
Thus, the same promoter is used for placental and adipose
expression.
-flanking genomic DNA were used in transient expression assays.
Expression of these leptin promoter-luciferase reporters was studied in
four cell types: primary rat adipocytes, HeLa cells, and the
choriocarcinoma cell lines JEG-3 (32) and JAR (33). In each case, all
constructs directed transcription at higher levels than the
promoterless pGL3-basic vector (Fig. 2).
Intriguingly, when the 5-flanking region was lengthened from 1546 to
1951, expression increased significantly in the choriocarcinoma cell
lines but not in adipose and HeLa cells (Fig. 2). These data suggest
that the 400-bp region from 1951 to 1546 bp upstream of the promoter
contains a placenta-selective enhancer.
-end to 1645, 1748, or 1847 reduced, but did not
abolish, luciferase expression. In contrast, any deletion of the 5-end resulted in complete loss of enhancer activity. Thus, the 100-bp region
from 1946- to 1847-bp upstream of the promoter is sufficient for
partial leptin enhancer activity in JEG-3 cells.
Fig. 5.
Electrophoretic mobility shift analysis of
the leptin enhancer. A, nuclear extracts prepared from JEG-3
and HeLa cells and from human placenta were used with the indicated
oligonucleotide probes (shown schematically at the bottom,
with sequences under "Experimental Procedures"). The positions of
PLE1, PLE2, PLE3, and Sp1 protein-DNA complexes and free probe are
indicated. B, antibody supershift analysis of PLE2. The
complex formed by JEG-3 extract with the PLE2 oligonucleotide was
incubated with either preimmune or anti-Sp1 antiserum, as indicated,
and then electrophoresed. The positions of the Sp1·DNA
(Sp1) and antibody·Sp1·DNA (ab-Sp1) complexes
are indicated.
1946, 1943, 1942, 1941, 1939, 1937, 1936, and 1935 in PLE1 and at 1894, 1892, 1888, and 1887 in
PLE3 reduced binding to these elements (Fig.
6A). This information was used
to design mutations of the PLE1 and PLE3 binding sites (Fig.
6B), which were incorporated into oligonucleotides (mPLE1 and mPLE3, sequences shown under "Experimental Procedures"). As expected, these mutant oligonucleotides were unable to form the PLE1
and PLE3 complexes (not shown) and were unable to compete for protein
binding to the unmutated sites (Fig. 6C). Binding to PLE1
was not competed by PLE2, PLE3, or Sp1. Binding to PLE3 was not
competed by PLE1, PLE2, or the following binding sites for
transcription factors known to regulate placental genes: Sp1 (35), AP1
and CREB (36-39), thyroid response element (40), Pit-1 (41, 42), C/EBP
(43, 44), DF3 and DF4 (45), FREAC (46), or GATA (39, 47) (Fig.
6C, and data not shown). Taken together, these results
demonstrate that the leptin enhancer contains three independent
protein-binding sites: an Sp1 site (PLE2) and two novel
placenta-selective binding sites, PLE1 and PLE3.
Fig. 6.
Protein binding to the PLE1 and PLE3 motifs.
A, methylated oligonucleotides were incubated with JEG-3
nuclear proteins and separated by electrophoresis. The free
(F) and bound (B) bands were eluted, cleaved with
piperidine, and electrophoresed under denaturing conditions. The
oligonucleotides (PLE1, PLE3) and labeled strand (Sense,
Antisense) are indicated. B, sequence of the
60-bp enhancer with the PLE motifs indicated. Methylation at positions interfering strongly with protein binding are marked by 
and interfering weakly by 
. Also indicated are the nucleotide changes introduced in making the mutated elements. C,
electrophoretic mobility shift assays using JEG-3 extracts and
oligonucleotides PLE1 and PLE3 as probes. Competitor oligonucleotides
were added in a 10- or 100-fold molar excess, as indicated.
40 bp of the 100-bp
enhancer was detected, a 60-bp enhancer comprising the 5-end was
tested for enhancer activity. A reporter using the 60-bp enhancer
(p1875) expressed luciferase at a slightly higher level than the 100-bp construct (p1860) (Fig. 7). It is
possible that the 3 end of the 100-bp region has some inhibitory
activity.
-subunit (48) genes. However, the PLE3
motif does not match the sequence elements (CRE (36), GATA (39), Pit-1
(41, 42), DF3 and DF4 (45), among others) implicated in transcription of these and other placental genes, suggesting that the protein binding
to the PLE3 motif is a novel, placenta-specific transcription factor.
Verification will require cloning of the transcription factor and
analysis of its expression pattern.
Scholar of the Lucille P. Markey Charitable Trust and to whom
correspondence should be addressed: Diabetes Branch, Bldg. 10, Rm.
8N-250, 10 Center Dr., MSC 1770, Bethesda, MD 20892-1770. Tel.:
301-496-6090; Fax: 301-402-0573; E-mail: mlr{at}helix.nih.gov.
1
Gavrilova, O., Barr, V., Marcus-Samuels, B., and
Reitman, M. (1997) J. Biol. Chem. 272, in press.
2
M. M. Mason, Y. He, H. Chen, M. J. Quon, and M. Reitman, unpublished observations.
3
The abbreviations used are: RACE, Rapid
amplification of cDNA ends; MER, medium reiteration frequency
repeat; PLE, placental leptin enhancer; bp, base pair(s); kb,
kilobase(s).
Volume 272, Number 48,
Issue of November 28, 1997
pp. 30583-30588
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  N. E. Schlabritz-Loutsevitch, J. C. Lopez-Alvarenga, A. G. Comuzzie, M. M. Miller, S. P. Ford, C. Li, G. B. Hubbard, R. J. Ferry Jr, and P. W. Nathanielsz The Prolonged Effect of Repeated Maternal Glucocorticoid Exposure on the Maternal and Fetal Leptin/Insulin-like Growth Factor Axis in Papio species Reproductive Sciences, March 1, 2009; 16(3): 308 - 319. [Abstract] [PDF]
|
|
|
|
 |
|
 J. L. Maymo, A. Perez Perez, V. Sanchez-Margalet, J. L. Duenas, J. C. Calvo, and C. L. Varone Up-Regulation of Placental Leptin by Human Chorionic Gonadotropin Endocrinology, January 1, 2009; 150(1): 304 - 313. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. C M Brinkman-Van der Linden, N. Hurtado-Ziola, T. Hayakawa, L. Wiggleton, K. Benirschke, A. Varki, and N. Varki Human-specific expression of Siglec-6 in the placenta Glycobiology, September 1, 2007; 17(9): 922 - 931. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. C. Henson and V. D. Castracane Leptin in Pregnancy: An Update Biol Reprod, February 1, 2006; 74(2): 218 - 229. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Lappas, K. Yee, M. Permezel, and G. E Rice Release and regulation of leptin, resistin and adiponectin from human placenta, fetal membranes, and maternal adipose tissue and skeletal muscle from normal and gestational diabetes mellitus-complicated pregnancies J. Endocrinol., September 1, 2005; 186(3): 457 - 465. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Prudhomme, G. Oriol, and F. Mallet A Retroviral Promoter and a Cellular Enhancer Define a Bipartite Element Which Controls env ERVWE1 Placental Expression J. Virol., November 15, 2004; 78(22): 12157 - 12168. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Zhao, T. H. Kunz, N. Tumba, L. Clamon Schulz, C. Li, M. Reeves, and E. P. Widmaier Comparative analysis of expression and secretion of placental leptin in mammals Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2003; 285(2): R438 - R446. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-R. Landry and D. L. Mager Functional Analysis of the Endogenous Retroviral Promoter of the Human Endothelin B Receptor Gene J. Virol., July 1, 2003; 77(13): 7459 - 7466. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Bieche, A. Laurent, I. Laurendeau, L. Duret, Y. Giovangrandi, J.-L. Frendo, M. Olivi, J.-L. Fausser, D. Evain-Brion, and M. Vidaud Placenta-Specific INSL4 Expression Is Mediated by a Human Endogenous Retrovirus Element Biol Reprod, April 1, 2003; 68(4): 1422 - 1429. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Jansson, S. L. Greenwood, B. R. Johansson, T. L. Powell, and T. Jansson Leptin Stimulates the Activity of the System A Amino Acid Transporter in Human Placental Villous Fragments J. Clin. Endocrinol. Metab., March 1, 2003; 88(3): 1205 - 1211. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.-R. Landry, A. Rouhi, P. Medstrand, and D. L. Mager The Opitz Syndrome Gene Mid1 Is Transcribed from a Human Endogenous Retroviral Promoter Mol. Biol. Evol., November 1, 2002; 19(11): 1934 - 1942. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Ambrosini, A. K. Nath, M. R. Sierra-Honigmann, and J. Flores-Riveros Transcriptional Activation of the Human Leptin Gene in Response to Hypoxia. INVOLVEMENT OF HYPOXIA-INDUCIBLE FACTOR 1 J. Biol. Chem., September 6, 2002; 277(37): 34601 - 34609. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Gambling, Z. Charania, L. Hannah, C. Antipatis, R. G. Lea, and H. J. McArdle Effect of Iron Deficiency on Placental Cytokine Expression and Fetal Growth in the Pregnant Rat Biol Reprod, February 1, 2002; 66(2): 516 - 523. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Coya, O. Gualillo, J. Pineda, M. del Carmen Garcia, M. d. l. A. Busturia, A. Aniel-Quiroga, P. Martul, and R. Maria Senaris Effect of Cyclic 3',5'-Adenosine Monophosphate, Glucocorticoids, and Insulin on Leptin Messenger RNA Levels and Leptin Secretion in Cultured Human Trophoblast Biol Reprod, September 1, 2001; 65(3): 814 - 819. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Yamashita, J. Shao, T. Ishizuka, P. J. Klepcyk, P. Muhlenkamp, L. Qiao, N. Hoggard, and J. E. Friedman Leptin Administration Prevents Spontaneous Gestational Diabetes in Heterozygous Leprdb/+ Mice: Effects on Placental Leptin and Fetal Growth Endocrinology, July 1, 2001; 142(7): 2888 - 2897. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. S. O'Neil, A. E. Green, D. E. Edwards, K. F. Swan, T. Gimpel, V. D. Castracane, and M. C. Henson Regulation of Leptin and Leptin Receptor in Baboon Pregnancy: Effects of Advancing Gestation and Fetectomy J. Clin. Endocrinol. Metab., June 1, 2001; 86(6): 2518 - 2524. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. C. Henson and V. D. Castracane Leptin in Pregnancy Biol Reprod, November 1, 2000; 63(5): 1219 - 1228. [Abstract] [Full Text]
|
|
|
|
 |
|
 R.G. Lea, D. Howe, L.T. Hannah, O. Bonneau, L. Hunter, and N. Hoggard Placental leptin in normal, diabetic and fetal growth-retarded pregnancies Mol. Hum. Reprod., August 1, 2000; 6(8): 763 - 769. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Guibourdenche, A. Tarrade, I. Laurendeau, C. Rochette-Egly, P. Chambon, M. Vidaud, and D. Evain-Brion Retinoids Stimulate Leptin Synthesis and Secretion in Human Syncytiotrophoblast J. Clin. Endocrinol. Metab., July 1, 2000; 85(7): 2550 - 2555. [Abstract] [Full Text]
|
|
|
|
|
|
N. Kronfeld-Schor, J. Zhao, B. A. Silvia, E. Bicer, P. T. Mathews, R. Urban, S. Zimmerman, T. H. Kunz, and E. P. Widmaier Steroid-Dependent Up-Regulation of Adipose Leptin Secretion In Vitro During Pregnancy in Mice Biol Reprod, July 1, 2000; 63(1): 274 - 280. [Abstract] [Full Text]
|
|
|
|
|
|
K. Yamada, H. Ogawa, S.-i. Honda, N. Harada, and T. Okazaki A GCM Motif Protein Is Involved in Placenta-specific Expression of Human Aromatase Gene J. Biol. Chem., November 5, 1999; 274(45): 32279 - 32286. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Chardonnens, P. Cameo, M.L. Aubert, F.P. Pralong, D. Islami, A. Campana, R.C. Gaillard, and P. Bischof Modulation of human cytotrophoblastic leptin secretion by interleukin-1{alpha} and 17{beta}-oestradiol and its effect on HCG secretion Mol. Hum. Reprod., November 1, 1999; 5(11): 1077 - 1082. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Kamat, J. L. Alcorn, C. Kunczt, and C. R. Mendelson Characterization of the Regulatory Regions of the Human Aromatase (P450arom) Gene Involved in Placenta-Specific Expression Mol. Endocrinol., November 1, 1998; 12(11): 1764 - 1777. [Abstract] [Full Text]
|
|
|
|
|
|
S. Yura, N. Sagawa, Y. Ogawa, H. Masuzaki, H. Mise, T. Matsumoto, K. Ebihara, S. Fujii, and K. Nakao Augmentation of Leptin Synthesis and Secretion Through Activation of Protein Kinases A and C in Cultured Human Trophoblastic Cells J. Clin. Endocrinol. Metab., October 1, 1998; 83(10): 3609 - 3614. [Abstract] [Full Text]
|
|
|
|
|
|
M. M. Mason, Y. He, H. Chen, M. J. Quon, and M. Reitman Regulation of Leptin Promoter Function by Sp1, C/EBP, and a Novel Factor Endocrinology, March 1, 1998; 139(3): 1013 - 1022. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Pantel, K. Machinis, M.-L. Sobrier, P. Duquesnoy, M. Goossens, and S. Amselem Species-specific Alternative Splice Mimicry at the Growth Hormone Receptor Locus Revealed by the Lineage of Retroelements during Primate Evolution. A NOVEL MECHANISM ACCOUNTING FOR PROTEIN DIVERSITY BETWEEN AND WITHIN SPECIES J. Biol. Chem., June 16, 2000; 275(25): 18664 - 18669. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Medstrand, J.-R. Landry, and D. L. Mager Long Terminal Repeats Are Used as Alternative Promoters for the Endothelin B Receptor and Apolipoprotein C-I Genes in Humans J. Biol. Chem., January 12, 2001; 276(3): 1896 - 1903. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |