JBC Origene Your Gene Company

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bi, S.
Right arrow Articles by Reitman, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bi, S.
Right arrow Articles by Reitman, M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 48, Issue of November 28, 1997 pp. 30583-30588

Identification of a Placental Enhancer for the Human Leptin Gene*

(Received for publication, April 25, 1997, and in revised form, July 30, 1997)

Sheng Bi , Oksana Gavrilova , Da-Wei Gong , Mark M. Mason and Marc Reitman Dagger

From the Diabetes Branch, NIDDK, National Institutes of Health, Bethesda, Maryland 20892-1770

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES


ABSTRACT

Leptin is a hormone that regulates metabolic efficiency, energy expenditure, and food intake. Leptin is produced chiefly in adipose cells, but in humans, mRNA encoding leptin is also present in the placenta. Here we elucidate the basis for placental leptin production. The same promoter is used for adipose and placental transcription. An upstream enhancer functions in the JEG-3 and JAR choriocarcinoma cell lines but not in adipocytes or HeLa cells. The minimal positive acting region is 60 base pairs in length. This region is within a MER11 repetitive element, suggesting that human placental expression of leptin is the result of insertion of this element. Binding analyses demonstrated three protein binding sites, designated placental leptin enhancer elements (PLE)1, PLE2, and PLE3. PLE2 binds Sp1. Enhancer activity was reduced by mutation of the PLE1 or PLE3 sites but was unaffected by alteration of PLE2. Proteins binding to PLE3 were present in JEG-3 and human placental nuclear extracts but not in extracts from non-placental sources. Upon triplication, the PLE3 element was a strong enhancer in choriocarcinoma cells but not in HeLa cells. The protein binding to the PLE3 motif appears to be a novel, placenta-specific transcription factor.


INTRODUCTION

Leptin is a hormone produced in adipose cells that is important in the regulation of energy expenditure, food intake, and adiposity (1, 2). One function of leptin is that of a signal from adipose tissue to the rest of the body reporting the degree of adiposity, and circulating leptin levels correlate best with the amount of body fat (3, 4). Mice lacking a functional leptin (formerly ob or obese) gene become massively obese and develop diabetes mellitus (5). Leptin treatment of ob/ob (lepob/lepob) mice reverses all these abnormalities, and in normal mice causes decreased food intake, increased energy expenditure, and weight loss (6-8). Although much studied for its role in regulation of increased adiposity, leptin is probably of even greater importance in the metabolic adaptation to food scarcity (9).

The infertility of ob/ob mice suggested that the missing factor is needed for proper reproductive function (10). Recently, leptin was shown to induce completion of reproductive organ development and allow fertility in both female (11)1 and male ob/ob mice (12). Leptin treatment also causes precocious sexual maturity in wild-type mice (13, 14).

A number of laboratories have studied the regulation of the leptin gene in adipose cells. Adipose leptin mRNA levels are increased by glucocorticoids (15-17) and by insulin (18-20) and decreased by beta -adrenergic agonists (17, 21). Three motifs in the leptin promoter, in addition to the TATA box, contribute to leptin transcription: a C/EBP site at -55 (22-26), a site at -87,2 and an Sp1 motif at -97.2 The observation that leptin RNA is also made by the human placenta (27) motivated us to examine regulation of leptin transcription in this tissue.


EXPERIMENTAL PROCEDURES

Northern Blot and 5'-Rapid Amplification of cDNA Ends

Northern blots were hybridized (Rapid-hyb, Amersham Corp.) using probes (leptin, bp 463-3426 in GenBankTM/EBI accession number U43653, or beta -actin; labeled by random priming) and washed twice (0.5 × SSC, 20 min, 65 °C). 5'-RACE3 was performed using a commercial kit and human placental cDNA (CLONTECH). After amplification, the products were cloned and sequenced.

Cell Lines

JEG-3 (ATCC HTB-36) and HeLa cells (ATCC CCL-2) were cultured in Dulbecco's modified Eagle's medium with 10% fetal bovine serum, 2 mM glutamine, penicillin (100 units/ml), and streptomycin (100 µg/ml) (Life Technologies, Inc.). JAR cells (ATCC HTB-144) were grown in Waymouth's MB 752/1 medium (ICN) supplemented as above.

Transient Expression

The luciferase reporter constructs are based on pGL3-basic or pGL3-promoter (Promega) and are shown schematically in Figs. 2, 3, 4, 7, and 8. p1774 and p1779 were previously named pGL3/3kb(+) and pGL3/0.3kb(+), respectively (28). Cloning details are available from the authors. Transient expression using electroporation in primary rat adipocytes was performed as described (29). For JEG-3, JAR, and HeLa cells, typically 100 ng of luciferase reporter, 5 ng of pRL-CMV internal control construct (Promega), and carrier plasmid DNA to 1 µg were transfected using 5 µl of LipofectAMINE (Life Technologies, Inc.). The medium was replaced after 5 h, and the cells were harvested 24 h later using 250 µl of passive lysis buffer (Promega). Luciferase activity was measured (Dual-Luciferase Reporter Assay System, Promega) and normalized to the internal control. Transfections were performed in duplicate. Data are the mean ± S.E., usually from three to five experiments.


Fig. 2. Activity of the human leptin promoter. Luciferase reporter plasmids containing 218 to 2922 bp of promoter and 5'-flanking region were transfected into the indicated cell lines, and expression was measured. The length of the 5'-flanking region is shown on the left, and luciferase activity (normalized to -218 construct in that cell line) is graphed at right. Luciferase activity of the promoterless pGL3-basic reporter was 0.04 ± 0.02, 0.10 ± 0.05, 0.10 ± 0.03, and 0.02 ± 0.01 in JEG-3, JAR, HeLa, and adipocytes, respectively. ND, not done.

[View Larger Version of this Image (27K GIF file)]



Fig. 3. An enhancer upstream of human leptin gene. The fragment from -1951 to -1546 was inserted into various luciferase (luc) reporters, as shown on the left (not to scale). Luciferase activity upon transient expression in JEG-3 cells, normalized to pGL3-promoter is shown at right.

[View Larger Version of this Image (25K GIF file)]



Fig. 4. Luciferase expression of enhancer deletions. Deletions of the 400-bp enhancer region, shown on the left, were tested for enhancer activity by transient expression in JEG-3 cells. Luciferase activity was normalized to pGL3-promoter.

[View Larger Version of this Image (21K GIF file)]



Fig. 7. Transient expression of enhancer mutants in JEG-3 cells. Reporter plasmids carrying the fragments and mutants of the enhancer diagrammed on the left were tested. Luciferase activity relative to pGL3-promoter is shown on the right.

[View Larger Version of this Image (24K GIF file)]



Fig. 8. Cell specificity of the leptin enhancer. Reporter plasmids (diagrammed on the left) were transfected into the indicated cell lines. Luciferase activity, normalized to pGL3-promoter in the same cell line, is shown to the right. ND, not done.

[View Larger Version of this Image (21K GIF file)]


Electrophoretic Mobility Shift and Methylation Interference Analyses

Binding reactions containing 3-5 µg of nuclear extract protein (30), 20-40 fmol of kinase-labeled probe, 10 mM Tris-HCl, pH 7.5, 50 mM NaCl, 0.05% Nonidet P-40, 1 mM EDTA, 0.5 mM DTT, 10% glycerol, and 1 µg of poly(dI:dC) were incubated (15 min, 23 °C) and electrophoresed. Competitor oligonucleotides were added prior to the addition of nuclear extract. Polyclonal antiserum to Sp1 (2 µg, Santa Cruz Biotechnology) was added after the probe and incubated for 60 min at 4 °C before electrophoresis. Methylation interference analysis was performed essentially as described (31).

The following double-stranded oligonucleotides were used in gel mobility shift assays (a lowercase letter indicates an introduced mutation): PLE1, CAGTACCCTCAGGCTTACTAGGGTGGTGAAAAACTC; mPLE1, CAGTACtagtAGGCTTACTAGGGTGGTGAAAAACTC; PLE2, AGGGTGGTGAAAAACTCCGCCCTGGTAAATTTGTGG; mPLE2, AGGGTGGTGAAAAACTCtagtCTGGTAAATTTGTGG; PLE3, CCTGGTAAATTTGTGGTCAGACCAGTTTTCTGCTCT; mPLE3, CCTGGTAAATTTGTGagtAGcttAGTTTTCTGCTCT; oligo D, TGCTCTCGAACACTGTTTTCTGTTGTTTAAGATGTT; and Sp1, GAATCCTAACTGGGCGGAGTTATGCTGGTG.


RESULTS

Leptin Expression in Human Placenta

Leptin expression in adipose tissue (both white and brown) has been reported in a number of species. The only other tissue identified as having significant amounts of leptin mRNA is human placenta (27). However, we did not detect leptin mRNA in mouse placenta,1 so a Northern blot was performed to confirm that human placenta contains leptin mRNA (Fig. 1). Leptin RNA was detected in human placenta at a level roughly 100-fold lower than that in white adipose tissue. It was the same size as in adipose tissue, ~4 kb. Additional confirmation that leptin is expressed in placenta came from the expressed sequence tag data base, which contains leptin cDNAs in libraries from both 8-9 week and term placentas.


Fig. 1. Human leptin RNA levels. Northern blots of poly(A)+ RNA (2 µg, CLONTECH) from the indicated tissues and total RNA (20 µg; Ref. 28) from adipose tissue were probed for leptin and beta -actin as indicated. The leptin-probed multitissue blot was exposed ~3 × longer than the adipose blot. Exposures of the actin-probed blots are comparable.

[View Larger Version of this Image (74K GIF file)]


Having established that human placenta contains leptin mRNA, we performed 5'-RACE to determine if placenta and adipose tissue use the same promoter. All six clones extending upstream of exon 2 agreed with the reported sequence for exon 1 from adipose tissue (data not shown). Thus, the same promoter is used for placental and adipose expression.

Leptin Promoter and Enhancer Activity in Human Placental Cell Lines

To search for DNA elements important for placental expression, reporter constructs containing from 218 to 2922 bp of 5'-flanking genomic DNA were used in transient expression assays. Expression of these leptin promoter-luciferase reporters was studied in four cell types: primary rat adipocytes, HeLa cells, and the choriocarcinoma cell lines JEG-3 (32) and JAR (33). In each case, all constructs directed transcription at higher levels than the promoterless pGL3-basic vector (Fig. 2). Intriguingly, when the 5'-flanking region was lengthened from -1546 to -1951, expression increased significantly in the choriocarcinoma cell lines but not in adipose and HeLa cells (Fig. 2). These data suggest that the 400-bp region from 1951 to 1546 bp upstream of the promoter contains a placenta-selective enhancer.

Next, the 400-bp region was tested directly for enhancer activity using the heterologous SV40 promoter to drive luciferase. In JEG-3 cells, this DNA caused 8-9-fold enhancement, independent of its orientation, at a distance of 2.1 kb from the promoter (Fig. 3). The 400-bp region could not increase expression in the absence of a promoter and did not have promoter activity itself. These data demonstrate that the DNA from 1951 to 1546 bp upstream of the leptin promoter contains an enhancer.

Identification of the Enhancer Elements

To identify the boundaries of the enhancer, deletion constructs were tested for enhancer activity (Fig. 4). Deletions from the 3'-end to -1645, -1748, or -1847 reduced, but did not abolish, luciferase expression. In contrast, any deletion of the 5'-end resulted in complete loss of enhancer activity. Thus, the 100-bp region from 1946- to 1847-bp upstream of the promoter is sufficient for partial leptin enhancer activity in JEG-3 cells.

Electrophoretic mobility shift assays were used to identify the sequence elements and proteins responsible for the enhancer activity. Four overlapping oligonucleotides (designated PLE1, PLE2, PLE3, and oligo D) were used to screen the 100-bp region. With nuclear extracts from JEG-3 cell and human placenta, protein binding was detected to PLE1, PLE2, and PLE3 but not to oligo D (Fig. 5A). Nuclear extracts from HeLa cells showed abundant binding to PLE2, slight binding to PLE1, and none to PLE3. These data are consistent with the hypothesis that the proteins binding to PLE3, and possibly PLE1, are placenta-specific. Additional support comes from the observation that no PLE3 binding activity was detected by mobility shift assays using nuclear extracts from rat liver, undifferentiated 3T3-L1 preadipocytes, differentiated 3T3-L1 adipocytes, rat adipocytes, or erythroid K562 cells (data not shown).


Fig. 5. Electrophoretic mobility shift analysis of the leptin enhancer. A, nuclear extracts prepared from JEG-3 and HeLa cells and from human placenta were used with the indicated oligonucleotide probes (shown schematically at the bottom, with sequences under "Experimental Procedures"). The positions of PLE1, PLE2, PLE3, and Sp1 protein-DNA complexes and free probe are indicated. B, antibody supershift analysis of PLE2. The complex formed by JEG-3 extract with the PLE2 oligonucleotide was incubated with either preimmune or anti-Sp1 antiserum, as indicated, and then electrophoresed. The positions of the Sp1·DNA (Sp1) and antibody·Sp1·DNA (ab-Sp1) complexes are indicated.

[View Larger Version of this Image (65K GIF file)]


Since the PLE2 oligonucleotide contains a canonical Sp1 sequence (CCGCCC; Ref. 34), we tested whether Sp1 is responsible for the observed protein binding to PLE2. An oligonucleotide with an authentic Sp1 site gave the same pattern as PLE2 upon protein binding (Fig. 5A). Mutation of the Sp1 motif in PLE2 (mPLE2) abolished protein binding to PLE2 (Fig. 5A). Finally, antibodies to Sp1 caused a decreased mobility of the protein-PLE2 complex (Fig. 5B). Thus, Sp1 is able to bind the PLE2 sequence and appears to account for most of the binding activity to PLE2 in JEG-3 cells.

To identify specific residues in the PLE1 and PLE3 binding sites, methylation interference analysis was performed. Methylation of guanines at positions -1946, -1943, -1942, -1941, -1939, -1937, -1936, and -1935 in PLE1 and at -1894, -1892, -1888, and -1887 in PLE3 reduced binding to these elements (Fig. 6A). This information was used to design mutations of the PLE1 and PLE3 binding sites (Fig. 6B), which were incorporated into oligonucleotides (mPLE1 and mPLE3, sequences shown under "Experimental Procedures"). As expected, these mutant oligonucleotides were unable to form the PLE1 and PLE3 complexes (not shown) and were unable to compete for protein binding to the unmutated sites (Fig. 6C). Binding to PLE1 was not competed by PLE2, PLE3, or Sp1. Binding to PLE3 was not competed by PLE1, PLE2, or the following binding sites for transcription factors known to regulate placental genes: Sp1 (35), AP1 and CREB (36-39), thyroid response element (40), Pit-1 (41, 42), C/EBP (43, 44), DF3 and DF4 (45), FREAC (46), or GATA (39, 47) (Fig. 6C, and data not shown). Taken together, these results demonstrate that the leptin enhancer contains three independent protein-binding sites: an Sp1 site (PLE2) and two novel placenta-selective binding sites, PLE1 and PLE3.


Fig. 6. Protein binding to the PLE1 and PLE3 motifs. A, methylated oligonucleotides were incubated with JEG-3 nuclear proteins and separated by electrophoresis. The free (F) and bound (B) bands were eluted, cleaved with piperidine, and electrophoresed under denaturing conditions. The oligonucleotides (PLE1, PLE3) and labeled strand (Sense, Antisense) are indicated. B, sequence of the 60-bp enhancer with the PLE motifs indicated. Methylation at positions interfering strongly with protein binding are marked by bullet  and interfering weakly by open circle . Also indicated are the nucleotide changes introduced in making the mutated elements. C, electrophoretic mobility shift assays using JEG-3 extracts and oligonucleotides PLE1 and PLE3 as probes. Competitor oligonucleotides were added in a 10- or 100-fold molar excess, as indicated.

[View Larger Version of this Image (50K GIF file)]


Contribution of Individual Elements to Leptin Enhancer Activity

Since no protein binding to the 3' 40 bp of the 100-bp enhancer was detected, a 60-bp enhancer comprising the 5'-end was tested for enhancer activity. A reporter using the 60-bp enhancer (p1875) expressed luciferase at a slightly higher level than the 100-bp construct (p1860) (Fig. 7). It is possible that the 3' end of the 100-bp region has some inhibitory activity.

The contributions of the PLE1, PLE2, and PLE3 sites to the function of the placental leptin enhancer was examined in the context of the 60-bp enhancer. Mutation of the Sp1 site at PLE2 had no effect on activity (Fig. 7). However, mutation of PLE1 reduced enhancement by 56%, and mutation of PLE3 abolished enhancer activity. Similarly, constructs containing only PLE1 (p1870) or PLE3 (p1871, p1877) did not have enhancer activity. Triplication of the PLE3 motif created a construct which showed 32-fold enhancement. Thus, as measured in JEG-3 cells, the PLE3 motif is essential for enhancer activity and when multimerized is a strong enhancer.

To examine the tissue specificity of the leptin enhancer, the reporter plasmids were tested for activity in four different cell types (Fig. 8). Transient transfection expression experiments confirmed that the enhancer works in the choriocarcinoma cell lines (JEG-3, JAR) but not in adipocytes or HeLa cells. The triplicated PLE3 element stimulated transcription in JEG-3 and JAR, but not in HeLa cells. These results suggest that the enhancer and the transcription factor binding to the PLE3 site are placenta-selective.


DISCUSSION

Leptin is expressed predominantly in adipocytes where its production correlates with the degree of adiposity. However, leptin is also made by the placenta (27). We identified an enhancer located 1.9 kb upstream of the human leptin gene. It contains three protein binding elements, PLE1-3, and transient expression experiments demonstrate that the enhancer works in choriocarcinoma lines but not in adipose or HeLa cells. The proteins binding to the PLE3 motif and possibly to the PLE1 motif may be placenta-specific and contribute to the activity of the enhancer in JEG-3 cells. Sp1 binds at the PLE2 motif but does not contribute to enhancer activity in these cells. We concentrated on PLE3 which, when triplicated, constitutes a strong enhancer. Placental enhancers have been identified for the chorionic somatomammotropin-B (45) and glycoprotein hormone alpha -subunit (48) genes. However, the PLE3 motif does not match the sequence elements (CRE (36), GATA (39), Pit-1 (41, 42), DF3 and DF4 (45), among others) implicated in transcription of these and other placental genes, suggesting that the protein binding to the PLE3 motif is a novel, placenta-specific transcription factor. Verification will require cloning of the transcription factor and analysis of its expression pattern.

The enhancer is located within a MER11 (medium reiteration frequency repeat) element (28). MER11 elements (which can be at least 1100 bp in length) are found 1500-3000 times in the human genome, but are not present in the murine genome (49). This observation provides an explanation of why the human, but not the murine, placenta expresses leptin mRNA. The MER11 insertion introduced DNA elements in a configuration that allowed interaction with the leptin promoter. (This hypothesis can be tested using phylogenetic analysis, scoring placental leptin expression, and the presence of the upstream MER11. Since the MER11 upstream of the leptin gene is only 94% identical to a consensus MER11, it is likely that the insertion event occurred at least several million years ago.) The high degree of sequence similarity between the leptin enhancer and other MER11s suggests that the other MER11s have the potential to be placental enhancers but require an accessible, compatible promoter for realization of this function. For example, 1.2 kb upstream of the human P450C17 gene (50) is a MER11 that matches the leptin PLE1-3 motifs exactly, yet the P450C17 gene is not expressed in the placenta (51). Insertion of repetitive elements in germline DNA is one of the major forces in evolution. Presumably, most insertions do not affect gene expression although sometimes insertion will disrupt a gene (52). Least commonly, introduction of a repetitive element results in a gain of function (53) as apparently is the case with the human leptin enhancer. Thus, human placental production of leptin appears to be an example of evolution in action; ectopic expression of a gene is acquired coincidentally and then is available for integration into the physiology of the tissue.

The biology of leptin during gestation is not well understood. In humans, the serum leptin concentration is increased 1.7-fold at the end of pregnancy (corrected for fat mass; Ref. 54). Placental production is a likely explanation for this increase although increased synthesis by maternal adipose tissue is also possible. One might have expected that a low leptin would be found during gestation since the metabolic effects of high leptin levels are not observed (decreased food intake) or would be undesirable (decreased metabolic efficiency) when the mother is putting great effort into nutrition of the fetus and into preparation for lactation. There is no information on either the bioactivity/bioavailability of leptin, or on the responsiveness of the body to leptin during pregnancy. If pregnancy is indeed a state of leptin resistance, then the observed increase in leptin could be a compensatory response. Alternatively, the increase in leptin levels might be selectively important for the reproductive system, rather than for general energy metabolism.

Some information about the role of leptin in pregnancy comes from studies using the ob/ob mouse. Leptin is needed for reproductive system maturation and fertility (11, 14) although this requirement can be bypassed and pregnancy induced (inefficiently) by gonadotropin treatment (10). Ongoing leptin treatment is not necessary to maintain pregnancy, but leptin appears to be needed for parturition and nursing (11).1 However, comparison between humans and mice is not straightforward. In humans, the serum leptin concentration is increased 1.7-fold (54) compared with 20-fold in mice.1 In mice there is also an increase in expression of a high-affinity binding protein, which has not been observed in humans.1 While the increase in leptin during pregnancy in humans may be a random evolutionary event without functional significance, another possibility is that, in humans, placental leptin has a paracrine function, for example preparing the uterus for parturition. This hypothesis has the advantage of unifying the need for leptin during parturition in the mouse, with the apparent attenuation of its systemic metabolic effects.

In summary, we have identified an enhancer of the human leptin gene and a placenta-selective element within the enhancer. This enhancer mediates placental expression of leptin, which could explain the increased leptin levels during human pregnancy. The biologic functions of leptin in gestation are not known, but a role in the control of pregnancy, parturition, or establishment of the lactating state seems likely and merits further investigation.


FOOTNOTES

*   The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Dagger    Scholar of the Lucille P. Markey Charitable Trust and to whom correspondence should be addressed: Diabetes Branch, Bldg. 10, Rm. 8N-250, 10 Center Dr., MSC 1770, Bethesda, MD 20892-1770. Tel.: 301-496-6090; Fax: 301-402-0573; E-mail: mlr{at}helix.nih.gov.
1   Gavrilova, O., Barr, V., Marcus-Samuels, B., and Reitman, M. (1997) J. Biol. Chem. 272, in press.
2   M. M. Mason, Y. He, H. Chen, M. J. Quon, and M. Reitman, unpublished observations.
3   The abbreviations used are: RACE, Rapid amplification of cDNA ends; MER, medium reiteration frequency repeat; PLE, placental leptin enhancer; bp, base pair(s); kb, kilobase(s).

ACKNOWLEDGEMENTS

We thank G. Poy for excellent sequencing support, Dr. J. Chou for discussions and for human placenta, and Drs. Y. He, S. Taylor, and C. Trainor for comments on the manuscript.


REFERENCES

  1. Zhang, Y., Proenca, R., Maffei, M., Barone, M., Leopold, L., and Friedman, J. M. (1994) Nature 372, 425-432 [CrossRef][Medline] [Order article via Infotrieve]
  2. Friedman, J. M. (1997) Nature 385, 119-120 [CrossRef][Medline] [Order article via Infotrieve]
  3. Maffei, M., Halaas, J., Ravussin, E., Pratley, R. E., Lee, G. H., Zhang, Y., Fei, H., Kim, S., Lallone, R., Ranganathan, S., et al. (1995) Nat. Med. 1, 1155-1161 [CrossRef][Medline] [Order article via Infotrieve]
  4. Considine, R. V., Sinha, M. K., Heiman, M. L., Kriauciunas, A., Stephens, T. W., Nyce, M. R., Ohannesian, J. P., Marco, C. C., McKee, L. J., Bauer, T. L., and Caro, J. F. (1996) N. Engl. J. Med. 334, 292-295 [Abstract/Free Full Text]
  5. Coleman, D. L. (1978) Diabetologia 14, 141-148 [CrossRef][Medline] [Order article via Infotrieve]
  6. Pelleymounter, M. A., Cullen, M. J., Baker, M. B., Hecht, R., Winters, D., Boone, T., and Collins, F. (1995) Science 269, 540-543 [Abstract/Free Full Text]
  7. Campfield, L. A., Smith, F. J., Guisez, Y., Devos, R., and Burn, P. (1995) Science 269, 546-549 [Abstract/Free Full Text]
  8. Halaas, J. L., Gajiwala, K. S., Maffei, M., Cohen, S. L., Chait, B. T., Rabinowitz, D., Lallone, R. L., Burley, S. K., and Friedman, J. M. (1995) Science 269, 543-546 [Abstract/Free Full Text]
  9. Ahima, R. S., Prabakaran, D., Mantzoros, C., Qu, D., Lowell, B., Maratos-Flier, E., and Flier, J. S. (1996) Nature 382, 250-252 [CrossRef][Medline] [Order article via Infotrieve]
  10. Smithberg, M., and Runner, M. N. (1957) J. Hered. 48, 97-100 [Free Full Text]
  11. Chehab, F. F., Lim, M. E., and Lu, R. (1996) Nat. Genet. 12, 318-320 [CrossRef][Medline] [Order article via Infotrieve]
  12. Mounzih, K., Lu, R., and Chehab, F. F. (1997) Endocrinology 138, 1190-1193 [Abstract/Free Full Text]
  13. Chehab, F. F., Mounzih, K., Lu, R., and Lim, M. E. (1997) Science 275, 88-90 [Abstract/Free Full Text]
  14. Ahima, R. S., Dushay, J., Flier, S. N., Prabakaran, D., and Flier, J. S. (1997) J. Clin. Invest. 99, 391-395 [Medline] [Order article via Infotrieve]
  15. De Vos, P., Saladin, R., Auwerx, J., and Staels, B. (1995) J. Biol. Chem. 270, 15958-15961 [Abstract/Free Full Text]
  16. Murakami, T., Iida, M., and Shima, K. (1995) Biochem. Biophys. Res. Commun. 214, 1260-1267 [CrossRef][Medline] [Order article via Infotrieve]
  17. Slieker, L. J., Sloop, K. W., Surface, P. L., Kriauciunas, A., LaQuier, F., Manetta, J., Bue-Valleskey, J., and Stephens, T. W. (1996) J. Biol. Chem. 271, 5301-5304 [Abstract/Free Full Text]
  18. Saladin, R., De Vos, P., Guerre-Millo, M., Leturque, A., Girard, J., Staels, B., and Auwerx, J. (1995) Nature 377, 527-529 [CrossRef][Medline] [Order article via Infotrieve]
  19. MacDougald, O. A., Hwang, C. S., Fan, H., and Lane, M. D. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 9034-9037 [Abstract/Free Full Text]
  20. Leroy, P., Dessolin, S., Villageois, P., Moon, B. C., Friedman, J. M., Ailhaud, G., and Dani, C. (1996) J. Biol. Chem. 271, 2365-2368 [Abstract/Free Full Text]
  21. Trayhurn, P., Duncan, J. S., Rayner, D. V., and Hardie, L. J. (1996) Biochem. Biophys. Res. Commun. 228, 605-610 [CrossRef][Medline] [Order article via Infotrieve]
  22. He, Y., Chen, H., Quon, M. J., and Reitman, M. (1995) J. Biol. Chem. 270, 28887-28891 [Abstract/Free Full Text]
  23. Hwang, C. S., Mandrup, S., MacDougald, O. A., Geiman, D. E., and Lane, M. D. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 873-877 [Abstract/Free Full Text]
  24. Miller, S. G., De Vos, P., Guerre-Millo, M., Wong, K., Hermann, T., Staels, B., Briggs, M. R., and Auwerx, J. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 5507-5511 [Abstract/Free Full Text]
  25. de la Brousse, F. C., Shan, B., and Chen, J. L. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 4096-4101 [Abstract/Free Full Text]
  26. Hollenberg, A. N., Susulic, V. S., Madura, J. P., Zhang, B., Moller, D. E., Tontonoz, P., Sarraf, P., Spiegelman, B. M., and Lowell, B. B. (1997) J. Biol. Chem. 272, 5283-5290 [Abstract/Free Full Text]
  27. Green, E. D., Maffei, M., Braden, V. V., Proenca, R., DeSilva, U., Zhang, Y., Chua, S. C., Leibel, R. L., Weissenbach, J., and Friedman, J. M. (1995) Genome Res. 5, 5-12 [Abstract/Free Full Text]
  28. Gong, D. W., Bi, S., Pratley, R. E., and Weintraub, B. D. (1996) J. Biol. Chem. 271, 3971-3974 [Abstract/Free Full Text]
  29. Quon, M. J., Zarnowski, M. J., Guerre-Millo, M., de la Luz Sierra, M., Taylor, S. I., and Cushman, S. W. (1993) Biochem. Biophys. Res. Commun. 194, 338-346 [CrossRef][Medline] [Order article via Infotrieve]
  30. Wada, N., and Chou, J. Y. (1993) J. Biol. Chem. 268, 14003-14010 [Abstract/Free Full Text]
  31. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. (1997) Current Protocols in Molecular Biology, Wiley, New York
  32. Kohler, P. O., and Bridson, W. E. (1971) J. Clin. Endocrinol. Metab. 32, 683-687 [Medline] [Order article via Infotrieve]
  33. Pattillo, R. A., Ruckert, A., Hussa, R., Berstein, R., and Delfs, E. (1971) In Vitro 6, 398-399
  34. Kadonaga, J. T., Jones, K. A., and Tjian, R. (1986) Trends Biochem. Sci. 11, 20-23
  35. Sadasivan, E., Cedeno, M. M., and Rothenberg, S. P. (1994) J. Biol. Chem. 269, 4725-4735 [Abstract/Free Full Text]
  36. Heckert, L. L., Schultz, K., and Nilson, J. H. (1996) J. Biol. Chem. 271, 31650-31656 [Abstract/Free Full Text]
  37. Pestell, R. G., Albanese, C., Watanabe, G., Johnson, J., Eklund, N., Lastowiecki, P., and Jameson, J. L. (1995) J. Biol. Chem. 270, 18301-18308 [Abstract/Free Full Text]
  38. Scatena, C. D., and Adler, S. (1996) Endocrinology 137, 3000-3008 [Abstract]
  39. Steger, D. J., Hecht, J. H., and Mellon, P. L. (1994) Mol. Cell. Biol. 14, 5592-5602 [Abstract/Free Full Text]
  40. Stephanou, A., Shah, M., Richardson, B., and Handwerger, S. (1996) J. Mol. Endocrinol. 16, 221-227 [Abstract]
  41. Lee, B. J., Jeong, J. K., Kim, J. H., Kang, S. G., Kim, M. O., and Choi, W. S. (1996) Mol. Cell. Endocrinol. 118, 9-14 [CrossRef][Medline] [Order article via Infotrieve]
  42. Bamberger, A. M., Bamberger, C. M., Pu, L. P., Puy, L. A., Loh, Y. P., and Asa, S. L. (1995) J. Clin. Endocrinol. Metab. 80, 2021-2026 [Abstract]
  43. Chen, H., Lin, B., Chen, C. L., Johnson, P. F., and Chou, J. Y. (1995) DNA Cell Biol. 14, 681-688 [Medline] [Order article via Infotrieve]
  44. Toda, K., Yang, L. X., and Shizuta, Y. (1995) J. Steroid Biochem. Mol. Biol. 53, 181-190 [CrossRef][Medline] [Order article via Infotrieve]
  45. Jacquemin, P., Oury, C., Peers, B., Morin, A., Belayew, A., and Martial, J. A. (1994) Mol. Cell. Biol. 14, 93-103 [Abstract/Free Full Text]
  46. Hellqvist, M., Mahlapuu, M., Samuelsson, L., Enerback, S., and Carlsson, P. (1996) J. Biol. Chem. 271, 4482-4490 [Abstract/Free Full Text]
  47. Ng, Y. K., George, K. M., Engel, J. D., and Linzer, D. I. (1994) Development 120, 3257-3266 [Abstract]
  48. Jameson, J. L., Jaffe, R. C., Deutsch, P. J., Albanese, C., and Habener, J. F. (1988) J. Biol. Chem. 263, 9879-9886 [Abstract/Free Full Text]
  49. Kaplan, D. J., Jurka, J., Solus, J. F., and Duncan, C. H. (1991) Nucleic Acids Res. 19, 4731-4738 [Abstract/Free Full Text]
  50. Picado-Leonard, J., and Miller, W. L. (1987) DNA 6, 439-448 [Medline] [Order article via Infotrieve]
  51. Voutilainen, R., and Miller, W. L. (1986) J. Clin. Endocrinol. Metab. 63, 1145-1150 [Abstract]
  52. Kazazian, H. H., Jr., Wong, C., Youssoufian, H., Scott, A. F., Phillips, D. G., and Antonarakis, S. E. (1988) Nature 332, 164-166 [CrossRef][Medline] [Order article via Infotrieve]
  53. Schulte, A. M., Lai, S., Kurtz, A., Czubayko, F., Riegel, A. T., and Wellstein, A. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 14759-14764 [Abstract/Free Full Text]
  54. Butte, N. F., Hopkinson, J. M., and Nicolson, M. A. (1997) J. Clin. Endocrinol. Metab. 82, 585-589 [Abstract/Free Full Text]

Volume 272, Number 48, Issue of November 28, 1997 pp. 30583-30588
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
GlycobiologyHome page
E. C M Brinkman-Van der Linden, N. Hurtado-Ziola, T. Hayakawa, L. Wiggleton, K. Benirschke, A. Varki, and N. Varki
Human-specific expression of Siglec-6 in the placenta
Glycobiology, September 1, 2007; 17(9): 922 - 931.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
M. C. Henson and V. D. Castracane
Leptin in Pregnancy: An Update
Biol Reprod, February 1, 2006; 74(2): 218 - 229.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
M. Lappas, K. Yee, M. Permezel, and G. E Rice
Release and regulation of leptin, resistin and adiponectin from human placenta, fetal membranes, and maternal adipose tissue and skeletal muscle from normal and gestational diabetes mellitus-complicated pregnancies
J. Endocrinol., September 1, 2005; 186(3): 457 - 465.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. Prudhomme, G. Oriol, and F. Mallet
A Retroviral Promoter and a Cellular Enhancer Define a Bipartite Element Which Controls env ERVWE1 Placental Expression
J. Virol., November 15, 2004; 78(22): 12157 - 12168.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
J. Zhao, T. H. Kunz, N. Tumba, L. Clamon Schulz, C. Li, M. Reeves, and E. P. Widmaier
Comparative analysis of expression and secretion of placental leptin in mammals
Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2003; 285(2): R438 - R446.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J.-R. Landry and D. L. Mager
Functional Analysis of the Endogenous Retroviral Promoter of the Human Endothelin B Receptor Gene
J. Virol., July 1, 2003; 77(13): 7459 - 7466.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
I. Bieche, A. Laurent, I. Laurendeau, L. Duret, Y. Giovangrandi, J.-L. Frendo, M. Olivi, J.-L. Fausser, D. Evain-Brion, and M. Vidaud
Placenta-Specific INSL4 Expression Is Mediated by a Human Endogenous Retrovirus Element
Biol Reprod, April 1, 2003; 68(4): 1422 - 1429.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
N. Jansson, S. L. Greenwood, B. R. Johansson, T. L. Powell, and T. Jansson
Leptin Stimulates the Activity of the System A Amino Acid Transporter in Human Placental Villous Fragments
J. Clin. Endocrinol. Metab., March 1, 2003; 88(3): 1205 - 1211.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
J.-R. Landry, A. Rouhi, P. Medstrand, and D. L. Mager
The Opitz Syndrome Gene Mid1 Is Transcribed from a Human Endogenous Retroviral Promoter
Mol. Biol. Evol., November 1, 2002; 19(11): 1934 - 1942.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Ambrosini, A. K. Nath, M. R. Sierra-Honigmann, and J. Flores-Riveros
Transcriptional Activation of the Human Leptin Gene in Response to Hypoxia. INVOLVEMENT OF HYPOXIA-INDUCIBLE FACTOR 1
J. Biol. Chem., September 6, 2002; 277(37): 34601 - 34609.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
L. Gambling, Z. Charania, L. Hannah, C. Antipatis, R. G. Lea, and H. J. McArdle
Effect of Iron Deficiency on Placental Cytokine Expression and Fetal Growth in the Pregnant Rat
Biol Reprod, February 1, 2002; 66(2): 516 - 523.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
R. Coya, O. Gualillo, J. Pineda, M. del Carmen Garcia, M. d. l. A. Busturia, A. Aniel-Quiroga, P. Martul, and R. Maria Senaris
Effect of Cyclic 3',5'-Adenosine Monophosphate, Glucocorticoids, and Insulin on Leptin Messenger RNA Levels and Leptin Secretion in Cultured Human Trophoblast
Biol Reprod, September 1, 2001; 65(3): 814 - 819.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
H. Yamashita, J. Shao, T. Ishizuka, P. J. Klepcyk, P. Muhlenkamp, L. Qiao, N. Hoggard, and J. E. Friedman
Leptin Administration Prevents Spontaneous Gestational Diabetes in Heterozygous Leprdb/+ Mice: Effects on Placental Leptin and Fetal Growth
Endocrinology, July 1, 2001; 142(7): 2888 - 2897.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
J. S. O'Neil, A. E. Green, D. E. Edwards, K. F. Swan, T. Gimpel, V. D. Castracane, and M. C. Henson
Regulation of Leptin and Leptin Receptor in Baboon Pregnancy: Effects of Advancing Gestation and Fetectomy
J. Clin. Endocrinol. Metab., June 1, 2001; 86(6): 2518 - 2524.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
M. C. Henson and V. D. Castracane
Leptin in Pregnancy
Biol Reprod, November 1, 2000; 63(5): 1219 - 1228.
[Abstract] [Full Text]


Home page
Mol Hum ReprodHome page
R.G. Lea, D. Howe, L.T. Hannah, O. Bonneau, L. Hunter, and N. Hoggard
Placental leptin in normal, diabetic and fetal growth-retarded pregnancies
Mol. Hum. Reprod., August 1, 2000; 6(8): 763 - 769.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
J. Guibourdenche, A. Tarrade, I. Laurendeau, C. Rochette-Egly, P. Chambon, M. Vidaud, and D. Evain-Brion
Retinoids Stimulate Leptin Synthesis and Secretion in Human Syncytiotrophoblast
J. Clin. Endocrinol. Metab., July 1, 2000; 85(7): 2550 - 2555.
[Abstract] [Full Text]


Home page
Biol. Reprod.Home page
N. Kronfeld-Schor, J. Zhao, B. A. Silvia, E. Bicer, P. T. Mathews, R. Urban, S. Zimmerman, T. H. Kunz, and E. P. Widmaier
Steroid-Dependent Up-Regulation of Adipose Leptin Secretion In Vitro During Pregnancy in Mice
Biol Reprod, July 1, 2000; 63(1): 274 - 280.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
K. Yamada, H. Ogawa, S.-i. Honda, N. Harada, and T. Okazaki
A GCM Motif Protein Is Involved in Placenta-specific Expression of Human Aromatase Gene
J. Biol. Chem., November 5, 1999; 274(45): 32279 - 32286.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
D. Chardonnens, P. Cameo, M.L. Aubert, F.P. Pralong, D. Islami, A. Campana, R.C. Gaillard, and P. Bischof
Modulation of human cytotrophoblastic leptin secretion by interleukin-1{alpha} and 17{beta}-oestradiol and its effect on HCG secretion
Mol. Hum. Reprod., November 1, 1999; 5(11): 1077 - 1082.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
A. Kamat, J. L. Alcorn, C. Kunczt, and C. R. Mendelson
Characterization of the Regulatory Regions of the Human Aromatase (P450arom) Gene Involved in Placenta-Specific Expression
Mol. Endocrinol., November 1, 1998; 12(11): 1764 - 1777.
[Abstract] [Full Text]


Home page
J. Clin. Endocrinol. Metab.Home page
S. Yura, N. Sagawa, Y. Ogawa, H. Masuzaki, H. Mise, T. Matsumoto, K. Ebihara, S. Fujii, and K. Nakao
Augmentation of Leptin Synthesis and Secretion Through Activation of Protein Kinases A and C in Cultured Human Trophoblastic Cells
J. Clin. Endocrinol. Metab., October 1, 1998; 83(10): 3609 - 3614.
[Abstract] [Full Text]