Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Becq, F.
Right arrow Articles by Chimini, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Becq, F.
Right arrow Articles by Chimini, G.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 5, Issue of January 31, 1997 pp. 2695-2699
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

ABC1, an ATP Binding Cassette Transporter Required for Phagocytosis of Apoptotic Cells, Generates a Regulated Anion Flux after Expression in Xenopus laevis Oocytes*

(Received for publication, June 13, 1996, and in revised form, September 17, 1996)

Frédéric Becq Dagger , Yannick Hamon §, Adriana Bajetto §, Maurice Gola Dagger , Bernard Verrier Dagger and Giovanna Chimini §

From the Dagger  Laboratoire de Neurobiologie Cellulaire, CNRS, 31 Chemin J. Aiguier, 13402 Marseille Cedex 20, France and the § Centre d'Immunologie, INSERM-CNRS de Marseille-Luminy, Parc Scientifique de Luminy, 13288 Marseille Cedex 9, France

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
Acknowledgments
REFERENCES


ABSTRACT

The ATP binding cassette transporter ABC1 is a 220-kDa glycoprotein expressed by macrophages and required for engulfment of cells undergoing programmed cell death. Since members of this family of proteins such as P-glycoprotein and cystic fibrosis transmembrane conductance regulator share the ability to transport anions, we have investigated the transport capability of ABC1 expressed in Xenopus oocytes using iodide efflux and voltage-clamp techniques. We report here that ABC1 generates an anion flux sensitive to glibenclamide, sulfobromophthalein, and blockers of anion transporters. The anion flux generated by ABC1 is up-regulated by orthovanadate, cAMP, protein kinase A, and okadaic acid. In other ABC transporters, mutating the conserved lysine in the nucleotide binding folds was found to severely reduce or abolish hydrolysis of ATP, which in turn altered the activity of the transporter. In ABC1, replacement of the conserved lysine 1892 in the Walker A motif of the second nucleotide binding fold increased the basal ionic flux, did not alter the pharmacological inhibitory profile, but abolished the response to orthovanadate and cAMP agonists. Therefore, we conclude that ABC1 is a cAMP-dependent and sulfonylurea-sensitive anion transporter.


INTRODUCTION

ATP binding cassette (ABC)1 transporters are implicated in the vectorial movement of a wide variety of substrates across biological membranes (1, 2). Most of the mammalian ABC transporters identified so far have been associated with clinically relevant phenotypes (2). The human P-glycoprotein confers resistance to chemotherapeutic drugs on tumor cells (3). Persistent hyperinsulinemic hypoglycemia of infancy is associated with mutation of SUR, the receptor for sulfonylureas (4). Cystic fibrosis is caused by mutations in the gene encoding the cystic fibrosis transmembrane conductance regulator (CFTR), a cAMP-dependent chloride channel (5, 6).

The basic structural unit of an ABC transporter consists of a pair of nucleotide binding folds (NBF) and two transmembrane domains, each composed as a rule of six transmembrane spanners (1, 2). Their activity as transporters is dependent on their interaction with ATP at the NBFs followed by its hydrolysis (see Fig. 1A) (7-16), and in some cases evidence has been provided for a further regulation via phosphorylation of serine/threonine residues in the region linking the two symmetric halves (6, 17-19). The NBF domains contain the highly conserved phosphate binding loop (20) that forms intimate contacts with the beta - and gamma -phosphates of bound ATP (21) and an additional diagnostic motif, the active transport signature, whose function is so far unknown.


Fig. 1. Expression and characterization of ABC1 in X. laevis oocytes. A, predicted structure of ABC1 with 12 transmembrane domains, 2 NBFs, and a large internally located regulatory domain (R domain) split into halves by a highly hydrophobic segment (HH1). B, specific expression of wild-type ABC1 (lane 2), K1892M (lane 3), and CFTR (lane 5) after injection of the respective cRNA or water (lanes 1 and 4) and immunoprecipitation with Ab16 (lanes 1-3, from samples of 5 oocytes) or anti-CFTR antibody (lanes 4 and 5, from samples of 35 oocytes). The migration of molecular size markers is shown. C, iodide efflux from water-injected oocytes bathed in ND96 medium containing 2 mM Ca2+ in the absence (water basal) or presence of the calcium ionophore A23187 (10 µM). D, iodide efflux from CFTR oocytes bathed in ND96 medium with cpt-cAMP (500 µM) + IBMX (1 mM) or without (CFTR basal). E, iodide efflux from water- and ABC1-injected oocytes bathed in ND96 medium (Ca2+-free). F, iodide efflux amplitude after 8 min from water- and ABC1-injected oocytes in ND96 medium (NaCl) or modified ND96 medium (as indicated under "Materials and Methods"). Bars show means and S.D. for 4-14 separate experiments.
[View Larger Version of this Image (34K GIF file)]


We have recently reported on the functional characterization of a novel ABC transporter, ABC1 (22, 23). This molecule, whose expression during embryonic development correlates with the occurrence of programmed cell death, is required by macrophages during engulfment of cells undergoing apoptosis (23, 24). From a structural standpoint, ABC1 possesses all of the typical features of ABC transporters, i.e. the two symmetric halves each equipped with six transmembrane spanners and an NBF. In addition, a long charged region, reminiscent of the regulatory domain of CFTR but unique in that it is equipped with an extra hydrophobic segment, links the two halves of the molecule (23). The purpose of this work was to analyze the ionic transport capability of ABC1 transporter using radiotracer efflux and electrophysiological techniques.


MATERIALS AND METHODS

Plasmid Construction

The ABC1 full-length cDNA was constructed from the lambda 13C, lambda 10F, and lambda 8a4 overlapping phage clones (22) using the prokaryotic cloning vector pBluescript KS+/- (Stratagene). The NgoMI-EcoRI fragment from the lambda 13C clone, which extends in the 5' region of ABC1 (EMBL accession number X75926[GenBank], nucleotides 1-2567), was juxtaposed to the EcoRI-HindIII fragment from lambda 10F (nucleotides 2568-5665) and the HindIII-XbaI fragment of lambda 8a4 (nucleotides 5666-6916). The final construct, pABC1KS, was excised by NotI-ApaI in the vector polylinker and then cloned into the pSP6TN poly(A) vector (pABC1TN) modified from pSP64T poly(A) (a generous gift of A. Ceriotti, Milano, Italy) (25) by the insertion of an oligonucleotide linker (GATCTGGGCCCACTCGAGTTAACGCGGCCGCA) conferring ApaI, XhoI, HpaI, and NotI as additional unique sites. The CFTR cDNA construct pACF23 was provided by J. R. Riordan, Scottsdale, AZ, (26).

In Vitro Mutagenesis Procedure

The Lys1892 in the second ATP cassette of ABC1 was mutated to methionine by polymerase chain reaction amplification of the wild-type cDNA with a mutated 5' primer spanning nucleotides 5854-5874 and a vector-specific 3' primer downstream from the multiple cloning sites linker of pSP64TN poly(A). The 5' sense primer whose sequence is <UNL>GTTAAC</UNL>GGAGCTGGGATGTCA includes the AAG (lysine) to ATG (methionine) single mutation (in bold) and the wild-type HpaI restriction site (underlined). The final construct, K1892M, was obtained after insertion into pABC1TN of the amplification product digested by HpaI-ApaI and verified by sequencing.

In Vitro Transcription

10 µg of linearized DNA template was transcribed in vitro by Sp6 RNA polymerase following standard protocols (27) for 1 h at 37 °C. After removal of DNA template by treatment with DNase I, the capped cRNA was precipitated and resuspended in diethyl pyrocarbonate-water. The final concentration was adjusted to 200 ng/µl for ABC1 and K1892M cRNA and to 100 ng/µl for CFTR cRNA after analysis on formaldehyde-agarose gel.

Oocyte Expression Studies

Stage V Xenopus laevis oocytes were defolliculated by collagenase and microinjected with 50 nl of water or aqueous solutions of cRNA encoding ABC1, K1892M, or CFTR. Oocytes were incubated in modified Barth's saline medium (88 mM NaCl, 1 mM KCl, 0.41 mM CaCl2, 0.33 mM Ca(NO3)2, 0.82 mM MgSO4, 2.4 mM NaHCO3, and 10 mM HEPES, pH 7.4) containing 5 IU/ml penicillin/streptomycin (Life Technologies, Inc.). The protein expression was monitored systematically for every batch of injected oocytes. After overnight metabolic labeling the oocytes were lysed in 0.1 M NaCl, 0.1 M Tris, pH 8.0, 10 mM EDTA, 1% Triton X-100, and 1 mM phenylmethylsulfonyl fluoride. The proteins of interest were immunoprecipitated according to the standard protocols (28) and eluted from protein A- or protein G-Sepharose in 20 µl of sample buffer (supplemented with M urea) for 2 min at 50 °C. ABC1 and K1892M were immunoprecipitated using Ab16, a rabbit polyclonal antiserum recognizing the first NBF domain of ABC1 (dilution 1:250) (23), and CFTR with 1 µg of monoclonal mouse anti-human regulatory domain-specific antibody (Genzyme, Cambridge, MA) (28).

Transport Assays

Groups of five oocytes were incubated for 30 min in a 6.5-mm diameter porous bottom dish (Transwell®, Costar) in 1 ml of ND96 buffer (96 mM NaCl, 2 mM KCl, 1.8 mM CaCl2, 1 mM MgCl2, and 5 mM HEPES titrated with NaOH to pH 7.4) containing 1 µM KI (1 µCi of Na125I/ml, DuPont) at room temperature (adapted from Refs. 29 and 30). After the loading period, the oocytes were sequentially moved at 1-min intervals through a series of wells containing 1 ml of buffer. 125I released from the oocytes in each well was measured by radioactivity counting (Compu Gamma, LKB). The first two wells were used to establish a stable base line in ND96 buffer (time 0). After eight 1-min washes, the oocytes were solubilized in 1 M NaOH and the residual iodide content was measured. The total amount of 125I (800-1200 cpm/oocyte) at time 0 was calculated as the sum of radioactivity recovered in each 1-min sample plus the residual iodide content. Efflux curves were constructed by plotting the percentage of total radioactivity released in the medium versus time. The percentage of total at 8 min (T8) was used for further analysis. The appropriate drug or modified ND96 buffers (Cl--free ND96 medium, all external Cl- was replaced by gluconate; Na+-free ND96 medium, 96 mM NaCl was replaced by 96 mM LiCl) was applied after the stable base line in ND96 buffer was obtained. Oocyte ion conductance was measured by conventional two-electrode voltage clamp (26) and bathed in ND96 medium. Data are presented as the mean ± S.D. of n observations. Statistical significance was assessed at the 95% confidence level with Student's t test.

In Vitro Phosphorylation

Ab16 immunoprecipitates from samples of 10 unlabeled oocytes were equilibrated in 50 mM Tris, pH 7.5, 10 mM MgCl2, and 100 mg/ml bovine serum albumin and then allowed to react in the presence of 50 ng of catalytic subunit of protein kinase A (Sigma) and 10 µCi of [gamma -32P]ATP for 1 h at 30 °C. The reaction was stopped by the addition of sample buffer. The patterns of phosphorylation in oocytes injected either with ABC1 or water were analyzed by SDS-polyacrylamide gel electrophoresis on 7.5% polyacrylamide gels and autoradiography.

Pharmacological Agents

N-(2-(p-Bromocinnamylamino)ethyl)-5-isoquinolinesulfonamide (H89) and okadaic acid were from RBI (Natick, MA), and A27187, forskolin, and cpt-cAMP were from Boehringer Mannheim. The drugs were dissolved in dimethyl sulfoxide stock solutions and used at a final dimethyl sulfoxide concentration of 0.1%. All other reagents were from Sigma.


RESULTS

Expression of ABC1 in Xenopus Oocytes

After injection of cRNA, the synthesis of ABC1 at the predicted size (220 kDa) was monitored after immunoprecipitation by Ab16 (Fig. 1B, lane 2). The expression of K1892M, an ABC1 mutant in which the Lys1892 of the Walker A motif in the second nucleotide binding fold (NBF2) has been replaced by a methionine, was monitored in the same way (Fig. 1B, lane 3). No variations with respect to the wild-type protein were detected either in the temporal onset of protein synthesis or in the ratio of produced protein to injected cRNA. The expression of CFTR in oocytes was monitored by immunopurification with a monoclonal mouse anti-human regulatory domain-specific antibody (Fig. 1B, lane 5).

ABC1 Generates an Anion Efflux in Xenopus Oocytes

Since the activity of CFTR and P-glycoprotein is associated with chloride transport (6, 18, 19, 26, 31), we wished to determine the properties of ABC1 expressed in Xenopus oocytes using the radiotracer iodide efflux technique. First, we analyzed the activity of two well characterized Cl- channels in Xenopus oocytes. The endogenous Ca2+-dependent Cl- channel can be activated by promoting Ca2+ influx using A23187 (29, 32) as shown in Fig. 1C. Indeed, the presence of 10 µM A23187 in the buffer increased (approx 3-fold) the iodide efflux in water-injected oocytes (efflux at 8 min, T8 = 68 ± 9%, n = 4) compared with basal oocytes (T8 = 21 ± 5%, p < 0.01, n = 4). After expression in Xenopus oocytes, CFTR generates a cAMP-dependent chloride current (26, 29). In our experiments the iodide efflux in CFTR-expressing oocytes was increased (p < 0.01) upon addition of cAMP agonists (Fig. 1D, CFTR basal (T8 = 31 ± 5%, n = 5) and CFTR + cAMP (T8 = 53 ± 11%, n = 5)). Having determined that our technique offers a convenient way to evaluate the activity of both endogenous and expressed chloride channels in oocytes, we then investigated whether an iodide efflux is detectable in ABC1-injected oocytes. Fig. 1, E and F, shows that the expression of ABC1 in oocytes is associated with an increase (p < 0.01) of the iodide efflux amplitude (T8 = 49 ± 7%, n = 12) greater than that seen in water-injected oocytes (T8 = 19 ± 7.5%, n = 14) in Ca2+-free ND96 medium. Similar results were obtained in ND96 medium containing 2 mM Ca2+ (ABC1, T8 = 50 ± 3%, n = 7; water, T8 = 20 ± 6%, n = 9, p < 0.01). The amplitude of the iodide efflux appeared to be directly dependent on the amount of injected ABC1 mRNA because 10-fold less mRNA led to a reduced efflux (T8 = 36 ± 7%, n = 6).

The equimolar substitution of extracellular chloride with the nonpermeant anion gluconate did not affect the amplitude of the A23187-activated efflux from water-injected oocytes (gluconate + A23187, T8 = 67.4 ± 7%, n = 2; ND96 + A2318, T8 = 68 ± 9%, n = 4 (not shown)). In contrast, a similar procedure decreased the magnitude of the efflux from ABC1-injected oocytes (gluconate, T8 = 34.2 ± 6%, n = 8 (Fig. 1F)), whereas substitution of extracellular sodium with lithium had no effect (T8 = 49.8 ± 5%, n = 5 (Fig. 1F)).

Pharmacological Specificity

Compared with the basal activity of ABC1 (Fig. 2B, noted as DMSO, T8 = 51 ± 4%, n = 5), the Cl- channel blockers DIDS (500 µM, n = 6 (Fig. 2A)), diphenylamine-2-carboxylic acid (500 µM, n = 3), and flufenamic acid (500 µM, n = 4) blocked 50-80% (p < 0.01) of the iodide efflux generated by the expression of ABC1 (Fig. 2B) (T8 = 22.4 ± 4, 29 ± 1, and 33 ± 8%, respectively). ABC1 activity was also sensitive to bumetanide (T8 = 42 ± 6%, 200 µM, n = 3, p < 0.05) and furosemide (T8 = 33 ± 7%, 200 µM, n = 3, p < 0.01 (Fig. 2B)). The prostaglandin transporter (33) inhibitor sulfobromophthalein (BSP) (500 µM, n = 8) inhibited approx 80% of the ABC1 activity (T8 = 24 ± 6%, p < 0.01 (Fig. 2, A and B)). The sulfonylurea compound glibenclamide (100 µM), which is an inhibitor of the activity of KATP (34) and CFTR (35) channels, almost completely blocked the activity of ABC1 (T8 = 21 ± 7%, n = 6, p < 0.01 (Fig. 2, A and B)) and CFTR (CFTR + cAMP, T8 = 53 ± 11%, n = 5; CFTR + cAMP + glibenclamide, T8 = 31 ± 5%, n = 4, p < 0.01) in oocytes. Verapamil (T8 = 49 ± 9%, 200 µM, n = 3), a P-glycoprotein inhibitor (31), and the potassium channel inhibitor tetraethylammonium (10 mM, T8 = 53 ± 5%, n = 2) had no significant effect on the ABC1 activity (Fig. 2B).


Fig. 2. Pharmacological inhibitory profile of ABC1 in X. laevis oocytes. A, inhibitions by DIDS (500 µM), BSP (500 µM), and glibenclamide (glib., 100 µM) of the iodide efflux. B, effects of 10 mM tetraethylammonium, 200 µM bumetanide, 200 µM furosemide, 500 µM flufenamic acid, 500 µM diphenylamine 2-carboxylic acid, 500 µM DIDS, 500 µM BSP, 100 µM glibenclamide, and 0.1% dimethyl sulfoxide as vehicle in ND96 medium. Bars show mean percentages of inhibition and S.D. for 3-6 separate experiments.
[View Larger Version of this Image (20K GIF file)]


Regulation of ABC1 Activity

Since CFTR can be regulated by cAMP (6, 26, 36), we analyzed the effects of cAMP on ABC1. Fig. 3 shows that cpt-cAMP (500 µM) increased (p < 0.01) the magnitude of the iodide efflux in ABC1 oocytes (T8 = 63 ± 6%, n = 6; basal T8 = 49 ± 7%). These observations were confirmed using forskolin (T8 = 68 ± 5.7%, 10 µM, n = 2 (Fig. 3B)) or a mixture containing cpt-cAMP (500 µM) and IBMX (1 mM, T8 = 67.5 ± 7%, n = 2 (Fig. 3B)). The protein kinase A inhibitor H89 (20 µM) decreased (p < 0.01) the basal activity of ABC1 (T8 = 37 ± 3.5%, n = 4 (Fig. 3B)). The protein phosphatase inhibitor okadaic acid (10 µM) slightly increased (p < 0.05) the ABC1 activity (T8 = 54 ± 3%, n = 3 (Fig. 3B)). In water-injected oocytes, exposure of cAMP agonists failed to generate a significant anion transport (T8 = 22 ± 5%, n = 3 (Fig. 3B)) (see Refs. 26 and 29). The cAMP stimulation may be due to the direct phosphorylation of ABC1 as shown by in vitro phosphorylation of immunopurified ABC1 by protein kinase A (Fig. 3C).


Fig. 3. Regulation of ABC1 activity by orthovanadate and cAMP in X. laevis oocytes. A, activation of ABC1 by cpt-cAMP (500 µM) + IBMX (1 mM) (ABC1 + cAMP) in oocytes bathed in ND96 medium. B, effects of forskolin (10 µM), cpt-cAMP (500 µM) alone or associated with IBMX (1 mM), H89 (20 µM), okadaic acid (10 µM), and orthovanadate (1 mM) alone or with glibenclamide (100 µM). Bars show means and S.D. of iodide efflux after 8 min for 3-6 separate experiments. C, incorporation of [32P]phosphate into ABC1 after immunoprecipitation with Ab16 in the absence (lane 1) or presence (lane 2) of protein kinase A.
[View Larger Version of this Image (27K GIF file)]


Role of NBF2

ABC1 in which the Lys1892 in NBF2 has been replaced by a methionine (K1892M mutant) and expressed in oocytes (see Fig. 1B) generated an iodide efflux that was increased (T8 = 57 ± 6.7%, n = 11) compared with wild-type ABC1 (T8 = 49 ± 7%, n = 12, p < 0.01 (see Fig. 3B)). DIDS (T8 = 27 ± 7%, 500 µM, n = 4), BSP (T8 = 28 ± 1%, 500 µM, n = 4), and glibenclamide (T8 = 26 ± 3%, 100 µM, n = 6) inhibit (p < 0.01) the transport activity of K1892M (Fig. 4, A-D). Fig. 4B shows that K1892M failed to respond to 500 µM cpt-cAMP (T8 = 55.6 ± 4.6%, n = 8). Whereas the phosphate analog orthovanadate increased (p < 0.01) the amplitude of the efflux of wild-type ABC1 (1 mM, n = 6 (Fig. 3B)) to T8 = 63 ± 5.7% (an effect inhibited by glibenclamide, 100 µM, n = 2 (Fig. 3B)), the activity of K1892M was reduced (T8 = 46 ± 3%, n = 11, p < 0.05 (Fig. 4B)).


Fig. 4. Effect of the Walker A motif lysine mutation K1892M on the transport activity of ABC1 after expression in X. laevis. A, iodide efflux from water-, ABC1-, and K1892M-injected oocytes bathed in ND96 medium. B, iodide efflux from K1892M oocytes in ND96 medium in the absence (basal) and presence of cpt-cAMP (500 µM) + IBMX (1 mM) (cAMP) and orthovanadate (1 mM). Bars show means and S.D. for 8-11 separate experiments. C, inhibition of the iodide efflux by BSP (500 µM) from K1892M oocytes. D, inhibition of the iodide efflux by BSP (500 µM), DIDS (500 µM), and glibenclamide (100 µM) from K1892M oocytes. Bars show means and S.D. for 4-6 separate experiments.
[View Larger Version of this Image (30K GIF file)]


ABC1 Is Not a Chloride Channel

We then examined the electrophysiological properties of oocytes expressing ABC1 compared with water- and CFTR-injected oocytes (Fig. 5). The membrane potential (Em) was not affected by the expression of the different transporters (ABC1, Em -42 ± 5 mV, n = 13; CFTR, Em = -45 ± 5 mV, n = 5; water, Em = -43 ± 6 mV, n = 10). The holding current was similar in water (-13 ± 3.4 nA, n = 7) and ABC1 (-14 ± 4 nA, n = 12) oocytes voltage clamped at -60 mV and bathed in ND96 medium. The Ca2+-activated Cl- channel activity induced by A23187 (10 µM, -126 ± 48 nA at -60 mV, p < 0.01, n = 5) and inhibited by DIDS (500 µM, -30 ± 8 nA at -60 mV, n = 3) was not affected by the presence of ABC1 (A23187, -114 ± 50 nA at -60 mV, n = 6; A23187 + DIDS, -18 ± 4 nA at -60 mV, n = 3 (Fig. 5A)). When cpt-cAMP (500 µM), IBMX (1 mM), or forskolin (10 µM) was added to the perfusion medium, no modification of the holding current was observed in the presence of ABC1 (-15 ± 4 nA, n = 14) or in its absence (-14.5 ± 6 nA, n = 20). In contrast, and as already reported (26, 29), CFTR generated a cAMP-dependent current (n = 10 (Fig. 5B)) inhibited by glibenclamide (100 µM, n = 4 (not shown)). Like wild-type ABC1, K1892M also failed to generate a current either under resting conditions or in the presence of cAMP agonists (data not shown).


Fig. 5. Electrophysiological recordings from oocytes injected with water and cRNA for wild-type ABC1 and CFTR. A, histograms of holding inward current from water- and ABC1-injected oocytes voltage clamped at a holding potential of -60 mV. The current was recorded in the following conditions: basal, A23187 (10 µM), A23187 (10 µM) + DIDS (500 µM), and cpt-cAMP (500 µM) + IBMX (1 mM) (cAMP) superfused in ND96 medium. Bars show means and S.D. of 3-14 experiments. B, family of currents from water-, ABC1-, and CFTR-injected oocytes. Voltage steps (400 ms) were made from -80 to +30 mV in 20-mV increments. ND96 medium was superfused in the absence (basal) or presence of cpt-cAMP (500 µM) + IBMX (1 mM) (cAMP). No cAMP-activated conductance was present in water- and ABC1-injected oocytes.
[View Larger Version of this Image (16K GIF file)]



DISCUSSION

We report here on the characterization, pharmacological profile, and regulation of ABC1 as a cAMP-dependent and glibenclamide-sensitive anion transporter. Among the ABC proteins involved in anion transport, CFTR is a chloride channel (5, 6, 26, 36) and the P-glycoprotein regulates an endogenous chloride channel (2, 18, 19, 31). In this paper, we provide evidence that ABC1 shares with CFTR (5, 6, 26, 36) the ability to transport anions and to be up-regulated by cAMP, IBMX, okadaic acid, and vanadate. However, as opposed to CFTR, ABC1 behaves as an electroneutral anion exchanger since no significant chloride current was detected from oocytes expressing ABC1 and the ABC1-generated anion efflux is dependent on extracellular chloride concentration. In fact, the substitution of extracellular chloride by gluconate reduces the efflux from ABC1-injected oocytes as would be expected from a parallel anion antiport (e.g. Cl-/HCO3- exchanger) (37, 38), whereas in similar conditions the activity of the A23187-stimulated efflux through the Ca2+-dependent Cl- channel is not affected.

Like CFTR (6, 29, 35), ABC1 is inhibited by glibenclamide, flufenamic acid, and diphenylamine-2-carboxylic acid. In addition, ABC1 is also inhibited by the organic anion sulfobromophthalein and by the broad acting blocker of anion transporters, DIDS.

We provide evidence that activation of protein kinase A increases the activity of ABC1 and that ABC1 is phosphorylated in vitro by protein kinase A, which suggests that direct phosphorylation of the protein might take place in vivo. On the other hand, the activity of ABC1 is unaffected by extracellular Ca2+ concentration or by Ca2+ entry triggered by A23187. Therefore, ABC1 appears to be up-regulated by cAMP-dependent protein kinases and by the phosphatase inhibitors okadaic acid and vanadate. Our observations are in line with the current opinion that kinases modulate their activities by phosphorylating specific sites of ABC transporters (6, 17, 19, 36).

In other ABC transporters, mutating the conserved lysine in NBF was found to severely reduce or abolish hydrolysis of ATP, which in turn alters the activity of the transporter (1, 2, 14). For example, mutation of the Lys1250 into the NBF2 of CFTR modifies the kinetic parameters of the channel activity (14-16). The corresponding mutation in ABC1 (i.e. K1892M) produces a transporter with an increased basal ionic flux and a conserved pharmacological inhibitory profile (i.e. inhibition by glibenclamide, DIDS, and BSP). In contrast, the K1892M mutant is unaffected by cAMP, and a reduced efflux is observed after vanadate treatment. A reasonable interpretation of these results is that vanadate in the wild-type ABC1 primarily impairs the function of NBF2, as is the case in the K1892M mutant. The reversed effect of vanadate treatment on the mutant might result from other actions of this compound either at NBF1 and/or as a phosphatase inhibitor. Similar effects of vanadate on CFTR and its mutants have been reported and led to a model of the transport cycle in which hydrolysis at NBF2 plays an inhibitory role (14-16, 36).

The identification of ABC1 as a cAMP-dependent anionic transporter does not provide any information on the nature of the transported substrate, nor does it shed light on the role played by ABC1 during engulfment of apoptotic corpses. Nonetheless, the finding of an ABC1-dependent anionic flux with a clear-cut pharmacological profile provides an extremely useful experimental tool. We can in fact readily investigate how modulations of ABC1 transporter activity in phagocytic cells, like mouse peritoneal macrophages, affect their responses to specific physiopathological challenges.


FOOTNOTES

*   This investigation was supported by a postdoctoral fellowship from the Association Française de Lutte Contre la Mucoviscidose (AFLM) (to F. B.), a postdoctoral fellowship from the European Economic Community (to A. B.), institutional grants from INSERM and CNRS, and specific grants from AFLM, Ligue Nationale Contre le Cancer, and Association pour la Recherche sur le Cancer. The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
   To whom correspondence should be addressed. Tel.: 33-4-91-26-94-04; Fax: 33-4-91-26-94-30; E-mail: chimini{at}ciml.univ-mrs.fr.
1    The abbreviations used are: ABC, ATP binding cassette; CFTR, cystic fibrosis transmembrane conductance regulator; NBF, nucleotide binding fold; H89, N-(2-(p-bromocinnamylamino)ethyl)-5-isoquinolinesulfonamide; cpt-cAMP, 8-(4-chlorphenylthio)-adenosine 3',5'-cyclic monophosphate; IBMX, 3-isobutyl-1-methylxanthine; BSP, sulfobromophthalein; DIDS, 4,4'-diisothiocyanostilbene-2,2'-disulfonic acid.

Acknowledgments

We gratefully acknowledge M. Crest, G. Jacquet, and M. F. Luciani for technical assistance, Aldo Cerriotti for having introduced A. B. to oocyte techniques, J. R. Riordan for the generous gift of full-length CFTR cDNA, and P. Golstein for critical reading of the manuscript.


REFERENCES

  1. Ames, G. F.-L., and Lecar, H. (1992) FASEB J. 6, 2660-2666 [Abstract]
  2. Higgins, C. F. (1995) Cell 82, 693-696 [CrossRef][Medline] [Order article via Infotrieve]
  3. Gottesman, M. M., and Pastan, I. (1992) Annu. Rev. Biochem. 62, 385-428 [CrossRef][Medline] [Order article via Infotrieve]
  4. Thomas, P. M., Cote, G. J., Wohlik, N., Haddad, B., Mathew, P. M., Rabl, W., Aguilar-Bryan, L., Gagel, R. F., and Bryan, J. (1995) Science 268, 426-429 [Abstract/Free Full Text]
  5. Riordan, J. R., Rommens, J. M., Kerem, B.-S., Alon, N., Rozmahel, R., Grzelczak, Z., Zielenski, J., Lok, S., Plavsic, N., Chou, J. L., Drumm, M. L., Iannuzzi, M. C., Collins, F. S., and Tsui, L.-C. (1989) Science 245, 1066-1073 [Abstract/Free Full Text]
  6. Hanrahan, J. W., Tabcharani, J. A., Becq, F., Mathews, C. J., Augustinas, O., Jensen, T. J., Chang, X.-B. & Riordan, J. R. (1995) in Ion Channels and Genetic Diseases (Dawson, D. C. & Frizzell, R. A., eds) Vol. 50, pp. 125-137, Society of General Physiologists Symposium Series, Rockefeller University Press, New York
  7. Sarkadi, B., Price, E. M., Boucher, R. C., Germann, U. A., and Scarborough, G. A. (1992) J. Biol. Chem. 267, 4854-4858 [Abstract/Free Full Text]
  8. Shapiro, A. B., and Ling, V. (1994) J. Biol. Chem. 269, 3745-3754 [Abstract/Free Full Text]
  9. Ko, Y. H., and Pedersen, P. L. (1995) J. Biol. Chem. 270, 22093-22096 [Abstract/Free Full Text]
  10. Doige, C. A., Xiaohong, Y., and Sharom, F. J. (1992) Biochim. Biophys. Acta 1109, 149-160 [Medline] [Order article via Infotrieve]
  11. Müller, M., Bakos, E., Welker, E., Varadi, A., Germann, U. A., Gottesman, M. M., Morse, B. S., Roninson, I. B., and Sarkadi, B. (1996) J. Biol. Chem. 271, 1877-1883 [Abstract/Free Full Text]
  12. Beaudet, L., and Gros, P. (1995) J. Biol. Chem. 270, 17159-17170 [Abstract/Free Full Text]
  13. Baukrowitz, T., Hwang, T. C., Nairn, A. C., and Gadsby, D. C. (1994) Neuron 12, 473-482 [CrossRef][Medline] [Order article via Infotrieve]
  14. Carson, M. R., Travis, S. M., and Welsh, M. J. (1995) J. Biol. Chem. 270, 1711-1717 [Abstract/Free Full Text]
  15. Gunderson, K. L., and Kopito, R. R. (1995) Cell 82, 231-239 [CrossRef][Medline] [Order article via Infotrieve]
  16. Smit, L. S., Wilkinson, D. J., Mansoura, M. K., Collins, F. S., and Dawson, D. C. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 9963-9967 [Abstract/Free Full Text]
  17. Picciotto, M. R., Cohn, J. A., Bertuzzi, G., Greengard, P., and Nairn, A. C. (1992) J. Biol. Chem. 267, 12742-12752 [Abstract/Free Full Text]
  18. Gill, D. R., Hyde, S. C., Higgins, C. F., Valverde, M. A., Mintening, G. M., and Sepùlveda, F. V. (1992) Cell 71, 23-32 [CrossRef][Medline] [Order article via Infotrieve]
  19. Hardy, S. P., Goodfellow, H. R., Valverde, M. A., Gill, D. R., Sepùlveda, F. V., and Higgins, C. F. (1995) EMBO J. 14, 68-75 [Medline] [Order article via Infotrieve]
  20. Walker, J. E., Saraste, M., Runswick, M. J., and Gay, N. J. (1982) EMBO J. 1, 945-951 [Medline] [Order article via Infotrieve]
  21. Saraste, M., Sibbald, P. R., and Wittinghofer, A. (1990) Trends Biochem. Sci. 15, 430-434 [CrossRef][Medline] [Order article via Infotrieve]
  22. Luciani, M. F., Denizot, F., Savary, S., Mattei, M. G., and Chimini, G. (1994) Genomics 21, 150-159 [CrossRef][Medline] [Order article via Infotrieve]
  23. Luciani, M. F., and Chimini, G. (1996) EMBO J. 15, 226-235 [Medline] [Order article via Infotrieve]
  24. Ellis, R. E., Yuan, J., and Horvitz, R. (1991) Annu. Rev. Cell Biol. 7, 663-699 [CrossRef]
  25. Krieg, P. A., and Melton, D. A. (1984) Nucleic Acids Res. 12, 7057-7070 [Abstract/Free Full Text]
  26. Bear, C. E., Duguay, F., Naismith, A. L., Kartner, N., Hanrahan, J. W., and Riordan, J. R. (1991) J. Biol. Chem. 266, 19142-19145 [Abstract/Free Full Text]
  27. Skach, W. R., and Lingappa, V. R. (1993) J. Biol. Chem. 268, 23552-23561 [Abstract/Free Full Text]
  28. Cheng, S. H., Rich, D. P., Marshall, J., Gregory, R. J., Welsh, M. J., and Smith, A. E. (1991) Cell 66, 1027-1036 [CrossRef][Medline] [Order article via Infotrieve]
  29. Ohrui, T., Skach, W., Thompson, M., Matsumoto-Pon, J., Calayag, C., and Widdicombe, J. H. (1994) Am. J. Physiol. 266, C1586-C1593 [Abstract/Free Full Text]
  30. Becq, F., Verrier, B., Chang, X.-B., Riordan, J. R., and Hanrahan, J. W. (1996) J. Biol. Chem 271, 16171-16179 [Abstract/Free Full Text]
  31. Valverde, M. A., Diaz, M., Sepùlveda, F. V., Gill, D. R., Hyde, S. C., and Higgins, C. F. (1992) Nature 355, 830-833 [CrossRef][Medline] [Order article via Infotrieve]
  32. Barish, M. E. (1983) J. Physiol. (Lond.) 342, 309-325 [Abstract/Free Full Text]
  33. Kanai, N., Lu, R., Satriano, J. A., Bao, Y., Wolkoff, A. W., and Schuster, V. L. (1995) Science 268, 866-869 [Abstract/Free Full Text]
  34. Quast, U., and Cook, N. S. (1989) J. Pharmacol. Exp. Ther. 250, 261-271 [Abstract/Free Full Text]
  35. Sheppard, D. N., and Welsh, M. J. (1992) J. Gen. Physiol. 100, 573-591 [Abstract/Free Full Text]
  36. Becq, F., Jensen, T. J., Chang, X. B., Savoia, A., Rommens, J. M., Tsui, L. C., Buchwald, M., Riordan, J. R., and Hanrahan, J. W. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 9160-9164 [Abstract/Free Full Text]
  37. Reuss, L., and Costantin, J. L. (1984) J. Gen. Physiol. 83, 801-818 [Abstract/Free Full Text]
  38. Kemp, P. J., and Boyd, C. A. R. (1993) Pfluegers Arch. Eur. J. Physiol. 425, 28-33

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
J. Wang, Z.-R. Zhang, C.-F. Chou, Y.-Y. Liang, Y. Gu, and H.-P. Ma
Cyclosporine stimulates the renal epithelial sodium channel by elevating cholesterol
Am J Physiol Renal Physiol, February 1, 2009; 296(2): F284 - F290.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. R. J. Taylor, M. Gonzalez-Begne, S. Dewhurst, G. Chimini, C. F. Higgins, J. E. Melvin, and J. I. Elliott
Sequential Shrinkage and Swelling Underlie P2X7-Stimulated Lymphocyte Phosphatidylserine Exposure and Death
J. Immunol., January 1, 2008; 180(1): 300 - 308.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
E. Naschberger, C. Lubeseder-Martellato, N. Meyer, R. Gessner, E. Kremmer, A. Gessner, and M. Sturzl
Human Guanylate Binding Protein-1 Is a Secreted GTPase Present in Increased Concentrations in the Cerebrospinal Fluid of Patients with Bacterial Meningitis
Am. J. Pathol., September 1, 2006; 169(3): 1088 - 1099.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
R. G. Deeley, C. Westlake, and S. P. C. Cole
Transmembrane Transport of Endo- and Xenobiotics by Mammalian ATP-Binding Cassette Multidrug Resistance Proteins.
Physiol Rev, July 1, 2006; 86(3): 849 - 899.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. Omer, D. Meredith, J. F. Morris, and H. C. Christian
Evidence for the Role of Adenosine 5'-Triphosphate-Binding Cassette (ABC)-A1 in the Externalization of Annexin 1 from Pituitary Folliculostellate Cells and ABCA1-Transfected Cell Models
Endocrinology, July 1, 2006; 147(7): 3219 - 3227.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
N. Kobayashi, T. Nishi, T. Hirata, A. Kihara, T. Sano, Y. Igarashi, and A. Yamaguchi
Sphingosine 1-phosphate is released from the cytosol of rat platelets in a carrier-mediated manner
J. Lipid Res., March 1, 2006; 47(3): 614 - 621.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
G. Martin, O. Sabido, P. Durand, and R. Levy
Phosphatidylserine externalization in human sperm induced by calcium ionophore A23187: relationship with apoptosis, membrane scrambling and the acrosome reaction
Hum. Reprod., December 1, 2005; 20(12): 3459 - 3468.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
J. A. Chirinos, J. P. Zambrano, S. Chakko, A. Schob, R. B. Goldberg, G. Perez, and A. J. Mendez
Ability of Serum to Decrease Cellular AcylCoA:Cholesterol Acyl Transferase Activity Predicts Cardiovascular Outcomes
Circulation, October 18, 2005; 112(16): 2446 - 2453.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
J. Qian, S. Morley, K. Wilson, P. Nava, J. Atkinson, and D. Manor
Intracellular trafficking of vitamin E in hepatocytes: the role of tocopherol transfer protein
J. Lipid Res., October 1, 2005; 46(10): 2072 - 2082.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
R. S. Kiss, J. Maric, and Y. L. Marcel
Lipid efflux in human and mouse macrophagic cells: evidence for differential regulation of phospholipid and cholesterol efflux
J. Lipid Res., September 1, 2005; 46(9): 1877 - 1887.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Denis, B. Haidar, M. Marcil, M. Bouvier, L. Krimbou, and J. Genest
Characterization of Oligomeric Human ATP Binding Cassette Transporter A1: POTENTIAL IMPLICATIONS FOR DETERMINING THE STRUCTURE OF NASCENT HIGH DENSITY LIPOPROTEIN PARTICLES
J. Biol. Chem., October 1, 2004; 279(40): 41529 - 41536.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J.-R. Nofer, G. Herminghaus, M. Brodde, E. Morgenstern, S. Rust, T. Engel, U. Seedorf, G. Assmann, H. Bluethmann, and B. E. Kehrel
Impaired Platelet Activation in Familial High Density Lipoprotein Deficiency (Tangier Disease)
J. Biol. Chem., August 6, 2004; 279(32): 34032 - 34037.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
T. J. F. Nieland, A. Chroni, M. L. Fitzgerald, Z. Maliga, V. I. Zannis, T. Kirchhausen, and M. Krieger
Cross-inhibition of SR-BI- and ABCA1-mediated cholesterol transport by the small molecules BLT-4 and glyburide
J. Lipid Res., July 1, 2004; 45(7): 1256 - 1265.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Kockx, K.-A. Rye, K. Gaus, C. M. Quinn, J. Wright, T. Sloane, D. Sviridov, Y. Fu, D. Sullivan, J. R. Burnett, et al.
Apolipoprotein A-I-stimulated Apolipoprotein E Secretion from Human Macrophages Is Independent of Cholesterol Efflux
J. Biol. Chem., June 18, 2004; 279(25): 25966 - 25977.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Haidar, M. Denis, M. Marcil, L. Krimbou, and J. Genest Jr.
Apolipoprotein A-I Activates Cellular cAMP Signaling through the ABCA1 Transporter
J. Biol. Chem., March 12, 2004; 279(11): 9963 - 9969.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Abe-Dohmae, Y. Ikeda, M. Matsuo, M. Hayashi, K.-i. Okuhira, K. Ueda, and S. Yokoyama
Human ABCA7 Supports Apolipoprotein-mediated Release of Cellular Cholesterol and Phospholipid to Generate High Density Lipoprotein
J. Biol. Chem., January 2, 2004; 279(1): 604 - 611.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. S. Kiss, D. C. McManus, V. Franklin, W. L. Tan, A. McKenzie, G. Chimini, and Y. L. Marcel
The Lipidation by Hepatocytes of Human Apolipoprotein A-I Occurs by Both ABCA1-dependent and -independent Pathways
J. Biol. Chem., March 14, 2003; 278(12): 10119 - 10127.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
L. P. Chapman, M. J. Epton, J. C. Buckingham, J. F. Morris, and H. C. Christian
Evidence for a Role of the Adenosine 5'-Triphosphate-Binding Cassette Transporter A1 in the Externalization of Annexin I from Pituitary Folliculo-Stellate Cells
Endocrinology, March 1, 2003; 144(3): 1062 - 1073.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
O. MASMOUDI, P. GANDOLFO, J. LEPRINCE, D. VAUDRY, A. FOURNIER, C. PATTE-MENSAH, H. VAUDRY, and M.-C. TONON
Pituitary adenylate cyclase-activating polypeptide (PACAP) stimulates endozepine release from cultured rat astrocytes via a PKA-dependent mechanism
FASEB J, January 1, 2003; 17(1): 17 - 27.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
S. T. Reddy, S. Hama, C. Ng, V. Grijalva, M. Navab, and A. M. Fogelman
ATP-Binding Cassette Transporter 1 Participates in LDL Oxidation by Artery Wall Cells
Arterioscler. Thromb. Vasc. Biol., November 1, 2002; 22(11): 1877 - 1883.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. H. See, R. A. Caday-Malcolm, R. R. Singaraja, S. Zhou, A. Silverston, M. T. Huber, J. Moran, E. R. James, R. Janoo, J. M. Savill, et al.
Protein Kinase A Site-specific Phosphorylation Regulates ATP-binding Cassette A1 (ABCA1)-mediated Phospholipid Efflux
J. Biol. Chem., October 25, 2002; 277(44): 41835 - 41842.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. W. Burgess, R. S. Kiss, H. Zheng, S. Zachariah, and Y. L. Marcel
Trypsin-sensitive and Lipid-containing Sites of the Macrophage Extracellular Matrix Bind Apolipoprotein A-I and Participate in ABCA1-dependent Cholesterol Efflux
J. Biol. Chem., August 23, 2002; 277(35): 31318 - 31326.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
S. Murthy, E. Born, S. N. Mathur, and F. J. Field
LXR/RXR activation enhances basolateral efflux of cholesterol in CaCo-2 cells
J. Lipid Res., July 1, 2002; 43(7): 1054 - 1064.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
I. Cherel, E. Michard, N. Platet, K. Mouline, C. Alcon, H. Sentenac, and J.-B. Thibaud
Physical and Functional Interaction of the Arabidopsis K+ Channel AKT2 and Phosphatase AtPP2CA
PLANT CELL, May 1, 2002; 14(5): 1133 - 1146.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
G. Hasko, E. A. Deitch, Z. H. Nemeth, D. G. Kuhel, and C. Szabo
Inhibitors of ATP-Binding Cassette Transporters Suppress Interleukin-12 p40 Production and Major Histocompatibility Complex II Up-Regulation in Macrophages
J. Pharmacol. Exp. Ther., April 1, 2002; 301(1): 103 - 110.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
R. J. Aiello, D. Brees, P.-A. Bourassa, L. Royer, S. Lindsey, T. Coskran, M. Haghpassand, and O. L. Francone
Increased Atherosclerosis in Hyperlipidemic Mice With Inactivation of ABCA1 in Macrophages
Arterioscler. Thromb. Vasc. Biol., April 1, 2002; 22(4): 630 - 637.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Zha, J. Genest Jr., and R. McPherson
Endocytosis Is Enhanced in Tangier Fibroblasts. POSSIBLE ROLE OF ATP-BINDING CASSETTE PROTEIN A1 IN ENDOSOMAL VESICULAR TRANSPORT
J. Biol. Chem., October 12, 2001; 276(42): 39476 - 39483.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
A. VON ECKARDSTEIN, C. LANGER, T. ENGEL, I. SCHAUKAL, A. CIGNARELLA, J. REINHARDT, S. LORKOWSKI, Z. LI, X. ZHOU, P. CULLEN, et al.
ATP binding cassette transporter ABCA1 modulates the secretion of apolipoprotein E from human monocyte-derived macrophages
FASEB J, July 1, 2001; 15(9): 1555 - 1561.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
A. von Eckardstein, J.-R. Nofer, and G. Assmann
High Density Lipoproteins and Arteriosclerosis : Role of Cholesterol Efflux and Reverse Cholesterol Transport
Arterioscler. Thromb. Vasc. Biol., January 1, 2001; 21(1): 13 - 27.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
A. R. Tall and C. W. Schindler
A, B, C...{gamma}!
Arterioscler. Thromb. Vasc. Biol., June 1, 2000; 20(6): 1423 - 1424.
[Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. McNeish, R. J. Aiello, D. Guyot, T. Turi, C. Gabel, C. Aldinger, K. L. Hoppe, M. L. Roach, L. J. Royer, J. de Wet, et al.
High density lipoprotein deficiency and foam cell accumulation in mice with targeted disruption of ATP-binding cassette transporter-1
PNAS, April 11, 2000; 97(8): 4245 - 4250.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. W. Freeman
Effluxed lipids: Tangier Island's latest export
PNAS, September 28, 1999; 96(20): 10950 - 10952.
[Full Text] [PDF]


Home page
Mol. Biol. CellHome page
C. Andrei, C. Dazzi, L. Lotti, M. R. Torrisi, G. Chimini, and A. Rubartelli
The Secretory Route of the Leaderless Protein Interleukin 1beta Involves Exocytosis of Endolysosome-related Vesicles
Mol. Biol. Cell, May 1, 1999; 10(5): 1463 - 1475.
[Abstract] [Full Text]


Home page
BloodHome page
Y. Hamon, M.-F. Luciani, F. Becq, B. Verrier, A. Rubartelli, and G. Chimini
Interleukin-1beta Secretion Is Impaired by Inhibitors of the Atp Binding Cassette Transporter, ABC1
Blood, October 15, 1997; 90(8): 2911 - 2915.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. V. Wu, N. S. Joo, M. E. Krouse, and J. J. Wine
Cystic Fibrosis Transmembrane Conductance Regulator Gating Requires Cytosolic Electrolytes
J. Biol. Chem., February 23, 2001; 276(9): 6473 - 6478.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
O. Chambenoit, Y. Hamon, D. Marguet, H. Rigneault, M. Rosseneu, and G. Chimini
Specific Docking of Apolipoprotein A-I at the Cell Surface Requires a Functional ABCA1 Transporter
J. Biol. Chem., March 23, 2001; 276(13): 9955 - 9960.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Toure, L. Morin, C. Pineau, F. Becq, O. Dorseuil, and G. Gacon
Tat1, a Novel Sulfate Transporter Specifically Expressed in Human Male Germ Cells and Potentially Linked to RhoGTPase Signaling
J. Biol. Chem., June 1, 2001; 276(23): 20309 - 20315.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Wang, D. L. Silver, C. Thiele, and A. R. Tall
ATP-binding Cassette Transporter A1 (ABCA1) Functions as a Cholesterol Efflux Regulatory Protein
J. Biol. Chem., June 22, 2001; 276(26): 23742 - 23747.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
R. J. Aiello, D. Brees, P.-A. Bourassa, L. Royer, S. Lindsey, T. Coskran, M. Haghpassand, and O. L. Francone
Increased Atherosclerosis in Hyperlipidemic Mice With Inactivation of ABCA1 in Macrophages
Arterioscler. Thromb. Vasc. Biol., April 1, 2002; 22(4): 630 - 637.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Becq, F.
Right arrow Articles by Chimini, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Becq, F.
Right arrow Articles by Chimini, G.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1997 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement