|
|
|
|||||||
|
|||||||||
(Received for publication, June 13, 1996, and in revised form, September 17, 1996)
From the ABSTRACT The ATP binding cassette transporter ABC1 is a
220-kDa glycoprotein expressed by macrophages and required for
engulfment of cells undergoing programmed cell death. Since members of
this family of proteins such as P-glycoprotein and cystic fibrosis transmembrane conductance regulator share the ability to transport anions, we have investigated the transport capability of ABC1 expressed
in Xenopus oocytes using iodide efflux and voltage-clamp techniques. We report here that ABC1 generates an anion flux sensitive to glibenclamide, sulfobromophthalein, and blockers of anion
transporters. The anion flux generated by ABC1 is up-regulated by
orthovanadate, cAMP, protein kinase A, and okadaic acid. In other ABC
transporters, mutating the conserved lysine in the nucleotide binding
folds was found to severely reduce or abolish hydrolysis of ATP, which in turn altered the activity of the transporter. In ABC1, replacement of the conserved lysine 1892 in the Walker A motif of the second nucleotide binding fold increased the basal ionic flux, did not alter
the pharmacological inhibitory profile, but abolished the response to
orthovanadate and cAMP agonists. Therefore, we conclude that ABC1 is a
cAMP-dependent and sulfonylurea-sensitive anion transporter.
INTRODUCTION ATP binding cassette (ABC)1
transporters are implicated in the vectorial movement of a wide variety
of substrates across biological membranes (1, 2). Most of the mammalian
ABC transporters identified so far have been associated with clinically
relevant phenotypes (2). The human P-glycoprotein confers resistance to
chemotherapeutic drugs on tumor cells (3). Persistent hyperinsulinemic hypoglycemia of infancy is associated with mutation of SUR, the receptor for sulfonylureas (4). Cystic fibrosis is caused by mutations
in the gene encoding the cystic fibrosis transmembrane conductance
regulator (CFTR), a cAMP-dependent chloride channel (5,
6).
The basic structural unit of an ABC transporter consists of a pair of
nucleotide binding folds (NBF) and two transmembrane domains, each
composed as a rule of six transmembrane spanners (1, 2). Their activity
as transporters is dependent on their interaction with ATP at the NBFs
followed by its hydrolysis (see Fig. 1A) (7-16), and in
some cases evidence has been provided for a further regulation via
phosphorylation of serine/threonine residues in the region linking the
two symmetric halves (6, 17-19). The NBF domains contain the highly
conserved phosphate binding loop (20) that forms intimate contacts with
the
We have recently reported on the functional characterization of a novel
ABC transporter, ABC1 (22, 23). This molecule, whose expression during
embryonic development correlates with the occurrence of programmed cell
death, is required by macrophages during engulfment of cells undergoing
apoptosis (23, 24). From a structural standpoint, ABC1 possesses all of
the typical features of ABC transporters, i.e. the two
symmetric halves each equipped with six transmembrane spanners and an
NBF. In addition, a long charged region, reminiscent of the regulatory
domain of CFTR but unique in that it is equipped with an extra
hydrophobic segment, links the two halves of the molecule (23). The
purpose of this work was to analyze the ionic transport capability of ABC1 transporter using radiotracer efflux and electrophysiological techniques.
MATERIALS AND METHODS The ABC1 full-length cDNA was
constructed from the The Lys1892 in
the second ATP cassette of ABC1 was mutated to methionine by polymerase
chain reaction amplification of the wild-type cDNA with a mutated
5 10 µg of linearized DNA template
was transcribed in vitro by Sp6 RNA polymerase following
standard protocols (27) for 1 h at 37 °C. After removal of DNA
template by treatment with DNase I, the capped cRNA was precipitated
and resuspended in diethyl pyrocarbonate-water. The final concentration
was adjusted to 200 ng/µl for ABC1 and K1892M cRNA and to 100 ng/µl
for CFTR cRNA after analysis on formaldehyde-agarose gel.
Stage V Xenopus laevis
oocytes were defolliculated by collagenase and microinjected with 50 nl
of water or aqueous solutions of cRNA encoding ABC1, K1892M, or CFTR.
Oocytes were incubated in modified Barth's saline medium (88 mM NaCl, 1 mM KCl, 0.41 mM
CaCl2, 0.33 mM
Ca(NO3)2, 0.82 mM
MgSO4, 2.4 mM NaHCO3, and 10 mM HEPES, pH 7.4) containing 5 IU/ml
penicillin/streptomycin (Life Technologies, Inc.). The protein
expression was monitored systematically for every batch of injected
oocytes. After overnight metabolic labeling the oocytes were lysed in
0.1 M NaCl, 0.1 M Tris, pH 8.0, 10 mM EDTA, 1% Triton X-100, and 1 mM
phenylmethylsulfonyl fluoride. The proteins of interest were
immunoprecipitated according to the standard protocols (28) and eluted
from protein A- or protein G-Sepharose in 20 µl of sample buffer
(supplemented with 8 M urea) for 2 min at 50 °C. ABC1
and K1892M were immunoprecipitated using Ab16, a rabbit polyclonal
antiserum recognizing the first NBF domain of ABC1 (dilution 1:250)
(23), and CFTR with 1 µg of monoclonal mouse anti-human regulatory
domain-specific antibody (Genzyme, Cambridge, MA) (28).
Groups of five oocytes were incubated for
30 min in a 6.5-mm diameter porous bottom dish
(Transwell®, Costar) in 1 ml of ND96 buffer (96 mM NaCl, 2 mM KCl, 1.8 mM CaCl2, 1 mM MgCl2, and 5 mM HEPES titrated with NaOH to pH 7.4) containing 1 µM KI (1 µCi of Na125I/ml, DuPont) at room
temperature (adapted from Refs. 29 and 30). After the loading period,
the oocytes were sequentially moved at 1-min intervals through a series
of wells containing 1 ml of buffer. 125I released from the
oocytes in each well was measured by radioactivity counting (Compu
Gamma, LKB). The first two wells were used to establish a stable base
line in ND96 buffer (time 0). After eight 1-min washes, the oocytes
were solubilized in 1 M NaOH and the residual iodide
content was measured. The total amount of 125I (800-1200
cpm/oocyte) at time 0 was calculated as the sum of radioactivity
recovered in each 1-min sample plus the residual iodide content. Efflux
curves were constructed by plotting the percentage of total
radioactivity released in the medium versus time. The
percentage of total at 8 min (T8) was used for
further analysis. The appropriate drug or modified ND96 buffers
(Cl Ab16 immunoprecipitates from
samples of 10 unlabeled oocytes were equilibrated in 50 mM
Tris, pH 7.5, 10 mM MgCl2, and 100 mg/ml bovine
serum albumin and then allowed to react in the presence of 50 ng of
catalytic subunit of protein kinase A (Sigma) and 10 µCi of [ N-(2-(p-Bromocinnamylamino)ethyl)-5-isoquinolinesulfonamide
(H89) and okadaic acid were from RBI (Natick, MA), and A27187, forskolin, and cpt-cAMP were from Boehringer Mannheim. The drugs were
dissolved in dimethyl sulfoxide stock solutions and used at a final
dimethyl sulfoxide concentration of 0.1%. All other reagents were from
Sigma.
RESULTS After injection of
cRNA, the synthesis of ABC1 at the predicted size (220 kDa) was
monitored after immunoprecipitation by Ab16 (Fig.
1B, lane 2). The expression of
K1892M, an ABC1 mutant in which the Lys1892 of the Walker A
motif in the second nucleotide binding fold (NBF2) has been replaced by
a methionine, was monitored in the same way (Fig. 1B,
lane 3). No variations with respect to the wild-type protein
were detected either in the temporal onset of protein synthesis or in
the ratio of produced protein to injected cRNA. The expression of CFTR
in oocytes was monitored by immunopurification with a monoclonal mouse
anti-human regulatory domain-specific antibody (Fig. 1B,
lane 5).
Since the
activity of CFTR and P-glycoprotein is associated with chloride
transport (6, 18, 19, 26, 31), we wished to determine the properties of
ABC1 expressed in Xenopus oocytes using the radiotracer
iodide efflux technique. First, we analyzed the activity of two well
characterized Cl The equimolar substitution of extracellular chloride with the
nonpermeant anion gluconate did not affect the amplitude of the
A23187-activated efflux from water-injected oocytes (gluconate + A23187, T8 = 67.4 ± 7%, n = 2; ND96 + A2318, T8 = 68 ± 9%,
n = 4 (not shown)). In contrast, a similar procedure
decreased the magnitude of the efflux from ABC1-injected oocytes
(gluconate, T8 = 34.2 ± 6%,
n = 8 (Fig. 1F)), whereas substitution of
extracellular sodium with lithium had no effect
(T8 = 49.8 ± 5%, n = 5 (Fig. 1F)).
Compared with the basal activity
of ABC1 (Fig. 2B, noted as DMSO,
T8 = 51 ± 4%, n = 5), the
Cl
Since CFTR can be regulated by
cAMP (6, 26, 36), we analyzed the effects of cAMP on ABC1. Fig.
3 shows that cpt-cAMP (500 µM) increased
(p < 0.01) the magnitude of the iodide efflux in ABC1
oocytes (T8 = 63 ± 6%, n = 6; basal T8 = 49 ± 7%). These observations were confirmed using forskolin (T8 = 68 ± 5.7%, 10 µM, n = 2 (Fig.
3B)) or a mixture containing cpt-cAMP (500 µM) and IBMX (1 mM, T8 = 67.5 ± 7%, n = 2 (Fig. 3B)). The protein kinase A
inhibitor H89 (20 µM) decreased (p < 0.01) the basal activity of ABC1 (T8 = 37 ± 3.5%, n = 4 (Fig. 3B)). The protein phosphatase inhibitor okadaic acid (10 µM) slightly
increased (p < 0.05) the ABC1 activity
(T8 = 54 ± 3%, n = 3 (Fig. 3B)). In water-injected oocytes, exposure of cAMP
agonists failed to generate a significant anion transport
(T8 = 22 ± 5%, n = 3 (Fig. 3B)) (see Refs. 26 and 29). The cAMP stimulation may
be due to the direct phosphorylation of ABC1 as shown by in
vitro phosphorylation of immunopurified ABC1 by protein kinase A
(Fig. 3C).
ABC1 in which the Lys1892 in NBF2
has been replaced by a methionine (K1892M mutant) and expressed in
oocytes (see Fig. 1B) generated an iodide efflux that was
increased (T8 = 57 ± 6.7%,
n = 11) compared with wild-type ABC1
(T8 = 49 ± 7%, n = 12, p < 0.01 (see Fig. 3B)). DIDS
(T8 = 27 ± 7%, 500 µM,
n = 4), BSP (T8 = 28 ± 1%, 500 µM, n = 4), and glibenclamide
(T8 = 26 ± 3%, 100 µM,
n = 6) inhibit (p < 0.01) the
transport activity of K1892M (Fig. 4, A-D). Fig. 4B shows that K1892M failed to respond to 500 µM cpt-cAMP (T8 = 55.6 ± 4.6%, n = 8). Whereas the phosphate analog
orthovanadate increased (p < 0.01) the amplitude of
the efflux of wild-type ABC1 (1 mM, n = 6 (Fig. 3B)) to T8 = 63 ± 5.7%
(an effect inhibited by glibenclamide, 100 µM,
n = 2 (Fig. 3B)), the activity of K1892M was
reduced (T8 = 46 ± 3%, n = 11, p < 0.05 (Fig. 4B)).
We then examined the
electrophysiological properties of oocytes expressing ABC1 compared
with water- and CFTR-injected oocytes (Fig. 5). The membrane potential
(Em) was not affected by the expression of the
different transporters (ABC1, Em =
DISCUSSION We report here on the characterization, pharmacological profile,
and regulation of ABC1 as a cAMP-dependent and
glibenclamide-sensitive anion transporter. Among the ABC proteins
involved in anion transport, CFTR is a chloride channel (5, 6, 26, 36)
and the P-glycoprotein regulates an endogenous chloride channel (2, 18,
19, 31). In this paper, we provide evidence that ABC1 shares with CFTR (5, 6, 26, 36) the ability to transport anions and to be up-regulated
by cAMP, IBMX, okadaic acid, and vanadate. However, as opposed to CFTR,
ABC1 behaves as an electroneutral anion exchanger since no significant
chloride current was detected from oocytes expressing ABC1 and the
ABC1-generated anion efflux is dependent on extracellular chloride
concentration. In fact, the substitution of extracellular chloride by
gluconate reduces the efflux from ABC1-injected oocytes as would be
expected from a parallel anion antiport (e.g.
Cl Like CFTR (6, 29, 35), ABC1 is inhibited by glibenclamide, flufenamic
acid, and diphenylamine-2-carboxylic acid. In addition, ABC1 is also
inhibited by the organic anion sulfobromophthalein and by the broad
acting blocker of anion transporters, DIDS.
We provide evidence that activation of protein kinase A increases the
activity of ABC1 and that ABC1 is phosphorylated in vitro by
protein kinase A, which suggests that direct phosphorylation of the
protein might take place in vivo. On the other hand, the activity of ABC1 is unaffected by extracellular Ca2+
concentration or by Ca2+ entry triggered by A23187.
Therefore, ABC1 appears to be up-regulated by
cAMP-dependent protein kinases and by the phosphatase
inhibitors okadaic acid and vanadate. Our observations are in line with
the current opinion that kinases modulate their activities by
phosphorylating specific sites of ABC transporters (6, 17, 19, 36).
In other ABC transporters, mutating the conserved lysine in NBF was
found to severely reduce or abolish hydrolysis of ATP, which in turn
alters the activity of the transporter (1, 2, 14). For example,
mutation of the Lys1250 into the NBF2 of CFTR modifies the
kinetic parameters of the channel activity (14-16). The corresponding
mutation in ABC1 (i.e. K1892M) produces a transporter with
an increased basal ionic flux and a conserved pharmacological
inhibitory profile (i.e. inhibition by glibenclamide, DIDS,
and BSP). In contrast, the K1892M mutant is unaffected by cAMP, and a
reduced efflux is observed after vanadate treatment. A reasonable
interpretation of these results is that vanadate in the wild-type ABC1
primarily impairs the function of NBF2, as is the case in the K1892M
mutant. The reversed effect of vanadate treatment on the mutant might
result from other actions of this compound either at NBF1 and/or as a
phosphatase inhibitor. Similar effects of vanadate on CFTR and its
mutants have been reported and led to a model of the transport cycle in
which hydrolysis at NBF2 plays an inhibitory role (14-16, 36).
The identification of ABC1 as a cAMP-dependent anionic
transporter does not provide any information on the nature of the
transported substrate, nor does it shed light on the role played by
ABC1 during engulfment of apoptotic corpses. Nonetheless, the finding
of an ABC1-dependent anionic flux with a clear-cut
pharmacological profile provides an extremely useful experimental tool.
We can in fact readily investigate how modulations of ABC1 transporter
activity in phagocytic cells, like mouse peritoneal macrophages, affect their responses to specific physiopathological challenges.
FOOTNOTES Acknowledgments We gratefully acknowledge M. Crest, G. Jacquet, and M. F. Luciani for technical assistance, Aldo Cerriotti for
having introduced A. B. to oocyte techniques, J. R. Riordan for the
generous gift of full-length CFTR cDNA, and P. Golstein for
critical reading of the manuscript.
REFERENCES
Volume 272, Number 5,
Issue of January 31, 1997
pp. 2695-2699
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.
,, and
Laboratoire de Neurobiologie Cellulaire,
CNRS, 31 Chemin J. Aiguier, 13402 Marseille Cedex 20, France and
the § Centre d'Immunologie, INSERM-CNRS de
Marseille-Luminy, Parc Scientifique de Luminy, 13288 Marseille Cedex 9, France
- and 
-phosphates of bound ATP (21) and an additional
diagnostic motif, the active transport signature, whose function is so
far unknown.
Fig. 1.
Expression and characterization of ABC1 in
X. laevis oocytes. A, predicted structure of
ABC1 with 12 transmembrane domains, 2 NBFs, and a large internally
located regulatory domain (R domain) split into halves by a
highly hydrophobic segment (HH1). B, specific
expression of wild-type ABC1 (lane 2), K1892M (lane 3), and CFTR (lane 5) after injection of the respective
cRNA or water (lanes 1 and 4) and
immunoprecipitation with Ab16 (lanes 1-3, from samples of 5 oocytes) or anti-CFTR antibody (lanes 4 and 5,
from samples of 35 oocytes). The migration of molecular size markers is
shown. C, iodide efflux from water-injected oocytes bathed
in ND96 medium containing 2 mM Ca2+ in the
absence (water basal) or presence of the calcium ionophore A23187 (10 µM). D, iodide efflux from CFTR
oocytes bathed in ND96 medium with cpt-cAMP (500 µM) + IBMX (1 mM) or without (CFTR basal). E, iodide efflux from water- and ABC1-injected oocytes
bathed in ND96 medium (Ca2+-free). F, iodide
efflux amplitude after 8 min from water- and ABC1-injected oocytes in
ND96 medium (NaCl) or modified ND96 medium (as indicated
under "Materials and Methods"). Bars show means and S.D.
for 4-14 separate experiments.
[View Larger Version of this Image (34K GIF file)]
13C, 10F, and 8a4 overlapping phage
clones (22) using the prokaryotic cloning vector pBluescript
KS+/
(Stratagene). The NgoMI-EcoRI
fragment from the 13C clone, which extends in the 5
region of ABC1
(EMBL accession number X75926[GenBank], nucleotides 1-2567), was juxtaposed to
the EcoRI-HindIII fragment from 10F
(nucleotides 2568-5665) and the HindIII-XbaI
fragment of 8a4 (nucleotides 5666-6916). The final construct,
pABC1KS, was excised by NotI-ApaI in the vector
polylinker and then cloned into the pSP6TN poly(A) vector (pABC1TN)
modified from pSP64T poly(A) (a generous gift of A. Ceriotti, Milano,
Italy) (25) by the insertion of an oligonucleotide linker
(GATCTGGGCCCACTCGAGTTAACGCGGCCGCA) conferring ApaI,
XhoI, HpaI, and NotI as additional
unique sites. The CFTR cDNA construct pACF23 was provided by J. R. Riordan, Scottsdale, AZ, (26).
primer spanning nucleotides 5854-5874 and a vector-specific 3
primer downstream from the multiple cloning sites linker of pSP64TN
poly(A). The 5 sense primer whose sequence is
GGAGCTGGGATGTCA includes the AAG (lysine)
to ATG (methionine) single mutation (in bold) and the wild-type
HpaI restriction site (underlined). The final construct,
K1892M, was obtained after insertion into pABC1TN of the amplification
product digested by HpaI-ApaI and verified by
sequencing.
-free ND96 medium, all external Cl was
replaced by gluconate; Na+-free ND96 medium, 96 mM NaCl was replaced by 96 mM LiCl) was applied
after the stable base line in ND96 buffer was obtained. Oocyte ion
conductance was measured by conventional two-electrode voltage clamp
(26) and bathed in ND96 medium. Data are presented as the mean ± S.D. of n observations. Statistical significance was
assessed at the 95% confidence level with Student's t
test.
-32P]ATP for 1 h at 30 °C. The
reaction was stopped by the addition of sample buffer. The patterns of
phosphorylation in oocytes injected either with ABC1 or water were
analyzed by SDS-polyacrylamide gel electrophoresis on 7.5%
polyacrylamide gels and autoradiography.
channels in Xenopus oocytes.
The endogenous Ca2+-dependent Cl
channel can be activated by promoting Ca2+ influx using
A23187 (29, 32) as shown in Fig. 1C. Indeed, the presence of
10 µM A23187 in the buffer increased (
3-fold) the
iodide efflux in water-injected oocytes (efflux at 8 min, T8 = 68 ± 9%, n = 4)
compared with basal oocytes (T8 = 21 ± 5%, p < 0.01, n = 4). After
expression in Xenopus oocytes, CFTR generates a
cAMP-dependent chloride current (26, 29). In our
experiments the iodide efflux in CFTR-expressing oocytes was increased
(p < 0.01) upon addition of cAMP agonists (Fig.
1D, CFTR basal (T8 = 31 ± 5%, n = 5) and CFTR + cAMP
(T8 = 53 ± 11%, n = 5)).
Having determined that our technique offers a convenient way to
evaluate the activity of both endogenous and expressed chloride
channels in oocytes, we then investigated whether an iodide efflux is
detectable in ABC1-injected oocytes. Fig. 1, E and
F, shows that the expression of ABC1 in oocytes is
associated with an increase (p < 0.01) of the iodide
efflux amplitude (T8 = 49 ± 7%,
n = 12) greater than that seen in water-injected
oocytes (T8 = 19 ± 7.5%,
n = 14) in Ca2+-free ND96 medium. Similar
results were obtained in ND96 medium containing 2 mM
Ca2+ (ABC1, T8 = 50 ± 3%,
n = 7; water, T8 = 20 ± 6%, n = 9, p < 0.01). The amplitude
of the iodide efflux appeared to be directly dependent on the amount of
injected ABC1 mRNA because 10-fold less mRNA led to a reduced
efflux (T8 = 36 ± 7%, n = 6).
channel blockers DIDS (500 µM,
n = 6 (Fig. 2A)), diphenylamine-2-carboxylic acid (500 µM, n = 3), and flufenamic acid
(500 µM, n = 4) blocked 50-80%
(p < 0.01) of the iodide efflux generated by the
expression of ABC1 (Fig. 2B) (T8 = 22.4 ± 4, 29 ± 1, and 33 ± 8%, respectively). ABC1
activity was also sensitive to bumetanide (T8 = 42 ± 6%, 200 µM, n = 3, p < 0.05) and furosemide (T8 = 33 ± 7%, 200 µM, n = 3, p < 0.01 (Fig. 2B)). The prostaglandin
transporter (33) inhibitor sulfobromophthalein (BSP) (500 µM, n = 8) inhibited 80% of the ABC1
activity (T8 = 24 ± 6%, p < 0.01 (Fig. 2, A and B)). The sulfonylurea
compound glibenclamide (100 µM), which is an inhibitor of
the activity of KATP (34) and CFTR (35) channels, almost completely
blocked the activity of ABC1 (T8 = 21 ± 7%, n = 6, p < 0.01 (Fig. 2,
A and B)) and CFTR (CFTR + cAMP,
T8 = 53 ± 11%, n = 5;
CFTR + cAMP + glibenclamide, T8 = 31 ± 5%, n = 4, p < 0.01) in oocytes.
Verapamil (T8 = 49 ± 9%, 200 µM, n = 3), a P-glycoprotein inhibitor
(31), and the potassium channel inhibitor tetraethylammonium (10 mM, T8 = 53 ± 5%,
n = 2) had no significant effect on the ABC1 activity
(Fig. 2B).
Fig. 2.
Pharmacological inhibitory profile of ABC1 in
X. laevis oocytes. A, inhibitions by DIDS (500 µM), BSP (500 µM), and glibenclamide
(glib., 100 µM) of the iodide efflux.
B, effects of 10 mM tetraethylammonium, 200 µM bumetanide, 200 µM furosemide, 500 µM flufenamic acid, 500 µM diphenylamine
2-carboxylic acid, 500 µM DIDS, 500 µM BSP,
100 µM glibenclamide, and 0.1% dimethyl sulfoxide as
vehicle in ND96 medium. Bars show mean percentages of
inhibition and S.D. for 3-6 separate experiments.
[View Larger Version of this Image (20K GIF file)]
Fig. 3.
Regulation of ABC1 activity by orthovanadate
and cAMP in X. laevis oocytes. A, activation of
ABC1 by cpt-cAMP (500 µM) + IBMX (1 mM)
(ABC1 + cAMP) in oocytes bathed in ND96 medium. B, effects of forskolin (10 µM), cpt-cAMP (500 µM) alone or associated with IBMX (1 mM), H89
(20 µM), okadaic acid (10 µM), and
orthovanadate (1 mM) alone or with glibenclamide (100 µM). Bars show means and S.D. of iodide efflux
after 8 min for 3-6 separate experiments. C, incorporation
of [32P]phosphate into ABC1 after immunoprecipitation
with Ab16 in the absence (lane 1) or presence (lane
2) of protein kinase A.
[View Larger Version of this Image (27K GIF file)]
Fig. 4.
Effect of the Walker A motif lysine mutation
K1892M on the transport activity of ABC1 after expression in X. laevis. A, iodide efflux from water-, ABC1-, and
K1892M-injected oocytes bathed in ND96 medium. B, iodide
efflux from K1892M oocytes in ND96 medium in the absence
(basal) and presence of cpt-cAMP (500 µM) + IBMX (1 mM) (cAMP) and orthovanadate (1 mM). Bars show means and S.D. for 8-11 separate
experiments. C, inhibition of the iodide efflux by BSP (500 µM) from K1892M oocytes. D, inhibition of the iodide efflux by BSP (500 µM), DIDS (500 µM), and glibenclamide (100 µM) from K1892M
oocytes. Bars show means and S.D. for 4-6 separate
experiments.
[View Larger Version of this Image (30K GIF file)]
42 ± 5 mV, n = 13; CFTR, Em = 45 ± 5 mV, n = 5; water, Em = 43 ± 6 mV, n = 10). The holding current
was similar in water (13 ± 3.4 nA, n = 7) and
ABC1 (14 ± 4 nA, n = 12) oocytes voltage
clamped at 60 mV and bathed in ND96 medium. The
Ca2+-activated Cl channel activity induced by
A23187 (10 µM, 126 ± 48 nA at 60 mV,
p < 0.01, n = 5) and inhibited by DIDS
(500 µM, 30 ± 8 nA at 60 mV, n = 3) was not affected by the presence of ABC1 (A23187, 114 ± 50 nA at 60 mV, n = 6; A23187 + DIDS, 18 ± 4 nA
at 60 mV, n = 3 (Fig. 5A)). When cpt-cAMP
(500 µM), IBMX (1 mM), or forskolin (10 µM) was added to the perfusion medium, no modification of
the holding current was observed in the presence of ABC1 (15 ± 4 nA, n = 14) or in its absence (14.5 ± 6 nA,
n = 20). In contrast, and as already reported (26, 29),
CFTR generated a cAMP-dependent current (n = 10 (Fig. 5B)) inhibited by glibenclamide (100 µM, n = 4 (not shown)). Like wild-type
ABC1, K1892M also failed to generate a current either under resting
conditions or in the presence of cAMP agonists (data not shown).
Fig. 5.
Electrophysiological recordings from oocytes
injected with water and cRNA for wild-type ABC1 and CFTR. A,
histograms of holding inward current from water- and ABC1-injected
oocytes voltage clamped at a holding potential of 60 mV. The current was recorded in the following conditions: basal, A23187 (10 µM), A23187 (10 µM) + DIDS (500 µM), and cpt-cAMP (500 µM) + IBMX (1 mM) (cAMP) superfused in ND96 medium.
Bars show means and S.D. of 3-14 experiments. B,
family of currents from water-, ABC1-, and CFTR-injected oocytes.
Voltage steps (400 ms) were made from 80 to +30 mV in 20-mV
increments. ND96 medium was superfused in the absence
(basal) or presence of cpt-cAMP (500 µM) + IBMX (1 mM) (cAMP). No cAMP-activated
conductance was present in water- and ABC1-injected oocytes.
[View Larger Version of this Image (16K GIF file)]
/HCO3 exchanger) (37,
38), whereas in similar conditions the activity of the
A23187-stimulated efflux through the
Ca2+-dependent Cl channel is not
affected.
¶
To whom correspondence should be addressed. Tel.:
33-4-91-26-94-04; Fax: 33-4-91-26-94-30; E-mail:
chimini{at}ciml.univ-mrs.fr.
1
The abbreviations used are: ABC, ATP binding
cassette; CFTR, cystic fibrosis transmembrane conductance regulator;
NBF, nucleotide binding fold; H89,
N-(2-(p-bromocinnamylamino)ethyl)-5-isoquinolinesulfonamide; cpt-cAMP, 8-(4-chlorphenylthio)-adenosine 3,5-cyclic monophosphate; IBMX, 3-isobutyl-1-methylxanthine; BSP, sulfobromophthalein; DIDS, 4,4-diisothiocyanostilbene-2,2-disulfonic acid.
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
ABSTRACTThis article has been cited by other articles:
|
|
 |
|
  J. Wang, Z.-R. Zhang, C.-F. Chou, Y.-Y. Liang, Y. Gu, and H.-P. Ma Cyclosporine stimulates the renal epithelial sodium channel by elevating cholesterol Am J Physiol Renal Physiol, February 1, 2009; 296(2): F284 - F290. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. R. J. Taylor, M. Gonzalez-Begne, S. Dewhurst, G. Chimini, C. F. Higgins, J. E. Melvin, and J. I. Elliott Sequential Shrinkage and Swelling Underlie P2X7-Stimulated Lymphocyte Phosphatidylserine Exposure and Death J. Immunol., January 1, 2008; 180(1): 300 - 308. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Naschberger, C. Lubeseder-Martellato, N. Meyer, R. Gessner, E. Kremmer, A. Gessner, and M. Sturzl Human Guanylate Binding Protein-1 Is a Secreted GTPase Present in Increased Concentrations in the Cerebrospinal Fluid of Patients with Bacterial Meningitis Am. J. Pathol., September 1, 2006; 169(3): 1088 - 1099. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. G. Deeley, C. Westlake, and S. P. C. Cole Transmembrane Transport of Endo- and Xenobiotics by Mammalian ATP-Binding Cassette Multidrug Resistance Proteins. Physiol Rev, July 1, 2006; 86(3): 849 - 899. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Omer, D. Meredith, J. F. Morris, and H. C. Christian Evidence for the Role of Adenosine 5'-Triphosphate-Binding Cassette (ABC)-A1 in the Externalization of Annexin 1 from Pituitary Folliculostellate Cells and ABCA1-Transfected Cell Models Endocrinology, July 1, 2006; 147(7): 3219 - 3227. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Kobayashi, T. Nishi, T. Hirata, A. Kihara, T. Sano, Y. Igarashi, and A. Yamaguchi Sphingosine 1-phosphate is released from the cytosol of rat platelets in a carrier-mediated manner J. Lipid Res., March 1, 2006; 47(3): 614 - 621. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Martin, O. Sabido, P. Durand, and R. Levy Phosphatidylserine externalization in human sperm induced by calcium ionophore A23187: relationship with apoptosis, membrane scrambling and the acrosome reaction Hum. Reprod., December 1, 2005; 20(12): 3459 - 3468. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. A. Chirinos, J. P. Zambrano, S. Chakko, A. Schob, R. B. Goldberg, G. Perez, and A. J. Mendez Ability of Serum to Decrease Cellular AcylCoA:Cholesterol Acyl Transferase Activity Predicts Cardiovascular Outcomes Circulation, October 18, 2005; 112(16): 2446 - 2453. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Qian, S. Morley, K. Wilson, P. Nava, J. Atkinson, and D. Manor Intracellular trafficking of vitamin E in hepatocytes: the role of tocopherol transfer protein J. Lipid Res., October 1, 2005; 46(10): 2072 - 2082. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. S. Kiss, J. Maric, and Y. L. Marcel Lipid efflux in human and mouse macrophagic cells: evidence for differential regulation of phospholipid and cholesterol efflux J. Lipid Res., September 1, 2005; 46(9): 1877 - 1887. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Denis, B. Haidar, M. Marcil, M. Bouvier, L. Krimbou, and J. Genest Characterization of Oligomeric Human ATP Binding Cassette Transporter A1: POTENTIAL IMPLICATIONS FOR DETERMINING THE STRUCTURE OF NASCENT HIGH DENSITY LIPOPROTEIN PARTICLES J. Biol. Chem., October 1, 2004; 279(40): 41529 - 41536. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-R. Nofer, G. Herminghaus, M. Brodde, E. Morgenstern, S. Rust, T. Engel, U. Seedorf, G. Assmann, H. Bluethmann, and B. E. Kehrel Impaired Platelet Activation in Familial High Density Lipoprotein Deficiency (Tangier Disease) J. Biol. Chem., August 6, 2004; 279(32): 34032 - 34037. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. J. F. Nieland, A. Chroni, M. L. Fitzgerald, Z. Maliga, V. I. Zannis, T. Kirchhausen, and M. Krieger Cross-inhibition of SR-BI- and ABCA1-mediated cholesterol transport by the small molecules BLT-4 and glyburide J. Lipid Res., July 1, 2004; 45(7): 1256 - 1265. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Kockx, K.-A. Rye, K. Gaus, C. M. Quinn, J. Wright, T. Sloane, D. Sviridov, Y. Fu, D. Sullivan, J. R. Burnett, et al. Apolipoprotein A-I-stimulated Apolipoprotein E Secretion from Human Macrophages Is Independent of Cholesterol Efflux J. Biol. Chem., June 18, 2004; 279(25): 25966 - 25977. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Haidar, M. Denis, M. Marcil, L. Krimbou, and J. Genest Jr. Apolipoprotein A-I Activates Cellular cAMP Signaling through the ABCA1 Transporter J. Biol. Chem., March 12, 2004; 279(11): 9963 - 9969. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Abe-Dohmae, Y. Ikeda, M. Matsuo, M. Hayashi, K.-i. Okuhira, K. Ueda, and S. Yokoyama Human ABCA7 Supports Apolipoprotein-mediated Release of Cellular Cholesterol and Phospholipid to Generate High Density Lipoprotein J. Biol. Chem., January 2, 2004; 279(1): 604 - 611. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. S. Kiss, D. C. McManus, V. Franklin, W. L. Tan, A. McKenzie, G. Chimini, and Y. L. Marcel The Lipidation by Hepatocytes of Human Apolipoprotein A-I Occurs by Both ABCA1-dependent and -independent Pathways J. Biol. Chem., March 14, 2003; 278(12): 10119 - 10127. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. P. Chapman, M. J. Epton, J. C. Buckingham, J. F. Morris, and H. C. Christian Evidence for a Role of the Adenosine 5'-Triphosphate-Binding Cassette Transporter A1 in the Externalization of Annexin I from Pituitary Folliculo-Stellate Cells Endocrinology, March 1, 2003; 144(3): 1062 - 1073. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. MASMOUDI, P. GANDOLFO, J. LEPRINCE, D. VAUDRY, A. FOURNIER, C. PATTE-MENSAH, H. VAUDRY, and M.-C. TONON Pituitary adenylate cyclase-activating polypeptide (PACAP) stimulates endozepine release from cultured rat astrocytes via a PKA-dependent mechanism FASEB J, January 1, 2003; 17(1): 17 - 27. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. T. Reddy, S. Hama, C. Ng, V. Grijalva, M. Navab, and A. M. Fogelman ATP-Binding Cassette Transporter 1 Participates in LDL Oxidation by Artery Wall Cells Arterioscler. Thromb. Vasc. Biol., November 1, 2002; 22(11): 1877 - 1883. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. H. See, R. A. Caday-Malcolm, R. R. Singaraja, S. Zhou, A. Silverston, M. T. Huber, J. Moran, E. R. James, R. Janoo, J. M. Savill, et al. Protein Kinase A Site-specific Phosphorylation Regulates ATP-binding Cassette A1 (ABCA1)-mediated Phospholipid Efflux J. Biol. Chem., October 25, 2002; 277(44): 41835 - 41842. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. W. Burgess, R. S. Kiss, H. Zheng, S. Zachariah, and Y. L. Marcel Trypsin-sensitive and Lipid-containing Sites of the Macrophage Extracellular Matrix Bind Apolipoprotein A-I and Participate in ABCA1-dependent Cholesterol Efflux J. Biol. Chem., August 23, 2002; 277(35): 31318 - 31326. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Murthy, E. Born, S. N. Mathur, and F. J. Field LXR/RXR activation enhances basolateral efflux of cholesterol in CaCo-2 cells J. Lipid Res., July 1, 2002; 43(7): 1054 - 1064. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Cherel, E. Michard, N. Platet, K. Mouline, C. Alcon, H. Sentenac, and J.-B. Thibaud Physical and Functional Interaction of the Arabidopsis K+ Channel AKT2 and Phosphatase AtPP2CA PLANT CELL, May 1, 2002; 14(5): 1133 - 1146. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Hasko, E. A. Deitch, Z. H. Nemeth, D. G. Kuhel, and C. Szabo Inhibitors of ATP-Binding Cassette Transporters Suppress Interleukin-12 p40 Production and Major Histocompatibility Complex II Up-Regulation in Macrophages J. Pharmacol. Exp. Ther., April 1, 2002; 301(1): 103 - 110. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. J. Aiello, D. Brees, P.-A. Bourassa, L. Royer, S. Lindsey, T. Coskran, M. Haghpassand, and O. L. Francone Increased Atherosclerosis in Hyperlipidemic Mice With Inactivation of ABCA1 in Macrophages Arterioscler. Thromb. Vasc. Biol., April 1, 2002; 22(4): 630 - 637. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Zha, J. Genest Jr., and R. McPherson Endocytosis Is Enhanced in Tangier Fibroblasts. POSSIBLE ROLE OF ATP-BINDING CASSETTE PROTEIN A1 IN ENDOSOMAL VESICULAR TRANSPORT J. Biol. Chem., October 12, 2001; 276(42): 39476 - 39483. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. VON ECKARDSTEIN, C. LANGER, T. ENGEL, I. SCHAUKAL, A. CIGNARELLA, J. REINHARDT, S. LORKOWSKI, Z. LI, X. ZHOU, P. CULLEN, et al. ATP binding cassette transporter ABCA1 modulates the secretion of apolipoprotein E from human monocyte-derived macrophages FASEB J, July 1, 2001; 15(9): 1555 - 1561. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. von Eckardstein, J.-R. Nofer, and G. Assmann High Density Lipoproteins and Arteriosclerosis : Role of Cholesterol Efflux and Reverse Cholesterol Transport Arterioscler. Thromb. Vasc. Biol., January 1, 2001; 21(1): 13 - 27. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. R. Tall and C. W. Schindler A, B, C...{gamma}! Arterioscler. Thromb. Vasc. Biol., June 1, 2000; 20(6): 1423 - 1424. [Full Text] [PDF]
|
|
|
|
 |
|
 J. McNeish, R. J. Aiello, D. Guyot, T. Turi, C. Gabel, C. Aldinger, K. L. Hoppe, M. L. Roach, L. J. Royer, J. de Wet, et al. High density lipoprotein deficiency and foam cell accumulation in mice with targeted disruption of ATP-binding cassette transporter-1 PNAS, April 11, 2000; 97(8): 4245 - 4250. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. W. Freeman Effluxed lipids: Tangier Island's latest export PNAS, September 28, 1999; 96(20): 10950 - 10952. [Full Text] [PDF]
|
|
|
|
 |
|
 C. Andrei, C. Dazzi, L. Lotti, M. R. Torrisi, G. Chimini, and A. Rubartelli The Secretory Route of the Leaderless Protein Interleukin 1beta Involves Exocytosis of Endolysosome-related Vesicles Mol. Biol. Cell, May 1, 1999; 10(5): 1463 - 1475. [Abstract] [Full Text]
|
|
|
|
 |
|
 Y. Hamon, M.-F. Luciani, F. Becq, B. Verrier, A. Rubartelli, and G. Chimini Interleukin-1beta Secretion Is Impaired by Inhibitors of the Atp Binding Cassette Transporter, ABC1 Blood, October 15, 1997; 90(8): 2911 - 2915. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. V. Wu, N. S. Joo, M. E. Krouse, and J. J. Wine Cystic Fibrosis Transmembrane Conductance Regulator Gating Requires Cytosolic Electrolytes J. Biol. Chem., February 23, 2001; 276(9): 6473 - 6478. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Chambenoit, Y. Hamon, D. Marguet, H. Rigneault, M. Rosseneu, and G. Chimini Specific Docking of Apolipoprotein A-I at the Cell Surface Requires a Functional ABCA1 Transporter J. Biol. Chem., March 23, 2001; 276(13): 9955 - 9960. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Toure, L. Morin, C. Pineau, F. Becq, O. Dorseuil, and G. Gacon Tat1, a Novel Sulfate Transporter Specifically Expressed in Human Male Germ Cells and Potentially Linked to RhoGTPase Signaling J. Biol. Chem., June 1, 2001; 276(23): 20309 - 20315. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Wang, D. L. Silver, C. Thiele, and A. R. Tall ATP-binding Cassette Transporter A1 (ABCA1) Functions as a Cholesterol Efflux Regulatory Protein J. Biol. Chem., June 22, 2001; 276(26): 23742 - 23747. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. J. Aiello, D. Brees, P.-A. Bourassa, L. Royer, S. Lindsey, T. Coskran, M. Haghpassand, and O. L. Francone Increased Atherosclerosis in Hyperlipidemic Mice With Inactivation of ABCA1 in Macrophages Arterioscler. Thromb. Vasc. Biol., April 1, 2002; 22(4): 630 - 637. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |