| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Volume 272, Number 51, Issue of December 19, 1997 pp. 31949-31952
(Received for publication, October 6, 1997)
,From the Department of CNS/CV Biological Research, Schering-Plough Research Institute, Kenilworth, New Jersey 07033
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
ABSTRACT 
Galanin, a 29-30 amino acid neuropeptide, is found in the central and peripheral nervous systems and displays several important physiological activities. The actions are believed to be mediated through distinct G protein-coupled receptors. To date, two galanin receptor subtypes have been cloned. In this report, we describe the cloning and expression of a cDNA encoding a novel galanin receptor (GalR3). The receptor has 370 amino acids and shares 36 and 54% homology with the rat GalR1 and GalR2 receptors. 125I-Porcine galanin binds the rat GalR3 receptor expressed in COS-7 cells with high affinity (Kd = 0.6 nM) and could be displaced by galanin and galanin fragments and galanin-chimeric peptides. The pharmacological profile of this novel receptor is distinct from those of GalR1 and GalR2, revealing different pharmacophores within galanin for the three galanin receptor subtypes. Northern blot analysis showed expression in heart, spleen, and testis. Unlike GalR1 and GalR2, no expression of GalR3 was detectable in the brain, suggesting that GalR3 may mediate some of the peripheral functions of galanin.
INTRODUCTION
Galanin is a 29-30 amino acid neuropeptide with no significant homology to any known family of biologically active peptides (1). Galanin is widely distributed in the central and peripheral nervous systems and is highly expressed in various regions of the brain. Many physiological processes are modulated by galanin, including neurotransmitter and hormone release (2), spinal reflexes, nociception (3), firing of noradrenergic neurons, and contraction of gastrointestinal smooth muscle (4, 5). Like neuropeptide Y, centrally administered galanin potently stimulates food intake in animals (6), suggesting a role for galanin in control of body weight.
A large body of evidence suggests that galanin mediates the various physiological functions through interaction with distinct receptor subtypes. Pharmacological studies with several peptidic agonists and antagonists of galanin receptor suggest the existence of multiple receptor subtypes (7-9). The first of these receptors (GalR1) has been cloned from several species (10-13). More recently, a second galanin receptor subtype (GalR2) was cloned. GalR2 is markedly dissimilar to the GalR1 receptor, sharing only 40% sequence homology (14, 15). Hydropathy analysis suggests that both GalR1 and GalR2 receptors have seven hydrophobic transmembrane domains, typical of members of the G protein-coupled receptor superfamily (16). The GalR2 receptor is distinguished pharmacologically from the GalR1 receptor by its high affinity for ligand galanin-(2-29). In addition to the pharmacological differences, the GalR2 transcript is widely distributed in both central and peripheral tissues (14, 15), whereas the expression of GalR1 is more restricted to brain and spinal cord (12, 13).
Given that a large number of physiological actions are modulated by galanin, it is unlikely that the two cloned galanin receptors mediate all the functions of galanin. A complete understanding of the roles of galanin requires identification and characterization of all the galanin receptor subtypes. In this report, we describe the cloning of a novel rat galanin receptor subtype by polymerase chain reaction (PCR),1 sib selection and rapid amplification of cDNA ends (RACE). The receptor shares highest homology with GalR1 and GalR2 and is capable of binding galanin and galanin analogs. We thus designate this new receptor as the GalR3 galanin receptor.
MATERIALS AND METHODS
125I-Porcine galanin (2200 Ci/mmol) and
[
-32P]dATP (5000 Ci/mmol) were purchased from NEN Life
Science Products. LipofectAMINE transfection agent and
oligonucleotides used in this study were purchased or
custom-synthesized by Life Technologies, Inc. and the sequences of the
primers are: oligo93C, gctggcagtgctcctgcagcctggc; oligo120B,
aagcggccgtaccagaagcacaggatg; oligo164, ccaagtgcctggcaggagccaagcag; oligo167, gcgggttaaggcangagttggcgtaggc; oligo172,
tgcgggccccagcagagcgcgtagag, oligo177, catccagtgtgtagatggctgcct;
oligo184, cgcgtagagcgcggccactgccagcatg; and oligo185,
caagggctgaatcaanaagctccagc. Rat multiple tissue Northern blots were
obtained from CLONTECH. Rat galanin, rat
galanin-(1-16), M40, C7, preprogalanin-(1-30), and galantide (M15)
were purchased from Peninsula Laboratories (Belmont, CA). Rat
galanin-(2-29), rat galanin-(1-19), rat galanin-(10-29), and rat
galanin-(3-29) were custom-synthesized by Bio-synthesis, Inc.
(Lewisville, TX). Galanin-(1-13)-bradykinin-(2-9) (M35), DAGO,
somatostatin, and galanin messenger-associated peptides GMAP-(1-41)
and GMAP-(44-59) were from Sigma.
[Ala6,D-Trp8]galanin-(1-15)-ol
and [D-trp6,D-trp8,9]galanin-(1-15)-ol were custom-synthesized by AnaSpec, Inc. (San Jose, CA).
PCR with galanin receptor-specific primers was used to screen pools of a rat hypothalamus cDNA library. Positive pools so identified were subdivided and screened further by the PCR screening until the final round of screening, at which time individual colonies were selected by analysis of plasmid mini-preps. The rat cDNA library was constructed as described previously (15).
PCR and RACE Amplification of cDNA FragmentUnless otherwise specified, PCR was performed using KlenTaq polymerase, which possesses proof reading activity (CLONTECH) and a cycling profile of 94 °C for 1 min, 65 °C for 1 min, and 72 °C for 2 min (40 cycles). Approximately 1 µl of overnight Escherichia coli culture was used in the PCR for sib selection. For RACE, nested primers specific to rat GalR3 cDNA and nested adaptor primers were used in the primary and secondary PCRs. A thermal cycling profile of 94 °C for 30 s, 65 °C for 30 s, and 72 °C for 90 s (25 cycles) and rat brain cDNA as a template were used in primary PCR. A cycling profile of 94 °C for 1 min and 70 °C for 4 min (30 cycles) and 5 µl of the primary PCR product (diluted 1:50) as a template were used in the secondary PCR. The RACE product was cloned into vector pCR 2.1. A GC melt reagent (CLONTECH) at 10-20% (v/v) of original stock (5 M) was always used in both PCR and RACE reactions.
DNA Sequencing and AnalysisThe DNA sequences of clones were determined on both strands using Applied Biosystems Prism dye termination DNA sequencing reagents and an Applied Biosystems 373 automated sequencing apparatus (Perkin-Elmer). DNA and protein sequence comparisons were performed with the DNA* software (DNAstar Inc., Madison, WI).
Transfection of COS-7 CellsRat GalR3 cDNA was introduced into COS-7 cells by electroporation as described previously (15) or by the use of LipofectAMINE method (Life Technologies, Inc.) according to the manufacturer's instructions. The two methods gave comparable levels of expression.
Receptor Membrane PreparationThree days following the transfection of the COS-7 cells, receptor membrane was prepared as previously described (15).
125I-Galanin Binding AssayBinding of 125I-porcine galanin to the membrane preparations was performed as previously described (15) except that 20 µg of membrane protein was used in the saturation and competition binding assays. All data were analyzed by nonlinear regression (Prism, GraphPad, San Diego, CA) and the Ki calculated according to the method of Cheng and Prusoff (17).
Northern Blot Analysis of Rat GalR3A rat multitissue
Northern blot (CLONTECH) was hybridized for 15 h at 55 °C in an ExpressHyb solution (CLONTECH)
using 32P-labeled rat GalR3 cDNA as a probe (labeled
with a random priming kit, Life Technologies, Inc., specific
activity = 3 × 109 cpm/µg). After
hybridization, the blot was washed with wash solution I (2 × SSC,
0.05% SDS) for 30 min at room temperature then with wash solution II
(0.1 × SSC, 0.1% SDS) for 30 min at room temperature, 1 h
at 48 °C, 1 h at 52 °C, and 30 min at 54 °C. The blot was then wrapped with Saran Wrap and exposed to Kodak BioMax films at
80 °C for 1 week. The same blot was stripped and hybridized in a
similar manner with a 32P-labeled actin cDNA to ensure
loading of poly(A)+ mRNA from the tissues onto the
blot.
RESULTS AND DISCUSSION
BLAST search (18) of the GenBankTM data base with the human GalR1 receptor amino acid sequence (10) as query identified a portion of a human genomic clone (accession number Z82241) that possessed high homology with the amino acids 37-132 of human GalR1 (third reading frame of the positive strand, 55% identity). The homology was greater than that between rGalR1 and rGalR2 (40%), suggesting that this human clone may contain a portion of a new galanin receptor.
Several pairs of PCR primers were generated according to the
human genomic sequence and used in PCR with cDNA reverse-translated from rat liver RNA as a template to obtain rat GalR3 cDNA (Fig. 1A). A PCR cycling paradigm
employing low annealing temperature with two PCR primers,
oligonucleotide 93C and oligonucleotide 120B, produced a PCR product.
The approximately 700-base pair fragment was cloned into vector pcR3.1
and sequenced. Comparison of the DNA sequence with the nucleotide
sequences in GenBankTM revealed 86, 65, and 63% identities with the
human genomic clone (Z82241), rat GalR2, and human GalR1,
respectively. Therefore, the rat clone appeared to be a portion of a
novel rat galanin receptor (Fig. 1A).
Molecular cloning of a rat GalR3 cDNA. A, isolation of the rat GalR3 cDNA. Four clones obtained in the four-step cloning are shown on the left. The long boxes indicate the clones obtained at each step by PCR, RACE, or by PCR-based sib selection. Pairs of primers used in the cloning steps are shown on the top (forward primer) and bottom (reverse primer) of each clone accompanied by their names. The lengths and relative positions of the clones are shown approximately to scale. "ATG" and "TAA" indicate the initiation and termination sites for the translation of the receptor. Cycling profile of 95 °C for 0.5 min, 55 °C for 0.5 min, and 72 °C for 1 min (40 cycles) was used to obtain the 0.7-kb PCR product and standard cycling was used in other PCRs (see "Materials and Methods"). B, nucleotide sequence and the deduced amino acid sequence of the rat GalR3 receptor (GenBankTM accession number AF031522). The seven putative TMs are underlined. C, alignment of the amino acid sequence of rat GalR3 receptor with rat GalR1 and GalR2 (11, 15). *, potential N-linked glycosylation site; #, two Cys residues that may form a disulfide bond. Gaps (-) are introduced to optimize the alignment. Conserved amino acid residues are shaded. The seven TMs are underlined.
[View Larger Version of this Image (45K GIF file)]
RACE and PCR sib selection were performed to extend the cDNA
sequence toward the 5
and 3 directions. In RACE, primers oligo172 and
AP1 (outer adaptor primer) were used in the primary PCR with a rat
brain cDNA library as a template and primers oligo177 and AP2
(inner adaptor primer) were used in the secondary PCR with product of
the primary PCR as a template. The final RACE product, ~1.8-kb,
overlapped with the 5 portion of the rat 0.7-kb GalR3 cDNA and the
upstream 5-untranslated region (Fig. 1A). For PCR sib
selection, two primers, oligo164 and oligo167, were used to screen a
cDNA library constructed from rat hypothalamus (15). Pool A28 gave
a positive band and was subdivided and screened until a single clone
(clone A28-1, 1.3 kb) was obtained (Fig. 1A).
A full-length clone of GalR3 cDNA was obtained by performing
further sib selection on the hypothalamus cDNA library using primer
oligo185, designed based on the sequence of the 5-RACE product, and
primer oligo184, designed based on the sequence of clone A28-1. A
single clone A5-3, selected from library pool A5, was obtained and
sequenced. The clone was 2.2 kb long and contained all the sequence of
clone A28-1 and a portion of the 5-RACE product (Fig. 1A).
A complete open reading frame was identified corresponding to a protein
of 370 amino acids with a calculated molecular mass of 40.3 kDa (Fig.
1B). The clone was termed GalR3 receptor. Hydrophathy analysis revealed seven putative transmembrane-spanning domains (TMs)
typical of G protein-coupled receptors. The GalR3 receptor also
contains a single potential N-linked glycosylation site in the N-terminal region, two Cys residues in the first and second extracellular loops that form a putative disulfide bond in these receptors, and two Cys residues in the C-terminal region that may
be involved in palmitoylation (Fig. 1C).
The amino acid sequence of the rat GalR3 receptor is significantly different from those of rat GalR1 and GalR2. The overall homology is 36% to rat GalR1 and 54% to rat GalR2 as analyzed by the Jutun Hein method (19) (Fig. 1C). A search of the SwissProt data bank revealed that rat GalR3 has high homology to the rat somatostatin type 4 receptor (31%) (20) and the rat µ-type opioid receptor (27%) (21). Sequence alignment of rGalR3 with rGalR1 shows the greatest similarity in TM2, TM7, and TM1, being 62, 46, and 46% identical, respectively. Alignment with rGalR2 displayed a generally higher homology in the TMs than rGalR1, with the highest in TM2, TM3, and TM4, being 92, 83, and 71% identical, respectively. The N terminus and the C terminus possess least homology with both rGalR1 and rGalR2 receptors (Fig. 1C).
Northern blot analysis was performed to examine the tissue distribution
of GalR3 mRNA. A single band of ~3.5 and ~3 kb was detected in
heart and testis, respectively (Fig. 2).
There was a strong, broad band at higher molecular weight (5-8 kb) in
spleen and testis, indicating a heterogeneous population of the
transcript in these tissues. There was no significant expression in
kidney, skeletal muscle, liver, brain, or lung. The low abundance of
GalR3 in the brain is contrasted to the distribution of GalR1, which is
significantly expressed only in brain and spinal cord (12, 13), and to
that of GalR2, which is expressed in both central and peripheral
tissues (14, 15). Given that the GalR3 cDNA was cloned from a
hypothalamus library, it seems likely that there is a low level
of expression of GalR3 in this part of the brain. The overall
expression pattern of GalR3 suggests that the receptor may mediate
galanin actions in the cardiovascular system (22, 23) and in sexual
behavior (24, 25).
-actin cDNA to
ensure comparable loading of mRNA from the tissues
(bottom).
[View Larger Version of this Image (99K GIF file)]
To characterize the pharmacology of the rat GalR3 receptor, the GalR3
plasmid (the 2.2-kb clone A5-3) was expressed in COS-7 cells. Binding
of 125I-porcine galanin to membranes prepared from
transfected COS-7 cells demonstrated a low but reproducible level of
specific binding, while binding of the radioligand to membranes from
COS-7 cells transfected with vector alone was negligible. The specific
binding was saturable at high affinity, showing a Kd
value for 125I-galanin of 0.55 ± 0.15 nM
and a Bmax of 28.1 ± 1.1 fmol/mg of membrane protein (mean ± S.D. from three independent
transfections). A representative binding curve is illustrated in Fig.
3. No specific binding was observed when
125I-labeled somatostatin was used in the binding
assays.
[View Larger Version of this Image (14K GIF file)]
The ability of several galanin antagonists and agonists to bind GalR3
were examined in radioligand competition binding assays. 125I-porcine galanin binding to membranes prepared from
COS-7 cells transfected with pcDNA3-rGalR3 cDNA could be
displaced with galanin fragments and galanin-related chimeric peptides
(Table I). Galanin, C7, galanin-(1-19),
M35, and galanin-(2-29) bound GalR3 with high affinity (within 9-fold
Ki of galanin), while M40, galanin-(1-16), and M15
bound rGalR3 with relatively lower affinities (33-60 times Ki of galanin) (Table I). No binding was detected in the assays with galanin-(3-29), galanin-(10-29),
preprogalanin-(1-30), GMAP-(1-41), GMAP-(44-59), and
[D-Thr6,D-Trp8,9]galanin-(1-15)-ol
(Table I). [Ala6,Trp8]Galanin-(1-15)-ol, an
antagonist shown to inhibit the effect of galanin on forskolin-induced
insulin release from RINm5F cells (26), bound the GalR3 receptor with
high affinity (Table I). When tested in the same competition binding
assays, somatostatin, dynorphin (
-opioid receptor-specific ligand)
and DAGO (µ-opioid receptor-specific ligand) did not cause detectable
displacement of the radioligand. The high affinity of galanin-(2-29)
for GalR3 (Table I) revealed that, like GalR2, Gly1
of galanin is not critical for galanin to bind GalR3, whereas this
residue is important for binding of galanin to GalR1 (15). In contrast,
galanin-(3-29) did not bind either GalR1, GalR2, or GalR3 (Table I),
indicating a crucial role of Trp2 of galanin in binding of galanin to
all three receptor subtypes.
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Pharmacological characterization revealed some striking differences
between the profile of GalR3 and those of GAlR1 and GalR2. Galanin-(1-16), and two galanin-related chimeric peptides, M40 and
M15, displayed significantly lower affinities for GalR3 than GalR2 and
GalR1 (Table I and see Refs. 12 and 15). Deletion of the C-terminal 10 amino acids (galanin-(1-19)) resulted in a 4-fold decrease in affinity
for GalR3 (Table I). However, further truncation to galanin-(1-16)
resulted in a further 8-fold decrease in affinity (Table I), indicating
the importance of residues 17-19 of galanin in binding to GalR3.
Examination of residues 17-19 of the high-affinity ligands reveals
that a potential hydrogen bond donor is conserved at position 18 in all
high affinity peptides, i.e. Asn in galanin,
galanin-(1-19), and galanin-(2-29), Gln in C7, and Ser in M35 (Fig.
4A). Substitution of this
position with Ala in M40 or Gly in M15 or deletion of this
residue in galanin-(1-16) to remove the potential for hydrogen bond
formation, significantly decreased the affinity of the ligands for the
GalR3 receptor (Fig. 4A). Delineation of the site of
interaction of this residue with the GalR3 receptor will require a
detailed receptor mutagenesis analysis.
[View Larger Version of this Image (31K GIF file)]
In summary, we have cloned and characterized a novel galanin receptor subtype termed GalR3. The receptor shares homology (36-54%) to the previously cloned GalR1 and GalR2 receptors. The distribution of GalR3 mRNA expression is strikingly different from those of GalR1 and GalR2 and appears to be restricted to the peripheral tissues. The pharmacology of the GalR3 receptor is distinguished from the other two receptors by the requirement of amino acids 17-19 of galanin (Fig. 4). The three galanin receptor subtypes show different pharmacological profiles with respect to galanin analogs, suggesting that they bind to distinct pharmacophores within the galanin peptide (Fig. 4B). This observation suggests the potential for physiological control of galanin receptor subtype activation by selective ligand modification such as differential proteolysis (27, 28). The characterization of this new galanin receptor should aid in delineating specific physiological roles of the galanin receptor subtypes.
FOOTNOTES
To whom correspondence should be addressed. Fax: 908-298-2383;
E-mail: suke.wang{at}spcorp.com.
ACKNOWLEDGEMENTS
We thank Drs. Michael Graziano and Catherine Strader for critical reading of the manuscript.
REFERENCES
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  N. Schauble, K. Reichwald, W. Grassl, H. Bechstein, H.-C. Muller, A. Scherag, F. Geller, M. Utting, W. Siegfried, H. Goldschmidt, et al. Human Galanin (GAL) and Galanin 1 Receptor (GALR1) Variations Are Not Involved in Fat Intake and Early Onset Obesity J. Nutr., June 1, 2005; 135(6): 1387 - 1392. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. K. Robinson Galanin and Cognition Behav Cogn Neurosci Rev, December 1, 2004; 3(4): 222 - 242. [Abstract] [PDF]
|
|
|
|
 |
|
 T. Bartfai, X. Lu, H. Badie-Mahdavi, A. M. Barr, A. Mazarati, X.-Y. Hua, T. Yaksh, G. Haberhauer, S. C. Ceide, L. Trembleau, et al. Galmic, a nonpeptide galanin receptor agonist, affects behaviors in seizure, pain, and forced-swim tests PNAS, July 13, 2004; 101(28): 10470 - 10475. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. J. Naylor, E. Ginsburg, T. P. Iismaa, B. K. Vonderhaar, D. Wynick, and C. J. Ormandy The Neuropeptide Galanin Augments Lobuloalveolar Development J. Biol. Chem., August 1, 2003; 278(31): 29145 - 29152. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S.-A. Mahoney, R. Hosking, S. Farrant, F. E. Holmes, A. S. Jacoby, J. Shine, T. P. Iismaa, M. K. Scott, R. Schmidt, and D. Wynick The Second Galanin Receptor GalR2 Plays a Key Role in Neurite Outgrowth from Adult Sensory Neurons J. Neurosci., January 15, 2003; 23(2): 416 - 421. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W.B. Church, K.A. Jones, D.A. Kuiper, J. Shine, and T.P. Iismaa Molecular modelling and site-directed mutagenesis of human GALR1 galanin receptor defines determinants of receptor subtype specificity Protein Eng. Des. Sel., April 1, 2002; 15(4): 313 - 323. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Kokaia, K. Holmberg, A. Nanobashvili, Z.-Q. D. Xu, Z. Kokaia, U. Lendahl, S. Hilke, E. Theodorsson, U. Kahl, T. Bartfai, et al. Suppressed kindling epileptogenesis in mice with ectopic overexpression of galanin PNAS, October 31, 2001; (2001) 231496298. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. A. Simen, C. C. Lee, B. B. Simen, V. P. Bindokas, and R. J. Miller The C Terminus of the Ca Channel {alpha}1B Subunit Mediates Selective Inhibition by G-Protein-Coupled Receptors J. Neurosci., October 1, 2001; 21(19): 7587 - 7597. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H.-X. Liu, P. Brumovsky, R. Schmidt, W. Brown, K. Payza, L. Hodzic, C. Pou, C. Godbout, and T. Hokfelt Receptor subtype-specific pronociceptive and analgesic actions of galanin in the spinal cord: Selective actions via GalR1 and GalR2 receptors PNAS, July 24, 2001; (2001) 161293598. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Takatsu, H. Matsumoto, T. Ohtaki, S. Kumano, C. Kitada, H. Onda, O. Nishimura, and M. Fujino Distribution of Galanin-Like Peptide in the Rat Brain Endocrinology, April 1, 2001; 142(4): 1626 - 1634. [Abstract] [Full Text]
|
|
|
|
|
|
F. E. Holmes, S. Mahoney, V. R. King, A. Bacon, N. C. H. Kerr, V. Pachnis, R. Curtis, J. V. Priestley, and D. Wynick Targeted disruption of the galanin gene reduces the number of sensory neurons and their regenerative capacity PNAS, September 29, 2000; (2000) 210221897. [Abstract] [Full Text]
|
|
|
|
|
|
S. Bouret, V. Prevot, D. Croix, A. Howard, E. Habert-Ortoli, S. Jegou, H. Vaudry, J.-C. Beauvillain, and V. Mitchell Expression of GalR1 and GalR2 Galanin Receptor Messenger Ribonucleic Acid in Proopiomelanocortin Neurons of the Rat Arcuate Nucleus: Effect of Testosterone Endocrinology, May 1, 2000; 141(5): 1780 - 1794. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Ohtaki, S. Kumano, Y. Ishibashi, K. Ogi, H. Matsui, M. Harada, C. Kitada, T. Kurokawa, H. Onda, and M. Fujino Isolation and cDNA Cloning of a Novel Galanin-like Peptide (GALP) from Porcine Hypothalamus J. Biol. Chem., December 24, 1999; 274(52): 37041 - 37045. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z.-Q. D. Xu, X. Ma, U. Soomets, U. Langel, and T. Hokfelt Electrophysiological evidence for a hyperpolarizing, galanin (1-15)-selective receptor on hippocampal CA3 pyramidal neurons PNAS, December 7, 1999; 96(25): 14583 - 14587. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Cai, J. D. Hayes, N. Patel, and J. F. Hyde Targeted Overexpression of Galanin in Lactotrophs of Transgenic Mice Induces Hyperprolactinemia and Pituitary Hyperplasia Endocrinology, November 1, 1999; 140(11): 4955 - 4964. [Abstract] [Full Text]
|
|
|
|
 |
|
 D. WYNICK, C. J. SMALL, S. R. BLOOM, and V. PACHNIS Targeted Disruption of the Murine Galanin Gene Ann. N.Y. Acad. Sci., December 21, 1998; 863(1): 22 - 47. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. P. IISMAA, Z. FATHI, Y. J. HORT, L. G. IBEN, J. L. DUTTON, E. BAKER, G. R. SUTHERLAND, and J. SHINE Structural Organization and Chromosomal Localization of Three Human Galanin Receptor Genes Ann. N.Y. Acad. Sci., December 21, 1998; 863(1): 56 - 63. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
U. LANGEL and T. BARTFAI Chemistry and Molecular Biology of Galanin Receptor Ligands Ann. N.Y. Acad. Sci., December 21, 1998; 863(1): 86 - 93. [Full Text] [PDF]
|
|
|
|
|
|
E. J. MUFSON, U. KAHL, R. BOWSER, D. C. MASH, J. H. KORDOWER, and D. C. DEECHER Galanin Expression within the Basal Forebrain in Alzheimer's Disease: Comments on Therapeutic Potential Ann. N.Y. Acad. Sci., December 21, 1998; 863(1): 291 - 304. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. P. McDONALD, T. C. GLEASON, J. K. ROBINSON, and J. N. CRAWLEY Galanin Inhibits Performance on Rodent Memory Tasks Ann. N.Y. Acad. Sci., December 21, 1998; 863(1): 305 - 322. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. ZHANG, Z.-Q. XU, T.-J. SHI, M. LANDRY, K. HOLMBERG, G. JU, Y.-G. TONG, L. BAO, X.-P. CHENG, Z. WIESENFELD-HALLIN, et al. Regulation of Expression of Galanin and Galanin Receptors in Dorsal Root Ganglia and Spinal Cord after Axotomy and Inflammation Ann. N.Y. Acad. Sci., December 21, 1998; 863(1): 402 - 413. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Mazarati, H. Liu, U. Soomets, R. Sankar, D. Shin, H. Katsumori, U. Langel, and C. G. Wasterlain Galanin Modulation of Seizures and Seizure Modulation of Hippocampal Galanin in Animal Models of Status Epilepticus J. Neurosci., December 1, 1998; 18(23): 10070 - 10077. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. W. Fitzgerald, J. P. Patterson, D. S. Conklin, R. Horlick, and B. L. Largent Pharmacological and Biochemical Characterization of a Recombinant Human Galanin GALR1 Receptor: Agonist Character of Chimeric Galanin Peptides J. Pharmacol. Exp. Ther., November 1, 1998; 287(2): 448 - 456. [Abstract] [Full Text]
|
|
|
|
|
|
K. E. Smith, M. W. Walker, R. Artymyshyn, J. Bard, B. Borowsky, J. A. Tamm, W.-J. Yao, P. J.-J. Vaysse, T. A. Branchek, C. Gerald, et al. Cloned Human and Rat Galanin GALR3 Receptors. PHARMACOLOGY AND ACTIVATION OF G-PROTEIN INWARDLY RECTIFYING K+ CHANNELS J. Biol. Chem., September 4, 1998; 273(36): 23321 - 23326. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H.-X. Liu, P. Brumovsky, R. Schmidt, W. Brown, K. Payza, L. Hodzic, C. Pou, C. Godbout, and T. Hokfelt Receptor subtype-specific pronociceptive and analgesic actions of galanin in the spinal cord: Selective actions via GalR1 and GalR2 receptors PNAS, August 14, 2001; 98(17): 9960 - 9964. [Abstract] |
