INTRODUCTION

Activation of tyrosine kinases is an initial biochemical event in intracellular signal transduction from cytokine receptors after their bindings with ligands. Although most of the cytokine receptors do not contain any consensus motif of tyrosine kinase, several families of tyrosine kinases, such as the Src family tyrosine kinases, Jak family tyrosine kinases, Syk/ZAP70 family tyrosine kinases, and other family tyrosine kinases (Fes and Tec), are known to be associated with the cytoplasmic domains of cytokine receptors (1). Upon activation of the tyrosine kinases, cytokine receptor subunits are phosphorylated on tyrosine residues, which results in association of the receptor subunits with signal transducers and activators of transcription (Stats)¹ via interaction between the phosphorylated tyrosine residues of receptor subunits and the Src homology 2 (SH2) domains of Stats, and subsequently the Stats are tyrosine-phosphorylated by the Jak family tyrosine kinases to be activated as transcription factors (2, 3). For example, interleukin-2 (IL-2) induces activation of Lck (Fyn or Lyn), Syk, and Jak1, all of which are associated with the IL-2 receptor  chain, and Jak3, which is associated with the IL-2 receptor c chain, together with activation of other signaling molecules such as phosphatidylinositol 3-kinase and Shc/Grb2/Sos/Ras/Raf1/mitogen-activated protein kinase cascade (4). Stat5 associated with the IL-2 receptor  chain is activated by Jak3 but not Jak1 upon IL-2 stimulation (5-7). IL-3/granulocyte-macrophage colony-stimulating factor (GM-CSF) also seems to activate Stat5 through Jak2 (8, 9). Activation of Stat5 has been shown to be involved in signaling for DNA synthesis mediated by IL-2 and IL-3 in certain cell lines (10, 11). Jak3 and Jak2 are also known to be essential for induction of c-myc and c-fos upon stimulation with IL-2 and GM-CSF, respectively (12, 13). The target genes for Stat5, such as OSM (oncostatin M), c-fos, pim-1, Id-1, and CIS (cytokine inducible SH2-containing protein) have been defined (11, 14), but there is no evidence for involvement of Stat5 in c-myc induction. Therefore, we suspected that signaling molecule(s) other than Stat5 would be involved in the signaling pathway immediately downstream of the Jaks for induction of c-myc.

To search for such molecule(s), we have investigated cellular phosphotyrosine proteins induced by IL-2 stimulation, and detected several phosphotyrosine molecules distinct in molecular masses. Among them, the 75-kDa molecule was identified as the  chain of IL-2 receptor, and a cDNA encoding the 70-kDa molecule was cloned and identified as a novel signal-transducing adaptor molecule, which we named STAM, containing an SH3 domain and a tyrosine cluster region including an immunoreceptor tyrosine-based activation motif (ITAM) (15). We also succeeded in determination of a partial amino acid sequence of the 110-kDa phosphotyrosine molecule induced by IL-2 stimulation, and here demonstrated that the 110-kDa molecule is a human counterpart of mouse Hrs. Hrs containing a double zinc-finger motif was reported previously to be a phosphotyrosine protein induced by stimulation with hepatocyte growth factor (HGF), epidermal growth factor (EGF), and platelet-derived growth factor (PDGF), and localized in the cytoplasm (16). Very recently, Hrs-2, a rat homolog of Hrs, which is different in the C terminus, has been reported to have nucleotide triphosphatase (NTPase) activity and be associated with SNAP-25, possibly modulating vesicular transport (17). However, the biological significance of Hrs has not yet been elucidated. On the other hand, we have recently demonstrated that STAM is directly associated with and phosphorylated by Jak3 and Jak2 upon stimulation with IL-2 and GM-CSF, respectively, and involved in signaling for DNA synthesis and c-myc induction mediated by IL-2 and GM-CSF (18). The present study documents that Hrs is associated with STAM and implicated in regulation of intracellular signal transduction mediated by IL-2 and GM-CSF.

EXPERIMENTAL PROCEDURES

Cell lines used were a human T cell line, MOLT, which is a MOLT-4 transfectant clone expressing the exogenous  and endogenous c chains of IL-2 receptor (19); a mouse IL-3-dependent pro-B cell line, BAF-B03 (20); a human GM-CSF-responsive cell line, TF-1 (21); a SV40-transformed monkey kidney cell line, COS7; human B cell lines, Raji and Daudi; a human T cell line, Jurkat; a human monocytic cell line, THP-1; a human eosinophilic cell line, Eol-3; a human myelogenic cell line, KU812; and a human GM-CSF-dependent cell line, M-TAT (22). TF-1 and M-TAT were maintained in RPMI 1640 medium supplemented with 10% FCS and recombinant GM-CSF. BAF-B03 was maintained in RPMI 1640 medium supplemented with 10% FCS, 20% conditioned medium derived from culture supernatant of WEHI-3 cell line (as a source of IL-3) and 50 µM 2-mercaptoethanol. COS7 was maintained in Dulbecco's modified Eagle's medium supplemented with 10% FCS. Other cell lines were maintained in RPMI 1640 medium supplemented with 10% FCS. Peripheral blood leukocytes (PBL) from a healthy donor were treated with 1.0% phytohemagglutinin (PHA) (Difco) for 2 days and maintained in RPMI 1640 medium supplemented with 10% FCS and 1 nM IL-2.

pSRB5 and pSRG1 are human IL-2 receptor  and c chain expression plasmids, respectively (19, 23), and hGMR and hGMR are human GM-CSF receptor  and c chain expression plasmids, respectively (24, 25). pENL is a -galactosidase expression plasmid.

Human recombinant cytokines used here were IL-2 (obtained from Ajinomoto Co. Ltd., Japan) and GM-CSF (Hoechst Japan). Monoclonal antibodies (mAbs) used were TUS-1 (IgG1) specific for STAM (15), 12CA5 (IgG2b) specific for influenza virus hemagglutinin (HA) epitope (Boehringer Mannheim), 4G10 (IgG2b) (Upstate Biotechnology Inc.) and PY20 (ICN Biomedicals) specific for phosphotyrosine, PC61 specific for the mouse IL-2 receptor  chain (26), TUm122 specific for the mouse IL-2 receptor  chain (27). A human Hrs-specific mAb, Imos-1, was prepared by immunizing mice with glutathione S-transferase fusion protein of an Hrs peptide (amino acid position from Arg²²¹ to Asn⁴⁴⁷) using pGEX-4T-2 plasmid (Pharmacia Biotech Inc.). Imos-1 is useful for immunoblotting but not immunoprecipitation. Polyclonal anti-Hrs antibody immunoprecipitable for human Hrs was also prepared in rabbits by immunization with the glutathione S-transferase-Hrs fusion protein.

Immunoprecipitation was carried out as described elsewhere (5). In brief, cells were lysed in Nonidet P-40 cell extraction buffer (1% Nonidet P-40, 25 mM Tris-HCl, pH 7.5, 140 mM NaCl, 10 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, 20 µg/ml aprotinin, 1 mM Na₃VO₄), and immunoprecipitated with indicated antibodies. The immunoprecipitates were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred to polyvinylidene difluoride filters (Millipore). After blocking with 3% bovine serum albumin in phosphate-buffered saline containing 0.1% Tween 20 or Tris-buffered saline containing 0.1% Tween 20 for blotting with anti-phosphotyrosine mAbs, 4G10 and PY20, the filters were then incubated with indicated antibodies, followed by incubation with anti-mouse IgG coupled with horseradish peroxidase and visualized by using the enhanced chemiluminescence (ECL) detection system (Amersham Life Science).

Based on a partial amino acid sequence (GQTVHDEVANK) of pp110, a pair of primers, A3F (5-GG(AGCT)CA(AG)AC(AGCT)GT(TC)-3) and AR (5-(TC)TT(AG)TT(AGCT)GC(AGCT)AC(TC)TC-3), were chemically synthesized. To isolate a cDNA coding for pp110, we prepared poly(A)⁺ RNA from MOLT, and synthesized first-strand cDNA from the poly(A)⁺ RNA as a template and AR primer with the First-Strand cDNA synthesis kit (Pharmacia). DNA fragments were amplified by polymerase chain reaction (PCR) method with A3F and AR primers, and the first strand cDNA as a template. We isolated a 33-bp DNA fragment, and the amino acid sequence deduced from the nucleotide sequence of this fragment included the amino acid sequence directly determined with the purified pp110. Using the 33-bp fragment as a probe, we isolated five cDNA clones from a oligo(dT)-primed cDNA library of PHA-stimulated PBL, and sequenced them. All the five cDNA clones sequenced were identical and the longest clone (clone 1) had an open reading frame coding for 777 amino acids, which included the GQTVHDEVANK sequence. To confirm that clone 1 contains full-length cDNA, the 5 end of clone 1 cDNA was amplified with the Marathon cDNA amplification kit (CLONTECH), and an additional 42 bp of cDNA upstream of the 5 end of clone 1 was obtained. This sequence contains an in-frame stop codon at 45 bp upstream of the first methionine codon, and the sequence around the first methionine (nucleotides 76-78) matches the favorable Kozak consensus sequence. Together with these results, clone 1 was confirmed to contain a full-length cDNA encoding pp110.

Clone 1 coding for pp110 was subcloned into pKU2-Hyg expression vector at the XhoI and XbaI sites, and pKU-Hrs was obtained as an expression plasmid for pp110. pKU-HdC1 and pKU-HdC2 are expression plasmids for the C-terminal truncation mutants of Hrs, named Hrs-dC1 and Hrs-dC2, respectively, which were deleted up to nucleotides 1786 and 1429 from pKU-Hrs with exonuclease III and mung bean nuclease, respectively, and then a multiple-termination linker (pGCTAGGTAGGTAGTCTAGACTACCTACCTAGC) was inserted. pKU-HdM is an expression plasmid for the mutant deleted from Ser⁴³² to Met⁵⁷³ of Hrs, named Hrs-dM. For preparation of pKU-HdM, we amplified Hrs DNA by PCR method with two pairs of primers, 5-TGGAGACAGATTGGGAGTCC-3 and 5-TAAAGGTACCGAGTCATTGGTGATGCTG-3, or 5-AAAAGGTACCCGCAGCCGGAGGTGTGCT-3 and 5-GGGAGGTGTGGGAGGTTTTT-3, respectively, and with pKU-Hrs as a template. Amplified DNA fragments were digested with KpnI, and the resultant fragments were ligated to each other and then digested with BglII and XbaI. The digested fragment was ligated to pKU-Hrs vector after removal of the BglII-XbaI fragment. The wild-type and mutants of Hrs were subcloned into pCXN2 expression vector (28).

pKU-HrsHA is an expression plasmid for the HA-epitope (YPYDVPDYASG)-tagged Hrs (Hrs-HA). For preparation of pKU-HrsHA, we amplified Hrs DNA by PCR method with two pairs of primers, 5-ATATCTCGAGCCCGCGGCGTCGGGTTT-3 and 5-ATAATCCGGAACATCATATGGATACCCCATGGCGACCTCCAG-3, or 5-ATGTTCCGGATTATGCTAGCGGAGGGCGAGGCAGCGGCACC-3 and 5-TCGCAGATCTGCAAAATG-3, respectively, and with pKU-Hrs as a template. Amplified DNA fragments were digested with AccIII and ligated to each other, and then digested with XhoI and BglII. Digested fragments were ligated to pKU-Hrs vector after removal of the XhoI-BglII fragment. pKU-HrsHA expresses Hrs-HA, which consists of the HA-epitope linked to Gly2 at the N terminus of Hrs. For HA-tagging to all the Hrs mutants, pKU-HdC1, pKU-HdC2, and pKU-HdM were digested with BglII and XbaI, and the resultant fragments were ligated into pKU-HrsHA vector at the BglII and XbaI sites. These expression vectors were named pKU-HdC1HA, pKU-HdC2HA, pKU-HdC3HA, and pKU-HdMHA, respectively.

All the constructed plasmids were sequenced with an Applied Biosystems model 373A DNA sequencer.

Northern blot analyses were performed as described previously (29). In brief, poly(A)⁺ RNA derived from various human cell lines was purified with guanidinium isothiocyanate extraction and oligo(dT) column (Oligotex^TM) (Takara Shuzo Co.), and Multiple Tissue Northern blot containing poly(A)⁺ RNA preparations derived from various human tissues were purchased (CLONTECH). 2 µg of poly(A)⁺ RNA derived from each cell lines were electrophoresed on 1% agarose gel containing formaldehyde, and transferred to GeneScreen membrane (NEN Life Science Products). A 2.9-kb fragment of Hrs cDNA and 0.5-kb fragment of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA were used as probes for hybridization after labeling with [-³²P]dCTP. Radioactivity was measured with a Bio-Image Analyzer BAS 1500 (Fuji Film).

The chromosomal location of human Hrs gene was determined by fluorescence in situ hybridization (FISH). FISH to bromodeoxyuridine-synchronized metaphase chromosomes was performed by using a 2.9-kb-long cDNA of human Hrs as a probe, as described previously (30). 150 ng of biotin-labeled cDNA probe was hybridized with metaphase spreads prepared from primary culture of human PBL. Slides were incubated with fluorescein isothiocyanate-conjugated avidin DCS. Fluorescein isothiocyanate signals were then amplified by incubation with biotin-conjugated goat anti-avidin D. The preparations were counterstained with propidium iodide and examined under a laser scanning microscope.

BAF-B03 cells without starvation for IL-3 and serum were transfected with indicated doses of Hrs plasmids and 5 µg of pENL, together with 2 µg of pSRB5 and pSRG1 or 2 µg of hGMR and hGMR by electroporation, and 1 × 10⁵ cells/well were seeded in 96-well plates. Subsequently, the cells were stimulated either with 3 nM human IL-2 in the presence of anti-mouse IL-2 receptor  chain mAb, PC61, and anti-mouse IL-2 receptor  chain mAb, TUm122, or with 20 ng/ml human GM-CSF for 24 h in triplicate. [³H]Thymidine was added at 1.0 µCi/well 4 h before termination of incubation. The incorporated [³H]thymidine was counted with 1450 MicroBeta^TM liquid scintillation counter (Pharmacia). The -galactosidase activity was also assayed for confirmation of comparable transfection efficiency in each sample.

RESULTS

An IL-2-induced phosphotyrosine protein, pp110, detected previously (15), was purified from immunoprecipitates of MOLT cell lysates with anti-phosphotyrosine mAb, 4G10, in two-dimensional gel electrophoresis, and amino acid sequence of its peptide fragment was successfully determined. Based on a partial amino acid sequence of the pp110, the full length of a cDNA clone encoding the pp110 was isolated as described under "Experimental Procedures." The deduced amino acid sequence of the pp110 was found to be 93% homologous to that of mouse Hrs, indicating that the pp110 is the human counterpart of mouse Hrs. Deduced amino acid sequences were compared among human Hrs, mouse Hrs (16), and rat Hrs-2 (17), all of which contain double zinc-finger motifs, proline-rich regions, proline- and glutamine-rich regions, putative coiled-coil sequences, and nucleotide-binding sites, and their schematic structures are shown in Fig. 1A. The N terminus containing 180 amino acid residues showed 99% homology among them, and the regions containing the double zinc-finger motif, proline-rich region, proline- and glutamine-rich region, and putative coiled-coil sequence were also highly homologous. However, the C-terminal 147 amino acid residues of Hrs-2 were not included in human and mouse Hrs.

[View Larger Version of this Image (33K GIF file)]

The chromosomal location of human Hrs gene was determined by FISH with Hrs cDNA probes. The human Hrs gene was mapped on chromosome 17q25 (Fig. 1B).

We investigated expression of Hrs mRNA in various human tissues and cell types. Hrs mRNA was detected as a 3.0-kb band in all the tissues and cell types tested, including spleen, lymph node, thymus, appendix, PBL, bone marrow, fetal liver, heart, brain, placenta, lung, liver, skeletal muscle, kidney, and pancreas (Fig. 2A), T and B lymphoid cell lines (MOLT, Jurkat, Daudi, and Raji), non-lymphoid hematopoietic cell lines (THP-1, TF-1, Eol-3, KU812, K562, and M-TAT), and PHA-treated PBL (PHA-PBL) (Fig. 2B). These results suggest that human Hrs is ubiquitously expressed in a variety of human tissues and cell lines.

[View Larger Version of this Image (67K GIF file)]

Since human Hrs was originally detected as an IL-2-induced phosphotyrosine protein, and mouse Hrs has been shown to be tyrosine-phosphorylated by stimulation with HGF, EGF, and PDGF, we examined tyrosine phosphorylation of Hrs upon stimulation with IL-2. MOLT cells were lysed before and after IL-2 stimulation. Their lysates were immunoprecipitated with anti-Hrs antibody and then immunoblotted with anti-phosphotyrosine mAbs, 4G10 and PY20 (Fig. 3A). Tyrosine-phosphorylated Hrs was detected at a 110-kDa molecular mass in the cell lysates after IL-2 stimulation but not before IL-2 stimulation. Immunoblotting with anti-Hrs mAb indicated comparable expressions of Hrs before and after IL-2 stimulation. Similarly, GM-CSF stimulation of TF-1 cells also induced tyrosine phosphorylation of Hrs (data not shown). These results indicate that tyrosine phosphorylation of Hrs is induced by stimulation with IL-2 and GM-CSF, as well as HGF, EGF, and PDGF. In addition to the 110-kDa Hrs, phosphotyrosine molecules with 120-kDa and 70-kDa molecular masses were detected in the Hrs immunoprecipitate, suggesting that the 120-kDa and 70-kDa molecules may be coimmunoprecipitated with Hrs. The kinetic study of IL-2-induced tyrosine phosphorylation of Hrs was done with MOLT cells (Fig. 3B). Tyrosine-phosphorylated Hrs became detectable within 3 min of IL-2 stimulation, and maximized at 5 min.

[View Larger Version of this Image (18K GIF file)]

Since we previously found that STAM has a 70-kDa molecular mass and is tyrosine-phosphorylated upon stimulation with a wide variety of cytokines including IL-2, GM-CSF, EGF and PDGF, we considered the possibility that the 70-kDa phosphotyrosine molecule detected in the immunoprecipitate of Hrs is STAM. To examine this possibility, we performed coimmunoprecipitation assays between Hrs and STAM with MOLT cells. They were treated or untreated with IL-2, and their lysates were immunoprecipitated with rabbit anti-Hrs antibody, preimmune serum, or anti-STAM mAb. The immunoprecipitates were separated by SDS-PAGE, and then immunoblotted with anti-STAM mAb or anti-Hrs mAb, respectively. Irrespective of IL-2 stimulation, Hrs was apparently coimmunoprecipitated with STAM, or vice versa (Fig. 4). These results indicate that Hrs is physically associated with STAM without IL-2 stimulation.

[View Larger Version of this Image (39K GIF file)]

To gain insight into the association site of Hrs with STAM, we further carried out coimmunoprecipitation between various deletion mutants of Hrs and STAM. Firstly, we prepared HA-tagged Hrs, Hrs-dC1, Hrs-dC2, and Hrs-dM, which are the wild-type Hrs, and three mutants of Hrs deleted of the C terminus up to Gln⁵⁷¹, of the C terminus up to Gln⁴⁵², and of the portion between Ser⁴³² and Met⁵⁷³, respectively, as shown in Fig. 5A. COS7 cells were transiently transfected with the wild-type STAM and the wild-type Hrs or Hrs mutants, their lysates were immunoprecipitated with anti-STAM mAb, and then immunoblotted with anti-HA mAb or anti-STAM mAb. STAM was coimmunoprecipitated with Hrs-dC1 as well as the wild-type Hrs, but not with Hrs-dC2 and Hrs-dM (Fig. 5B, upper blot). Conversely, the cell lysates were immunoprecipitated with anti-HA mAb, and immunoblotted with anti-STAM mAb or anti-HA mAb. The wild-type Hrs and Hrs-dC1 but not Hrs-dC2 and Hrs-dM mutants was coimmunoprecipitated with STAM (Fig. 5C, upper blot). The expression levels of the wild-type and mutants of Hrs and STAM were confirmed to be comparable among transfections (Fig. 5, B, C, and E, lower blots). These results suggest that the portion between Gln⁴⁵² and Leu⁵⁷⁰ of Hrs includes the binding site for STAM. Next, we examined the association of STAM mutants with the wild-type Hrs. DSH3, DIT, and DY2 mutants of STAM are deleted of the SH3 domain, ITAM region and the tyrosine cluster region, respectively (Fig. 5D). COS7 cells were transiently transfected with the wild-type STAM, DSH3, DIT, and DY2 together with HA-tagged wild-type Hrs, their lysates were immunoprecipitated with anti-STAM mAb, and then immunoblotted with anti-HA mAb. Hrs was coimmunoprecipitated equally well with the wild-type STAM and DSH3 mutant STAM, but weakly with DY2 mutant STAM, while DIT mutant STAM was not coimmunoprecipitated with Hrs (Fig. 5E). These results indicated that the ITAM region, in particular, the amino acid position between Glu³⁵⁶ and Leu³⁷⁰, of STAM includes the association site for Hrs. The SH3 domain of STAM is not involved in the association with Hrs.

[View Larger Version of this Image (27K GIF file)]

Hrs-2, a rat homolog of Hrs, was recently reported to include two putative coiled-coil sequences in the amino acid position between Gln⁴⁵⁰ and Asp⁴⁷⁷, and between Met⁵¹⁵ and Arg⁵⁴⁴ (17), which correspond to the STAM-binding site of Hrs. The amino acid sequence of Hrs was hence searched for a coiled-coil sequence with COILS 2.1 program (31). A highly conserved coiled-coil sequence (p = 0.99) was detected at the amino acid position between Leu⁴⁷⁰ and Arg⁴⁹⁷ of Hrs (Fig. 6A). Although rat Hrs-2 contained two putative coiled-coil sequences, not only human Hrs but also mouse Hrs contained only one putative coiled-coil sequence. The coiled-coil sequence of Hrs was deleted in Hrs-dM mutant, which lost STAM binding activity. The amino acid sequence of STAM was also searched for a coiled-coil sequence in a similar manner. STAM also contained a putative coiled-coil sequence (p = 0.96) at the amino acid position between Ile³⁵⁰ and Glu³⁷⁷ (Fig. 6B). Most of the coiled-coil sequence of STAM was included in the ITAM region at the amino acid position between Ser³⁵⁵ and Gln³⁸⁸, of which the deletion mutant, DIT, lacked Hrs binding activity. DY2 mutant of STAM carrying a weak Hrs binding activity is deleted of a C-terminal half from Tyr³⁷¹, including a small region consisting of 7 amino acid residues (from Tyr³⁷¹ to Glu³⁷⁷) of the total 28 amino acid residues of the coiled-coil sequence of STAM. These results suggest a possible involvement of the coiled-coil structures of Hrs and STAM in their association.

[View Larger Version of this Image (14K GIF file)]

Since STAM is involved in signaling for DNA synthesis mediated by IL-2 and GM-CSF, we investigated the effect of Hrs on DNA synthesis mediated by IL-2 and GM-CSF. BAF-B03 cells without starvation for IL-3 and serum were transiently transfected with the wild-type Hrs or Hrs-dM mutant, together with human IL-2 receptor  and c genes or human GM-CSF receptor  and c genes. They were then stimulated with human IL-2 or GM-CSF, respectively, and assayed for [³H]thymidine incorporation. Transfection with the wild-type Hrs resulted in 76% and 73% inhibition of [³H]thymidine incorporation induced by IL-2 and GM-CSF, respectively, in comparison with the control, whereas Hrs-dM mutant, which has no binding site for STAM, induced little if any inhibition of [³H]thymidine incorporation upon stimulation with IL-2 and GM-CSF (Fig. 7, A and B). The suppression of [³H]thymidine uptake mediated by IL-2 and GM-CSF was dose-dependent on the wild-type Hrs plasmids (Fig. 7, C and D). These results suggest that Hrs has the ability to inhibit signaling for DNA synthesis mediated by IL-2 and GM-CSF, and that Hrs-STAM association is a prerequisite for such activity.

[View Larger Version of this Image (25K GIF file)]

DISCUSSION

Mouse Hrs was molecularly identified as a phosphotyrosine protein induced by stimulation with HGF, EGF, and PDGF, but its biological significance has not yet been elucidated (16). We here demonstrated that human Hrs is implicated in regulation of intracellular signal transduction mediated by cytokines through interaction with STAM, which we have already shown to be associated with Jak3 and Jak2 tyrosine kinases, and involved in signaling for cell growth and c-myc induction mediated by IL-2 and GM-CSF (15, 18). Human Hrs was shown to have structural characteristics similar to mouse Hrs, such as a double zinc-finger motif, a proline-rich region, and a proline- and glutamine-rich region, and found to be rapidly tyrosine-phosphorylated upon stimulation with cytokines such as IL-2 and GM-CSF with similar kinetics to stimulation with HGF (16). These observations suggest that Hrs is possibly involved in signaling induced by a wide variety of cytokines and growth factors, which well correlates with its ubiquitous expression among various human tissues and cell types. Although receptors for HGF, EGF, and PDGF carry tyrosine kinases in themselves (32), and receptors for IL-2 and GM-CSF are associated with non-receptor type tyrosine kinases such as the Jak family and Src family (1), tyrosine kinase(s) catalyzing Hrs phosphorylation has not yet been detected. Since STAM directly associates with Jak3 and Jak2 (18), it is possible that Hrs is phosphorylated by Jak3 and Jak2 upon stimulation with IL-2 and GM-CSF, respectively.

Hrs was revealed to bind to STAM, suggesting a possible biological significance of Hrs in cytokine-mediated signal transduction. The association between Hrs and STAM exists in cells even before ligand stimulation, because IL-2 stimulation did not affect their coimmunoprecipitation. The STAM-association site of Hrs was identified to locate in the portion between Gln⁴⁵² and Leu⁵⁷⁰, which includes a highly conserved coiled-coil sequence. Furthermore, using DIT mutant STAM deleted of the ITAM region, the Hrs-binding site of STAM was determined to locate in the ITAM region, which also contains most of a highly conserved coiled-coil sequence. These results suggest the possibility that Hrs forms a complex with STAM through interaction between their coiled-coil structures. The weaker association of DY2 mutant STAM with Hrs than the wild-type STAM may be explained by deletion of a small part (seven amino acids) of the coiled-coil sequence of STAM. So far, the ITAM region of STAM is also known to be involved in association with Jak3 and Jak2 (18). However, DY2 mutant STAM, retaining Hrs binding activity, completely lost the ability for association with the Jaks. Furthermore, the Jaks do not contain any highly conserved coiled-coil sequence (data not shown). These observations suggest that the Hrs-binding site of STAM does not completely overlap the Jak-binding site of STAM, and the coiled-coil sequence of the ITAM region may not be involved in the interaction with the Jaks.

It has been demonstrated that native intrinsic STAM is involved in signaling for DNA synthesis mediated by IL-2 and GM-CSF, since the STAM mutant deleted of the SH3 domain functions as a dominant negative effect on such signal transduction (18). In the present study, exogenous introduction of Hrs associated with STAM induced suppression of DNA synthesis mediated by IL-2 and GM-CSF. Hrs-dM mutant lacking the STAM-binding site, however, restored DNA synthesis mediated by the cytokines, suggesting that the interaction of Hrs with STAM may result in negative regulation of DNA synthesis induced by the cytokines. These observations further suggest that STAM is associated with signaling molecules, which either positively or negatively regulate DNA synthesis mediated by IL-2 and GM-CSF. Hrs is thought to be a signaling molecule negatively regulating DNA synthesis mediated by the cytokines. In contrast, molecule(s) associated with the SH3 domain of STAM may contribute to the positive effect, because the SH3 domain of STAM is essentially involved in signaling for DNA synthesis mediated by IL-2 and GM-CSF (18). Since stimulation of cells with IL-2 and GM-CSF induced DNA synthesis even in cells expressing endogenous Hrs, the negative effect of Hrs on DNA synthesis may not be dominant in signaling pathways from the cytokine receptors. It is also interesting to examine whether Hrs affects the signaling for c-myc induction, where STAM is implicated. Such study to define the functional significance of Hrs in intracellular signal transduction is currently in progress.

Together with the evidence for the physical association between Hrs and STAM, the apparent effects of exogenous Hrs on DNA synthesis mediated by the cytokines suggest the implication of endogenous Hrs in the cytokine-mediated signaling pathways. Very recently, an Hrs-homologous rat protein, Hrs-2, has been molecularly cloned and demonstrated to have NTPase activity with four nucleotide-binding sites in itself (17). NTPase activity of Hrs remains to be tested. However, since Hrs was also shown to have three nucleotide-binding sites, it is also predicted to have NTPase activity. Little is known about any relationship between molecules carrying NTPase activity and regulation of signaling for gene expression and DNA synthesis. Hrs-2 was shown to bind to SNAP-25, which is considered to modulate vesicular transport, and in fact, recombinant Hrs-2 inhibited calcium-triggered noradrenaline release from PC12 cells (17). Interaction, however, between Hrs and SNAP-25 is still unknown, but since expression of SNAP-25 is specific for nerve tissues (33), SNAP-25 may not be implicated in the Hrs-induced regulation of signaling for DNA synthesis mediated by the cytokines. Moreover, it is still obscure the exact relationship between genes coding for Hrs and Hrs-2, because a single mRNA band but not two distinct mRNA bands was detected in all the tissues and cell types tested with Hrs probes, which are highly homologous to Hrs-2.

Hrs together with STAM, both of which are tyrosine-phosphorylated upon stimulation with a variety of cytokines and growth factors, may contribute to the general understanding of signal-transducing pathways from receptors for such ligands.