INTRODUCTION

The retinol (vitamin A) metabolite all-trans-retinoic acid modulates the transcription of multiple genes in diverse cells during embryogenesis and post-natally by activating three retinoic acid receptors, RAR,¹ RAR, and RAR (1-3). An isomer of all-trans-retinoic acid, 9-cis-retinoic acid also binds with these three receptors with K_d values in vitro similar to those of all-trans-retinoic acid. 9-cis-Retinoic acid, but not all-trans-retinoic acid, activates three other members of the steroid hormone/thyroid hormone/vitamin D/retinoid receptor superfamily, the RXRs , , and  (4-6). RARs and RXRs function as heterodimers. RXRs also serve as partners for other members of the superfamily, such as thyroid hormone, vitamin D, and peroxisome proliferator-activated receptors, and can modulate gene expression as homodimers (2, 3). This multiplicity of receptors, receptor partners, and ligands suggests a mechanism for the pleiotropic effects of retinoids, but much depends on the loci of all-trans-retinoic acid and 9-cis-retinoic acid biosynthesis. Even though 9-cis-retinoic acid occurs in vivo, and has been identified as an endogenous ligand of RXR, its concentrations are lower than all-trans-retinoic acid, and it has been found only in a few tissues to date, compared with the ubiquitous distribution of all-trans-retinoic acid (7, 8). Rapid conversion in vivo into the receptor inactive isomer 9,13-di-cis-RA most likely limits 9-cis-retinoic acid concentrations and effects (9, 10).

All-trans-retinoic acid undergoes isomerization in cultured cells into 9-cis-retinoic acid (7) and pharmacological amounts of all-trans-retinoic acid dosed to rats produce small amounts of 9-cis-retinoic acid (11), but 9-cis-retinoic acid has not been detected in normal serum, and there is no evidence of enzymatic 9-cis-retinoic acid production from all-trans-retinoic acid (12, 13). The availability of potential substrates, however, suggests that a route of 9-cis-retinoic acid biosynthesis could occur other than through all-trans-retinoic acid. Both 9-cis-retinol and 9-cis--carotene are normal constituents of mammalian diets, including fresh and processed fruits and vegetables (14-17) and accumulate in mammalian tissues, and the latter undergoes conversion into 9-cis-retinoids (18-22). A 9-cis-RoDH could rely on these sources of 9-cis-retinol as a first step in the production of 9-cis-retinoic acid.

Three SDR isozymes, RoDH-1, -2, and -3 catalyze the first reaction of all-trans-retinoic acid biosynthesis, the conversion of all-trans-retinol into all-trans-retinal (23-26). Recently, one of these, RoDH-1, also was shown to catalyze 3-hydroxysterol dehydrogenation (27). The SDR family also includes an 11-cis-RoDH which catalyzes the conversion of 11-cis-retinol into 11-cis-retinal (28, 29), the cofactor of opsin, and many members that control the actions of steroid hormones and prostaglandins (30, 31). Notably, the enzymes of this family frequently exhibit two characteristics: multifunctional natures and expression of closely-related isoforms from different genes.

This work reports the cDNA cloning and expression, the mRNA tissue distribution, and the enzymatic characterization of a heretofore unknown SDR that catalyzes the conversion of 9-cis- and 11-cis-retinols into their respective aldehydes, but shows more efficient 3-hydroxyandrogen dehydrogenase activity than cis-retinoid catalytic activity. This SDR, herein referred to as CRAD, provides a means of generating 9-cis-retinal from 9-cis-retinol and dihydrotestosterone from 3-adiol.

MATERIALS AND METHODS

An EMBL3 SP6/T7 mouse genomic DNA library (CLONTECH) was screened through three rounds with a ³²P-labeled probe composed of nucleotides 1-788 of RoDH-1 (24). The final wash was done at 65 °C with 0.2 × SSC. DNA from one of four positive plaques was isolated and digested. The digests were analyzed by Southern blot hybridization with two probes, nucleotides 1-788 and 1096-1326 of RoDH-1. The smallest fragment that hybridized with both probes, ~3 kb, generated by digestion with EcoRI and XbaI, was subcloned into pBluescript-II SK(±) to yield pBSK/3kb. pBSK/3kb was digested and each of the three fragments produced by EcoRV, EcoRV/XbaI, and SacI/EcoRI, 0.75, 1, and 1.1 kb, respectively, hybridized with three probes from RoDH-1 nucleotides, 654-976, 977-1072, and 1096-1326. These fragments were subcloned into pBluescript-II SK(±) to produce pBSK/0.75, pBSK/1, and pBSK/1.1, which were sequenced by dideoxy chain termination with Taq DNA polymerase (Promega).

Primers were designed from genomic sequences distinct from the corresponding sequences of RoDH-1: sense primer CCCAAGCTTGACCAGTAGTGCCAGAT (nucleotides 64-80 of pBSK/1.1, i.e. 683-699 of the final cDNA (Fig. 1); antisense primer CGCGGATCCCCCAACTCTCCTAATTTC (nucleotides 576-593 of pBSK/0.75, i.e. 1063-1080 of final cDNA) containing HindIII and BamHI, respectively (underlined). A probe was generated by PCR amplification of cDNA from a mouse liver gt10 library with these primers. The probe was labeled with ³²P by random priming and used to screen ~6 × 10⁵ plaques on nitrocellulose membranes at 42 °C from the mouse cDNA library. A final wash was done at 65 °C with 0.2 × SCC. The first round of screening identified more than 200 plaques. The second and third rounds of screening were done by PCR at an annealing temperature of 55 °C with the sense primer ATGTGGCTCTACCTGCTG, based on the nucleotide sequence of the first six amino acids of RoDH-1, and the antisense primer CGCGGATCCCCCAACTCTCCTAATTTC from nucleotides 576 to 593 of pBSK/0.75, containing a BamHI site (underlined). Of the 40 plaques screened, two were positive. Phage DNA from one was isolated and digested with EcoRI. Two fragments, 1.2 and 2 kb, were subcloned into pBSK to produce pBSK/CRAD1.2kb and pBSK/CRAD2kb. These two fragments represent the cDNA, which has an internal EcoRI site. The inserts were sequenced in both directions.

CHO-K1 cells (ATCC) were cultured in Ham's F-12 medium supplemented with 10% fetal calf serum. Cells were plated semiconfluently onto 100-mm tissue culture dishes 24 h before transfection. The coding region for CRAD was digested from pBSK/CRAD1.2kb with EcoRI and ligated into pcDNA3 to produce pcDNA3/CRAD. The cells were transfected by using LipofectAMINE reagent (Life Technologies, Inc.) with pcDNA3/CRAD or with pcDNA3 (mock) and harvested 24 h later. The cell pellets were suspended in 10 mM Hepes, 10% sucrose, pH 7.5, and homogenized with a Dounce homogenizer. The homogenate was centrifuged at 800 × g for 20 min and the supernatant protein was used for enzyme assays, unless noted otherwise. Protein concentrations were determined by the method of Bradford (32).

Unless noted otherwise, retinol dehydrogenase assays were done at 37 °C in 0.25 ml of 50 mM Hepes, 150 mM KCl, and 1 mM EDTA, 1.6 mM NAD⁺, pH 8. In some assays, egg yolk L--phosphatidylcholine was added in 2 µl of ethanol. Reactions were quenched with 0.1 ml of 0.1 M O-ethylhydroxylamine, incubated at room temperature for 10 min, and extracted with 2.5 ml of hexane. The retinoids were quantified by normal-phase high performance liquid chromatography eluted with hexane for 5 min followed by 15% tetrahydrofuran in hexane for 5 min, followed by 14% tetrahydrofuran in hexane for 2 min eluted at 2 ml/min, as described previously (23). Replicates averaged within 7% of their means. Recovery was quantitative, as determined by comparing the areas of graded concentrations of retinoid oximes injected directly onto high performance liquid chromatography to the areas of the same concentrations after processing through the extraction procedure. The limit of detection was ~1 pmol and linear detection ranged from ~1 pmol to at least 1200 pmol. Retinal isomers were detected at 370 nm; retinol isomers were detected at 325 nm. 11-cis-Retinoids undergo isomerization into more stable isomers during incubation and extraction; therefore the sum of the retinal isomers recovered from the 11-cis-retinol incubation was used to determine the rate of its conversion into 11-cis-retinal (15).

Steroid dehydrogenase assays were done with [³H]steroids (40-101 Ci/mmol, 20,000 dpm/reaction) under the same conditions used for retinoid assays. Dichloromethane (4 ml) was used to quench the reactions and extract the steroids as described (27). The organic phases were evaporated with nitrogen and the residues were dissolved in 50 µl of ethanol and applied to (R_F values): 1) aluminum oxide thin-layer chromatography plates developed with chloroform/ethyl acetate (3/1, v/v) (androsterone, 0.44  androstanedione, 0.77; 3-adiol, 0.2  dihydrotestosterone, 0.43; dihydrotestosterone, 0.43  androstandione, 0.77; testosterone, 0.45  androstenedione, 0.69); 2) silica plates developed with the same mobile phase (-estradiol, 0.37  estrone, 0.55); or 3) silica plates developed with chloroform/ethanol (96/4, v/v) (corticosterone, 0.3  11-dehydrocorticosterone, 0.4). Visualization of standards was done with potassium dichromate/sulfuric acid. [³H]Substrates and products were detected by autoradiography: the radioactive zones were excised and counted with a liquid scintillation counter. Recovery of the sum of substrate and product ranged between 73 and 87% of the total radioactivity added. Replicates were between 14 and 20% of their means. The limit of detection was ~1 pmol.

Ethanol and propanol dehydrogenase assays were done with 33 mM substrate in 0.1 M glycine/NaOH, pH 10, and also in the same buffer used to measure retinoid activity (pH 8.0), both in a total volume of 1 ml. The absorbance was read at 340 nm during a 10-min incubation with 3 mM NAD⁺ and 20-32 µg of protein from an 800 × g supernatant of transfected CHO cells.

Kinetic data were obtained under initial velocity conditions (linear rates with protein and time; i.e. up to 6 and 2 µg of 800 × g supernatant protein, and for 20 and 10 min, for retinols and sterols, respectively) and were fit with the nonlinear regression program Enzfitter using simple weighing (33).

Northern blots were done with the mouse Multiple Tissue Northern blot which provides 2 µg of poly(A⁺) RNA per lane on a Nylon membrane (CLONTECH). The probe was generated by PCR amplification of pBSK/CRAD2kb with the sense primer TTCAGTTCCTGGTGGTGA (nucleotides 1476-1493 of the final cDNA) and the antisense primer GGAGTCAGGCATTTATGG (nucleotides 2082-2099). The probe was labeled with ³²P by random priming. Prehybridization was done in 10 ml of ExpressHyb^TM Hybridization solution (CLONTECH) at 68 °C for 30 min. Hybridization was done for 1 h in the same solution containing 2 × 10⁶ cpm of probe/ml. The final wash was done at 50 °C with 0.1 × SSC, 0.1% SDS. Signals were visualized with a Bio-Rad GS-505 Molecular Imager System.

A CRAD-specific probe was amplified by PCR from pBSK/CRAD1.2kb with the sense primer ATGGAGCATGCTCTGACT (nucleotides 846-863) and the T7 primer CGGGATATCACTCAGCATAATG of pBluescript-II SK(±). The PCR product was digested with EcoRI to produce a 341-bp probe (nucleotides 846-1187), which was subcloned into pBluescript-II SK(±) and linearized with HindIII. A ³²P-labeled antisense probe was transcribed with T3 RNA polymerase (Promega) for 1 h at 37 °C in 10 mM dithiothreitol, 0.5 mM each ATP, CTP, and GTP, 50 µM UTP, and 50 µCi of UTP (800 Ci/mmol). The DNA template was removed by DNase I digestion. The transcript was gel purified with a 5% polyacrylamide, 8 M urea gel. A 250-bp KpnI/XbaI fragment of mouse actin was used to generate an antisense probe for -actin mRNA. RNase protection assays were done with the Hybspeed^TM RPA kit (Ambion) following the manufacturers instructions with modifications as follows. For each experimental tube, labeled probes (9 × 10⁴ cpm) were mixed with 30 µg of total RNA. The probe and sample RNAs were co-precipitated at 20 °C for 30 min with 2.5 volumes of ethanol and 0.1 volume of 5 M ammonium acetate. The supernatants from a 15-min centrifugation with a microcentrifuge were removed and the pellets were air dried for 5 min at room temperature. To each pellet 10 µl of hybridization buffer preheated to 95 °C were added with good mixing. Samples were heated for 3.5 min at 95 °C and then hybridized at 68 °C for 30 min. A 100-µl aliquot of RNase A/T1 mixture diluted 1/100 was allowed to digest the unhybridized probe and RNA for 30 min at 37 °C. Inactivation/precipitation mixture (150 µl) was added and the samples were kept at 20 °C for 30 min. After centrifugation, the supernatants were removed and the pellets were dissolved in 8 µl of gel-loading buffer for denaturing gels by heating at 95 °C for 4 min. The samples were loaded onto a polyacrylamide, 8 M urea gel and run at ~180 volts for 2 h in 1 × TBE. The protected fragments were quantified as described above.

RESULTS

To isolate genomic clones of RoDH isozymes 1-3, an EMBL3 Sp6/T7 mouse genomic DNA library was screened with a probe consisting of nucleotides 1-788 of RoDH-1, i.e. a span homologous with RoDH-2 and RoDH-3. The deduced amino acid sequence from exons 2 through 4 had no better than 80 and 82% amino acid identities with rat RoDH-1 and rat RoDH-2, respectively. Because proteins that mediate retinoid function, such as the retinoid-binding proteins and the retinoid receptors, retain very high interspecies conservation (2, 34), we suspected that the clone represented a distinct SDR, rather than the mouse homolog of a known rat RoDH isozyme. To test this suspicion, a mouse liver cDNA library was used as template for PCR with primers from rat RoDH-1 (sense, nucleotides 295-313; antisense, nucleotides 1308-1326). The mouse PCR product had 99% nucleotide and >98% amino acid identity with rat RoDH-1. Similarly, PCR with primers to rat RoDH-2 (sense, nucleotides 229-246; antisense, nucleotides 1207-1224) amplified a product with 99% nucleotide and amino acid identity to rat RoDH-2 (data not shown). These two products encode the mouse homologs of RoDH-1 and RoDH-2, and therefore the genomic clone represented a heretofore unknown mouse SDR.

To obtain a cDNA clone of the mouse genomic clone, primers from the genomic sequence were used for PCR amplification of a probe from a mouse liver cDNA library. The plaques identified with this probe were further screened by PCR with a sense probe from RoDH-1 and an antisense probe from the genomic DNA. This identified a 3.2-kb cDNA which was subcloned in two parts, 1.2 (pBSK/CRAD1.2kb) and 2 kb (pBSK/CRAD2kb), because of an internal EcoRI site. The shorter fragment contained a single open reading frame with a complete coding region, whereas the longer fragment contained 3-untranslated sequence. The open reading frame in pBSK/CRAD1.2kb predicts a polypeptide with a calculated molecular mass of ~35 kDa, i.e. in the 25-35 kDa range of SDR (Fig. 1). The amino acid sequence deduced from pBSK/CRAD1.2kb had other features consistent in SDR. Twenty-three amino acids are conserved in ~70% of SDR: 19 of these are conserved in the protein encoded by pBSK/CRAD1.2kb. This includes the cofactor binding residues, Gly³⁶(X)₃GlyXGly, the catalytic residues, Tyr¹⁷⁶-(X)₃-Lys, and the conserved sequence of unknown function, Leu¹⁰⁹-X-Asn-Asn-Ala-Gly. One of the three non-identical amino acids represents a conservative substitution, I159V, also in the three RoDH isozymes and in 11-cis-RoDH. The two other substitutions are not conservative: A191R, also in the three RoDH isozymes and in 11-cis-RoDH; and D107W present in the RoDH isozymes, but not in 11-cis-RoDH, which has Phe¹⁰⁷. Both of these substitutions occur in other SDR (30, 31, 35). The first 103 N-terminal amino acids of RoDH-1, -2, and -3 are identical. Compared with these three, the product of pBSK/CRAD2kb has only seven substitutions in these amino acids versus 44 for 11-cis-RoDH. The closest amino acid similarity between the pBSK/CRAD1.2kb encoded protein and other SDR occurs with RoDH isozymes, with less similarity to both bovine and human 11-cis-RoDH, which also recognizes 9-cis-retinol (Table I) (28, 29, 36, 37). Even less similarity occurs with rat -hydroxybutyrate and mouse 11-hydroxysteroid dehydrogenases (35, 38).

[View Larger Version of this Image (102K GIF file)]

Table I. Comparison of CRAD and related SDR amino acid sequences Species SDR Amino acid homology % Identity % Similarity Mouse CRAD 100 100 Mousea RoDH-2 85 91 Rat RoDH-2 85 91 Rat RoDH-1 80 87 Rat RoDH-3 80 87 Mousea RoDH-1 79 86 Human SDR/"RoDH" 60 68 Bovine 11-cis-RoDH 53 67 Human 11-cis-RoDH 51 59 Rat D--Hydroxybutyrate 39 62 Mouse Adipocyte p27 protein 26 53 Mouse Ke 6 protein 26 48 Mouse 11-Hydroxysteroid 23 49 a X. Chai and J. L. Napoli, unpublished data.

SDR usually have two or less cysteine residues, but some mammalian SDR have four: rat 11-hydroxysteroid dehydrogenase (38); human (R)-3-hydroxybutyrate dehydrogenase (39); human 17-hydroxysteroid dehydrogenase, type I (40); human 15-hydroxyprostaglandin dehydrogenase (41). The rat liver D--hydroxybutyrate dehydrogenase (35), the RoDH isozymes, and CRAD represent SDRs with six cysteine residues, whereas bovine 11-cis-RoDH has seven (28, 29).

The CRAD cDNA was expressed in CHO cells to determine the enzymatic characteristics of its protein product. With 15 µM retinol substrate, the 800 × g supernatant of CHO cells transfected with pcDNA3/CRAD generated (mean ± S.D. of nmol/min/mg protein, n = 3, with 4 µg of protein in 15 min) 11-cis-retinal (13 ± 1.8), 9-cis-retinal (9.9 ± 0.4), 13-cis-retinal (0.8 ± 0.1), and all-trans-retinal (0.2 ± 0.02) in the presence of 1.6 mM NAD⁺.

Retinoid turnover in CHO cells was monitored to determine whether the different amounts of retinals isolated reflected the inherent activity of CRAD or endogenous activity of CHO cells or a combination. The 800 × g supernatant of mock-transfected CHO cells had no endogenous activity that metabolized 9-cis-retinol: the substrate was recovered unchanged over the course of a 15-min incubation (Fig. 2). 9-cis-Retinol also was recovered unchanged from the supernatant of cells transfected with pcDNA3/CRAD when NAD⁺ was omitted from the incubation. Addition of NAD⁺ to the CHO supernatant was obligatory for 9-cis-retinol metabolism. Under the same conditions, 5 µM all-trans-retinol was recovered unchanged at the end of a 15-min incubation. 9-cis-Retinal (400 pmol) also was recovered unchanged. These data demonstrate that use of the 800 × g supernatant of CHO cells transfected with pcDNA3/CRAD reflects the inherent activity of CRAD and not differential catalysis by enzymes endogenous to CHO cells.

[View Larger Version of this Image (20K GIF file)]

CRAD exhibited cooperative kinetics for 9-cis-retinol with a K_0.5 value of 5.4 ± 0.5 µM (mean ± S.D., n = 3) and a Hill coefficient of 1.7 ± 0.2 (mean ± S.D., n = 3) (Fig. 3, top panel). CRAD recognized 11-cis-retinol as substrate with a K_0.5 value of 7.6 and a Hill coefficient of 2.8 ± 0.5. Thus, the V_m/K_0.5 values indicate that CRAD shows little preference between 9-cis-retinol and 11-cis-retinol. These characteristics contrast with those of recombinant RoDH-1 and RoDH-2 which exhibited Michaelis-Menten kinetics for all-trans-retinol with K_m values of 0.9 and 2 µM, respectively (25, 26). Concentrations of 9-cis-retinol in liver have not been quantified, but are less than those of the ~2-5 µM of all-trans-retinol.² The impact of this K_0.5 on 9-cis-retinal synthesis, however, depends on the exact concentrations of 9-cis-retinol, their range during variable dietary and humoral conditions, and the potential for allosteric modulation of CRAD.

[View Larger Version of this Image (20K GIF file)]

CRAD shows typical Michaelis-Menten kinetics as a 3-hydroxysteroid dehydrogenase with both 3-adiol and androsterone (Fig. 3, bottom panel), with kinetic efficiencies under these conditions 30-60-fold greater than it shows with 9- and 11-cis-retinol (Table II). CRAD lacks 17-hydroxysteroid dehydrogenase activity with 5 µM estradiol or dihydrotestosterone and lacks 11-hydroxysteroid dehydrogenase activity with 10 µM corticosterone. CRAD showed 17-hydroxysteroid dehydrogenase activity toward testosterone that was relatively low and not kinetically saturated at 35 µM (rate = 72 pmol/min/mg protein).

Table II. CRAD activity with steroid substrates Data are the averages of two separate measurements. Substrate Activity Product Km Ratea V/Km µM 3-Adiol 3-HSD Dihydrotestosterone 0.2 27 135 Androsterone 3-HSD Androstanedione 0.1 6 60 Testosterone 17-HSD Androstenedione >35 Dihydrotestosterone 17-HSD Androstanedione NDb Estradiol 17-HSD Estrone NDb Corticosterone 11-HSD Dehydrocorticosterone NDb a nmol/min/mg protein. b ND, no activity detected (activity <0.02 nmol/min/mg protein). Reactions with dihydrotestosterone and estradiol were done with 5 µM substrate for 15 min with 4 µg of protein. Reactions with corticosterone were done with 10 µM substrate and 20 µg of protein for 30 min.

Centrifugation of the 800 × g supernatant of transfected CHO cells for 30 min at 10,000 × g partitioned the recovered CRAD activity, measured with 9-cis-retinol, between the pellet (30%) and the supernatant (70%). Centrifugation of the 10,000 × g supernatant at 100,000 × g for 2 h distributed most of the recovered activity into the microsomal pellet (91%), with relatively little in the cytosolic fraction (9%), indicating that CRAD associates with membranes.

Various agents affect the activities of recombinant RoDH-1 and -2 (23-25). For comparison, the effects of these agents were examined on CRAD activity (Table III). Ethanol (1 mM) enhances the activity of recombinant RoDH-1 and RoDH-2 by ~50-60%, but has no significant effect on CRAD activity. Moreover, neither ethanol nor propanol was metabolized by CRAD either at pH 8 or pH 10 (data not shown). Recombinant RoDH-1 and -2 require 2 mM phosphatidylcholine for maximum activity, which stimulates RoDH-1 7-fold and RoDH-2 3-fold. In contrast, 2 mM phosphatidylcholine, added in 2 µl of ethanol to give a final ethanol concentration of 137 mM, does not stimulate CRAD activity. Carbenoxolone, the steroidal aglycone of the licorice-derived compound glycyrrhizin, inhibits SDRs, such as rat 11-hydroxysteroid dehydrogenase, 15-hydroxyprostaglandin dehydrogenase, RoDH-1, and RoDH-2 (23-25, 42-44). It also inhibits CRAD potently. Phenylarsine oxide, which forms covalent adducts between spatially-proximal sulfhydryl groups (45), inhibits CRAD, as it does RoDH-1 and RoDH-2. 4-Methylpyrazole, a potent inhibitor of the medium-chain alcohol dehydrogenase ADH class I and a moderate inhibitor of alcohol dehydrogenase class II, inhibits CRAD. 4-Methylpyrazole has little effect on RoDH-1 and -2, but inhibits cytosolic NAD⁺-supported all-trans-retinoic acid synthesis with the complex cellular retinol-binding protein/all-trans-retinol as substrate (23). The NAD-dependent, cytosolic holocellular retinol-binding protein recognizing activity has features of an SDR/RoDH, i.e. it recognizes holocellular retinol-binding protein as substrate and apocellular retinol-binding protein and carbenoxolone as inhibitors, and can be distinguished from liver alcohol dehydrogenase isozymes by pI values. It is, however, distinct from CRAD, because the later does not recognize the complex cellular retinol-binding protein/all-trans-retinol as substrate (data not shown) and because the two activities associate with different subcellular fractions. Finally, these data show the preference of CRAD for NAD⁺ as cofactor, rather than NADP⁺.

Table III. Characteristics of CRAD transiently-expressed in CHO cells CRAD activity was assayed with 5 µM 9-cis-retinol and 2 µg of protein for 10 min and with 0.1 µM 3-adiol for 5 min with 50 ng of protein. The data for 9-cis-retinol are the means ± S.E. of 6-11 replicates from three separate transfections. The data for 3-adiol are the means ± S.D. of triplicates from a fourth transfection. The two entrees without errors indicate averages of duplicates. NADP+ was added in the absence of NAD+. Addition Substrate 9-cis-Retinol 3-Androstanediol % activity None 100  ± 3 100  ± 22 1 mM Ethanol 86  ± 8 130  ± 25 137 mM Ethanol 62 114  ± 11 2 mM Phosphatidylcholine 13  ± 3 75 0.5 mM Carbenoxolone 9  ± 3 4  ± 0.1 500 mM 4-Methylpyrazole 3  ± 2 0  ± 0.3 1 mM Phenylarsine oxide 3  ± 1 11  ± 3 2 mM NADP+ 4  ± 0.8 6  ± 2

Northern blot hybridization revealed intense expression of CRAD mRNA in kidney and liver (Fig. 4). Each tissue expressed multiple isoforms of mRNA (kidney, 4.4, 3.5, and 2.7 kb; liver, 4.4, 3.5, 3.0, and 2.7 kb). No signals were observed by Northern blotting in heart, brain, spleen, lung, skeletal muscle, or testis. The more sensitive RNase protection assays also were done to determine whether low mRNA expression occurs, not necessarily detectable by Northern blot hybridization. These assays showed CRAD mRNA expression in multiple mouse tissues (relative intensity normalized to the -actin signal): kidney (100) > liver (92) > small intestine (9) = heart (9) > retinal pigment epithelium + sclera (4.5) > brain (2) > retina + vitreous (1.6) > spleen (0.7) > testis (0.6) > lung (0.4). The anticipated 341-bp protected fragment was not observed in the iris, cornea, or lens. The intensity of expression of CRAD mRNA correlates well with the report that kidney has relatively high concentrations of 9-cis-retinoic acid (30 ng/g wet weight) and liver has somewhat lower concentrations (4 ng/g wet weight) (8), and with the Northern data which detected mRNA only in kidney and liver. A 210-bp fragment was noted in all tissues that showed the anticipated 341-bp fragment, but was absent from the three tissues that lacked the 341-bp fragment. In intestine and retina/vitreous the intensity of the 210-bp fragment was equal to or greater than the 341-bp fragment. This seems consistent with a CRAD isoform.

[View Larger Version of this Image (34K GIF file)]

DISCUSSION

This article describes cloning and expression of a cDNA which encodes a novel SDR that recognizes both retinols and sterols as substrates. This SDR increases the total cloned SDRs reported which catalyze retinoid metabolism to include, in addition to the current mouse CRAD, the three rat and/or mouse RoDH isozymes (types 1, 2, and 3) (24-26), a human "RoDH" (27), the human and bovine 11-cis-RoDHs (28, 29, 36, 37). We have also cloned and expressed another distinct mouse SDR, which recognizes cis-retinols and sterols, with 82% amino acid identity with CRAD.² These observations indicate that SDRs have considerable roles in retinoid metabolism, just as they have in steroid hormone metabolism. Thus, steroids and retinoids seem to share families of metabolic enzymes, ligand-activated receptors (2, 3, 6), and cellular binding-proteins (46, 47).

Dihydrotestosterone promotes prostate epithelial cell growth, whereas all-trans-retinoic acid and its isomers inhibit prostate epithelial cell growth (48, 49). Each hormone seems to work through modulating the receptor(s) of the other. Androgens decrease the mRNA of RAR ~5-fold in prostate epithelia and 15-20-fold in seminal vesicles (but increase it 2-fold in kidney) (50), whereas RA decreases androgen receptor binding 3-fold (48, 51). In addition, all-trans-retinoic acid decreases serum concentrations of dihydrotestosterone, 3-adiol, and androsterone significantly, and seems to cause a metabolic deviation away from the 5-path in liver as well (48, 52). Because of the dual androgen/retinoid activity of SDRs, they could be additional targets of retinoid-sterol interaction, either directly through substrate and/or allosteric or other interactions, or indirectly through any facet of gene expression or protein turnover via RARs, RXRs, and/or the androgen receptor. The observance of potentially dual androgen/retinoid substrate SDRs provides opportunity for additional insight into the physiological impact of retinoids on male reproduction, and extends the insights afforded by recognition of the requirement for functional retinoid receptors during spermatogenesis (53, 54), and detection of a epididymal retinoid-binding protein with high affinity for both all-trans-retinoic acid and 9-cis-retinoic acid (55).

Two pathways of testosterone metabolism have been observed in prostate cells (56). Prostate epithelial cells make and maintain dihydrotestosterone as the predominant testosterone product. Dihydrotestosterone serves as the major biologically active androgen in prostate (testosterone itself serves this role in testis) (57). Prostate stromal cells convert dihydrotestosterone into the inactive 3-adiol and then into the inactive androsterone. The androgen 3-hydroxydehydrogenase activities of RoDH-1, as shown by Biswas and Russell (27), and CRAD, shown here, convert 3-adiol (an inactive intermediate between dihydrotestosterone and the inactive androsterone) back into dihydrotestosterone, suggesting that RoDH-1 and CRAD could help maintain adequate transcriptionally-active androgen levels in prostate epithelial cells. The potential importance of dihydrotestosterone synthesis from 3-adiol is illustrated by detection of dihydrotestosterone in castrated and functionally-hepatectomized rats and the retention of androgen activity in the presence of 5-reductase inhibitors (57). Indeed, although 3-adiol does not bind to the androgen receptor, it stimulates prostate growth in vivo and in prostate organ culture, consistent with metabolism into dihydrotestosterone (58-60).

From its retinoid isomer recognition, CRAD also could function in either one or both of two retinoid metabolic paths. Its 9-cis-RoDH activity, along with its most intense mRNA expression in kidney and liver, but widespread expression throughout many tissues, implies that CRAD participates in an enzymatic pathway that generates 9-cis-retinoic acid from 9-cis-retinol (Fig. 5). 9-cis-Retinol and 9-cis-carotenoids occur in diets, 9-cis-carotenoids undergo conversion into 9-cis-retinoids, and both 9-cis-carotenoids and 9-cis-retinol accumulate in animal tissues (14-21, 61). CRAD could initiate the pathway by catalyzing the conversion of 9-cis-retinol into 9-cis-retinal. The 9-cis-retinal produced would undergo conversion into 9-cis-retinoic acid by retinal dehydrogenase type I, which catalyzes dehydrogenation of all-trans- and 9-cis-retinal into their respective aldehydes with equivalent efficiencies (62, 63). Like CRAD, many tissues express the mRNA of retinal dehydrogenase type I, including relatively intense expression in liver and kidney (64). The substrate specificity and the widespread expression of CRAD and retinal dehydrogenase type I mRNA, considered with the potential substrate availability, are consistent with a pathway for generating 9-cis-retinoic acid.

[View Larger Version of this Image (15K GIF file)]

The human 11-cis-RoDH, or a very closely-related isozyme, has been re-cloned and shown to convert 9-cis-retinol into 9-cis-retinal (37). This observation was based on a one-point enzyme assay with 10 µM substrate for an unspecified amount of time. No non-retinoid substrates were tested, nor was 11-cis-retinol re-evaluated side by side with 9-cis-retinol. The assays included phosphatidylcholine, but no indication was given of its effect on reaction rates. Without more insight its efficiency (i.e. K_0.5 and rate values) for 9-cis-retinol and whether it recognizes other substrates, its potential contribution to 9-cis-retinoic acid biosynthesis is difficult to assess.

The 11-cis-retinol dehydrogenase activity of CRAD technically could provide 11-cis-retinal for use as a rhodopsin chromophore. At first consideration, expression of CRAD in the retinal pigment epithelium would seem to support this notion. The mechanism of generating 11-cis-retinoids argues against this probability, however. Concerted hydrolysis-isomerization of all-trans-retinyl esters in the retinal pigment epithelium generates 11-cis-retinol for use in rhodopsin (65). This reaction has not been demonstrated in other tissues. Moreover, 11-cis-retinoids do not occur outside of the eye. 11-cis-Retinoids are unstable and rapidly undergo thermal, chemical, and light-catalyzed isomerization into other geometric isomers. Nor does CRAD seem to be co-specific with either of the two known dehydrogenases associated with the visual cycle. The 11-cis-RoDH expressed in the retinal pigment epithelium recognizes both 11-cis- and 13-cis-retinol as substrates, but neither all-trans- nor 9-cis-retinol (66). The retinol dehydrogenase activity of the rod outer segments requires NADP⁺ as cofactor and recognizes only all-trans-retinol as substrate and not 9-cis-, 11-cis-, or 13-cis-retinol (67). All these considerations weaken the expectation that CRAD contributes to the production of 11-cis-retinal. Moreover, in the eye, retinoids do not function solely as cofactors in the visual cycle; they also regulate gene expression. The expression of CRAD mRNA in the eye may be related to widespread use of 9-cis-retinoic acid, rather than to the requirement for 11-cis-retinal in the visual cycle, but further research will have to address this issue.

In summary, CRAD could be serving as either a sterol 3-hydroxydehydrogenase or a cis-retinol dehydrogenase or both. Likely, however, the exact function of CRAD will vary with its precise spatial-temporal expression loci, substrate availability, and humoral influences.