Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mo, C.
Right arrow Articles by Holland, T. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mo, C.
Right arrow Articles by Holland, T. C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 52, Issue of December 26, 1997 pp. 33305-33311

Determination of the Transmembrane Topology of Herpes Simplex Virus Type 1 Glycoprotein K (gK)*

(Received for publication, September 10, 1997)

Chengjun Mo and Thomas C. Holland Dagger

From the Department of Immunology and Microbiology, Wayne State University Medical School, Detroit, Michigan 48201

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES


ABSTRACT

Herpes simplex virus type 1 glycoprotein K (gK) plays an essential role in viral replication and cell fusion. gK is a very hydrophobic membrane protein that contains a signal sequence and several hydrophobic regions. It has been shown that mutations inducing cell fusion map to two distinct domains of gK, suggesting that these domains are functionally important. To understand the transmembrane topology of gK and the localization of these functional domains, we constructed a set of gK deletion, insertion, and truncation mutants and expressed these by in vitro translation in the presence of microsomal membranes. The transmembrane topology of gK was determined by examination of the post-translational processing and protease sensitivity of the mutant proteins. Our data demonstrate that gK contains three transmembrane domains (amino acids 125-139, 226-239, and 311-325). Another hydrophobic domain (amino acids 241-265), which is relatively less hydrophobic and much longer compared with the transmembrane sequences, is located in the extracellular loop. The analysis showed that the domains containing syncytial mutations are both ectodomains. They may interact with each other to form a complex tertiary structure that is critical for the biological function of gK.


INTRODUCTION

Herpes simplex virus type 1 (HSV-1)1 enters host cells by fusion between the virion envelope and the cell plasma membrane (1). Although many viruses that penetrate by direct fusion also cause syncytia formation (cell fusion), extensive cell fusion is caused by very few wild-type HSV strains. The majority of cells infected by wild-type HSV-1 round up and clump (2). However, mutants of HSV-1 that cause extensive cell fusion have been found. This phenotype has been designated the syncytial (Syn) phenotype (2-6). Mutations that give rise to the Syn phenotype have been mapped to at least four genes in the HSV viral genome: the gK gene (UL53) (7, 8), the gB gene (UL27) (9, 10), the UL24 gene (11, 12) and the UL20 gene (13). A large percentage of Syn mutations have been mapped to the gK gene (1, 7, 8, 14-16). Glycoprotein K has several notable characteristics compared with other HSV-1 glycoproteins. It contains multiple hydrophobic domains and may traverse the plasma membrane several times, giving gK a complex transmembrane structure (8, 16). Also in infected cells, gK is expressed at low levels relative to other glycoproteins of HSV-1 and does not reach the plasma membrane (17, 18). It appears that gK is essential for viral replication since mutant viruses with insertions or deletions in the UL53 open reading frame cannot grow in tissue culture (18, 19). Hutchinson et al. (20) constructed HSV-1 mutant virus FgKbeta , in which a lacZ gene cassette was inserted downstream of the amino-terminal portion of gK. They found that FgKbeta was defective in virus egress. Recent studies by Jayachandra et al. (19) on the mutant Delta gK, which lacks the entire gK gene, indicated that gK is required for both capsid envelopment and virus egress.

gK is a highly hydrophobic protein with 338 amino acids. It has characteristics of a membrane protein: a cleavable 30-amino acid NH2-terminal signal sequence, two sites for N-linked glycosylation, and several hydrophobic domains (Fig. 1) (8). Cleavage of the NH2-terminal signal sequence and addition of carbohydrates on asparagine residues at 48 and 58 of the gK amino acid sequence suggest that the NH2-terminal domain of gK is an ectodomain (21, 22). A truncated gK protein containing hydrophobic domain 1 is membrane-bound, indicating that this domain is a transmembrane or membrane-binding domain (22). However, the topology of the remainder of gK is difficult to predict. Eleven Syn mutants from KOS have been found to have mutations mapping to the gK gene (6, 14, 21, 23). Sequence analysis of these mutants indicated that syncytial mutations can occur in two distinct domains of gK: the NH2-terminal ectodomain of gK and the region between hydrophobic domains 2 and 4 (21). These two regions of gK are likely to be functional domains that play a role in regulating cell fusion. Determination of the transmembrane topology of gK, especially the localization of Syn mutation domains, is essential for the understanding of the structure and function of gK.

In this paper, we constructed a set of gK deletion, insertion, and truncation mutants. These were expressed by in vitro translation in the presence of microsomal membranes. The transmembrane topology of gK was determined by examination of their post-translational processing and protease sensitivity. This provided evidence for a gK structure with three transmembrane domains in which the syncytial mutations occur in the gK ectodomains.


EXPERIMENTAL PROCEDURES

Bacterial Strains, Growth Media, and Conditions

E. coli strains INValpha F' (Invitrogen) and DH5alpha (Life Technologies) were routinely cultured in Luria broth at 37 °C. These strains were host for the recombinant plasmids used in deletion and truncation mutagenesis experiments. Cells containing recombinant plasmids were selected by addition of ampicillin at a final concentration of 100 µg/ml.

Genetic Manipulations: Plasmid DNA Construction

Wild-type gK was amplified from pBS-KBLN (22) by PCR. The T7 promoter sequence was added to the 5'-primer and BamHI sites were put at the ends of 5' and 3' primers (Table I). The plasmid pTAgK was constructed by amplifying gK using the primers shown in Table I, followed by cloning of the product in the pCRII TA cloning vector (Invitrogen). The BamHI DNA fragment containing the T7 promoter and the gK open reading frame from pTAgK was ligated into the BamHI site of pUC13, forming pgKwt. Restriction analysis was used to determine the orientation of inserts.

Construction of pgK Mutants

Recombinant plasmids pgKDelta 1 and pgKDelta 2 were made by the primer-mediated mutagenesis method (24). Two PCR products that overlap in sequence were made to produce each mutant. These primary PCR products were denatured and allowed to anneal together by their overlaps. The heteroduplex products containing recessed 3' ends were extended by Taq DNA polymerase to produce a fragment that was the sum of the two overlapping fragments. These were amplified further by additional PCR cycles. PCR products with deletion mutations were digested by BamHI and subcloned into the BamHI site of pUC13.

The plasmid pgKDelta 1,2 was prepared by ligation of the 3252-bp BstEII/HindIII fragment from pgKDelta 1 and the 455-bp BstEII/HindIII fragment from pgKDelta 2. A high fidelity and efficient one-tube PCR-based mutagenesis method (25) was applied to make pgKDelta 3 and pgKDelta 1,2,3 deletion mutants. The plasmids pgKwt and pgKDelta 1,2 were utilized as the templates, respectively. Each pair of primers (Table I) was designed to complement the DNA upstream and downstream of hydrophobic domain 3. The PCR products amplified by primers gKDelta 3 or gKDelta 1,2,3 did not contain hydrophobic domain 3. After amplification, they were phosphorylated with T4 polynucleotide kinase, then ligated to form plasmids pgKDelta 3 and pgKDelta 1,2,3. Finally, pgKDelta 1,3 was made by ligating the 3253-bp BstEII/HindIII fragment from pgKDelta 1 and the 422-bp BstEII/HindIII fragment from pgKDelta 3.

Introduction of the MRGSH4 Epitope into gK

Two backward primers (Table I) were designed to add a sequence coding for the MRGSH4 epitope (26) and a stop codon downstream to the gK COOH terminus (gKMRGSH6) and the region upstream of hydrophobic domain 4 (gKMRGSH4) by PCR. The forward primer used in these reactions was the same as that described above for amplification of wild-type gK. The PCR products were gel-purified and used as DNA templates for in vitro transcription.

Introduction of Termination Codons into Truncated gK Genes

Truncated gK genes containing stop codons immediately downstream of the BstEII site at codon 205 or at codon 310, immediately upstream of hydrophobic domain 4, were produced by PCR. These were designated gKwtB2S, gKDelta 1B2S, KR256, KR270, and KR281, respectively. These PCR products were gel-purified and used as DNA templates for in vitro transcription. Primer sequences are shown in Table I.

Table I. Primers used for construction of gKwt and gK mutants


Constructa Forward primers (5' to 3') Reverse primers (5' to 3')

gKwt GCATGGATCCTAATACGACTCACTATAG GCATGGATCCCCCAAGACAGGACAG
GCACGCCATGCTCGCCG
gKDelta 1 GGGTGCGTCACCAACGCCb GGTGACGCACCCGTGTGTb
gKDelta 2 CGTACGCCGGGGGGCATGb CCCCCCGGCGTACGATCAACb
gKDelta 3 GAGCTGTATTGTATTCTGCGc CCGGGATATGAAAGCGGTGCc
gKDelta 1,2,3 GAGCTGTATTGTATTCTGCGc CCGGCGTACGATCAACTCGCc
gKBstE2 GCATGGATCCTAATACGACTCACTATAG CGTACCTAGGTCACGGGTCCGTCTC
GCACGCCATGCTCGCCG
KR281, KR270, KR256 GCATGGATCCTAATACGACTCACTATAG CGTACCTAGGTCATCGCATTGCGATG
GCACGCCATGCTCGCCG
gK.MRGSH4 GCATGGATCCTAATACGACTCACTATAG GGATCCTCAATGATGATGATGGCTACCA
GCACGCCATGCTCGCCG CGCATTCGCATTGCGATGCC
gK.MRGSH6 GCATGGATCCTAATACGACTCACTATAG GGATCCTCAATGATGATGATGATGATGG
GCACGCCATGCTCGCCG CTACCACGCATTACATCAAACAGGCGCC

a A start codon is bold and underlined. Nucleotides in bold type represent MRGSH4 epitope and stop codon added to the gK COOH-terminus and the region upstream of hydrophobic domain 4.
b Oligonucleotides used for primer-mediated mutagenesis. The overlapping sequences were underlined.
c Primers applied in the one-tube PCR-based mutagenesis protocal.

Biochemical Techniques: Preparation of Canine Pancreatic Rough Microsome Membranes

Rough microsomes (RM, a kind gift from P. Walter, University of California at San Francisco) were treated with staphylococcal nuclease (Boehringer Mannheim) to digest endogenous mRNAs (27). To 300 µl of RM, 3 µl of 100 mM CaCl2 buffer were added followed by 4.8 µl of staphylococcal nuclease S7 (5,000 units/µl) for a final concentration of 80 units/µl. Digestion was carried out for 10 min at 23 °C. The digestion was stopped by adding 6 µl of a 100 mM EGTA solution. The nuclease-treated RM were transferred to a 13 × 51-mm centrifuge tube (Beckman). The tube was topped off by layering 100 mM CaCl2 buffer on top of the RM. Membranes were pelleted in a Beckman SW55Ti rotor at 33,000 × g for 30 min. The supernatant was removed and the membranes were resuspended in 300 µl of 100 mM CaCl2 buffer. The nuclease-treated RM were aliquoted and stored at -70 °C.

In Vitro Transcription

Plasmid DNAs were digested with BamHI, and the fragments containing the T7 promoter and gK open reading frame were gel-purified. An in vitro T7 transcription kit (MEGAscriptTM, Ambion) was used to transcribe the purified DNA fragments. Briefly, each transcription reaction contains 1 µg of DNA template, 1 × transcription buffer (Ambion), 7.5 mM of each NTP, 1 × T7 RNA polymerase mix, and nuclease-free water in a total volume of 20 µl. The transcription mixture was incubated at 37 °C for 2 h. Then mRNAs were precipitated by 10 µl of LiCl at -70 °C. RNA pellets were washed with 50 µl of 80% ethanol and redissolved in nuclease-free water. RNA transcripts were analyzed by agarose gel electrophoresis before being used for in vitro translation reactions. Some DNA templates were produced directly by PCR. They were gel-purified and transcribed to make RNAs encoding the truncated gK proteins.

In Vitro Translation

RNAs were translated in vitro using a reticulocyte lysate system (Promega). Typically, a 25-µl translational mixture contained 1-2 µg of RNA, 2.5 µCi of [35S]methionine, 0.125 mM MgAc2, 12.5 mM KCl, 0.01 mM amino acid mixture (without methionine), and 12.5 µl of rabbit reticulocyte lysate (28). Nuclease-treated microsome membranes (3.5 µl) were added to certain reactions where post-translational processing was needed. After 2 h of incubation at 30 °C, 2 µl of a 10 µg/µl ribonuclease A solution was added to digest RNAs.

Proteinase K Protection Assay

In protease protection experiments, in vitro translation reactions were divided into several aliquots. These were left untreated or were digested by adding proteinase K to a final concentration of 2 or 0.5 µg/µl, either with or without addition of Triton X-100 to a final concentration of 1.0%. After 1 h of digestion at 4 °C, proteolysis was stopped by adding excess phenylmethylsulfonyl fluoride (PMSF, final concentration 4 mM). These samples were analyzed on SDS-polyacrylamide gels.

N-Glycosidase Treatment

Endoglycosidase H (Endo H) and peptide N-glycosidase F (PNGase) from New England Biolabs were used for carbohydrate digestion of gK proteins. To test for Endo H sensitivity, samples of translation reactions were denatured by addition of 0.1 volume of 10 × Endo H denaturation buffer, followed by incubation for 30 min at 37 °C. Then, 0.1 volume of 10 × Endo H reaction buffer was added to the denatured sample, followed by incubation with 2 µl of 1,000 units/µl Endo H for 1 h at 37 °C. To test for PNGase sensitivity, samples of translation reactions were first denatured by addition of 0.1 volume of 10 × PNGase denaturation buffer. Then 0.1 volume of 10 × PNGase reaction buffer and 0.1 volume of 10% Nonidet P-40 were mixed with the denatured samples. Finally, the mixtures were incubated with 2 µl of 500 units/µl PNGase for 1 h at 37 °C.

Immunoprecipitation

To immunoprecipitate MRGSH4-tagged gK proteins, 3-5 µl of in vitro translation reaction was added to 200 µl lysis buffer (1% Triton X-100, 1% bovine serum albumin, 10 mM Tris-Cl, pH 8.0, 150 mM NaCl, 0.025% NaN3 freshly supplemented with 1.0 mM PMSF, and 1 mM iodoacetamide) for 1 h at 4 °C. Anti-MRGSH4 antibody (Qiagen) (0.4 µg) was added, and the samples were mixed for 2 h at 4 °C on a rotator. A volume of 25 µl of 50% protein A-Sepharose suspension (Life Technologies, Inc.) was added, and the samples were mixed overnight at 4 °C on a rotator to precipitate antigen-antibody complexes. The beads were washed twice with 1 ml of lysis buffer. Finally, 12.5 µl of 2 × ESS loading buffer was used to release proteins from the beads at room temperature.

SDS-PAGE Analysis

In vitro-translated proteins were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Polyacrylamide slab gels (15.5%, 3% cross-linker) were made using the method of Laemmli (29). N,N'-diallyltartardiamide was used as the cross-linker instead of methylenebisacrylamide (bis). Since in vitro-translated gK aggregates when heated, even in the presence of SDS (22), gK protein samples were mixed with an equal volume of 2 × electrophoresis sample buffer and loaded directly onto gels without heating.

DNA Sequencing

DNA sequencing reactions were performed using the Taq DyeDeoxy terminator cycle sequencing system and were analyzed by automated sequence analysis (Applied Biosystems, Inc.). Three primers in each direction (Wayne State University Macromolecular Core Facility) were used for sequencing of the whole gene (21). The nucleotide sequence data were analyzed by AssemblyLign software program (Oxford Molecular Group).


RESULTS

Hydropathy Analysis of Glycoprotein K

The gK sequence consists of 338 amino acids (Fig. 1A), and its hydropathic profile is shown in Fig. 1B. A strongly hydrophobic region at the NH2 terminus has been shown to be part of a cleavable signal sequence (22). The four major hydrophobic domains (HD) are indicated. HD1, HD2, and HD4 are relatively short (14-15 amino acids), but are highly hydrophobic. HD3 meets the criteria for transmembrane domains proposed by Eisenberg et al. (30), but it does not meet those suggested by Kyte and Doolittle (31).


Fig. 1. A, amino acid sequence of gK. The protein sequence of HSV-1 gK is shown with its signal sequence, glycosylation sites, and potential transmembrane domains underlined. The locations of Syn mutations, which result in fusion of HSV-1-infected cells, are also indicated (21-23). B, hydropathy profile of gK. The hydrophilicity profile of gK was determined using the method of Kyte and Doolittle (31) with a window size of 9 residues. The solid bars indicate the signal sequence and four most hydrophobic domains, numbered HD 1-HD 4. These domains of gK consist of residues Met1-Gly30, Leu125-Leu139, Phe226-Ser239, Gly241-Thr265, and Leu311-Leu325, respectively.

[View Larger Version of this Image (33K GIF file)]


Protease Protection Assay for Analysis of gK Topology

Membrane and secreted proteins translated in vitro in the presence of canine pancreatic microsomal membranes undergo those steps of post-translational processing normally occurring in the endoplasmic reticulum (ER): membrane insertion, signal sequence cleavage, and N-linked glycosylation. Topologically, the interior of the pancreatic microsomes corresponds to the lumen of the ER. The exterior surface of the microsomes is derived from the cytoplasmic side of the ER (27, 32). Protease protection assays have been used to determine the topology of a number of membrane proteins (33-37). Domains protected from protease digestion by microsomes are located in the interior of the microsome or within the microsomal membrane itself and thus are ectodomains or transmembrane domains, respectively. Protease-sensitive domains are cytoplasmic domains that are exposed on the outside of the microsome.

To verify reaction conditions, a well characterized secreted protein, yeast alpha -mating factor, was studied. Post-translational processing of alpha -mating factor involves cleavage of its NH2-terminal signal sequence and addition of N-linked carbohydrate chains (38). After in vitro translation in the presence of microsomes, yeast alpha -mating factor should be located on the interior of microsomal membranes and should be protected from protease degradation. As shown in Fig. 3A, in the absence of pancreatic microsomes, yeast alpha -mating factor was synthesized as an 18-kDa protein (Fig. 3A, lane 1). In the presence of microsomes, the majority of this protein was processed to a form with an apparent molecular mass of 28 kDa (Fig. 3A, lane 2). A partially glycosylated form of 25 kDa was also observed, as well as a small amount of the unprocessed 18-kDa form. Treatment of in vitro translated and microsomally processed alpha -mating factor with proteinase K in the presence of Triton X-100 resulted in complete degradation of the protein (Fig. 3A, lane 3). This was inhibited by the protease inhibitor PMSF (Fig. 3A, lane 4). When the microsomes were treated with proteinase K alone at the concentration of 2 or 0.5 µg/µl, the 28-kDa and 25-kDa forms of alpha -mating factor were protected, but the 18-kDa form was completely degraded (Fig. 3A, lanes 5 and 6). Protection of the 28-kDa and 25-kDa forms by the microsomal membranes indicated that these forms were on the interior of the microsomes, whereas the unprocessed 18-kDa form remained outside the microsomes. In summary, the microsomes protected alpha -mating factor proteins that were translocated into the microsomal vesicles.

To use protease protection analysis to determine gK topology, the BamHI DNA fragment from pgKwt containing the T7 promoter and the gK open reading frame (Fig. 2B) was used as a template for in vitro transcription. Transcripts of wild-type gK were translated in vitro in the presence or absence of microsomal membranes. Microsomally processed samples were aliquoted, and proteinase K and Triton X-100 were added as indicated in Fig. 3B. The samples were run on a 15.5% SDS-PAGE gel. Without post-translational processing, gK migrated with an apparent molecular mass of 28 kDa (Fig. 3B, lane 1). This is considerably smaller than the predicted molecular mass of unprocessed gK (38 kDa). This is due to incomplete denaturation of gK in these samples, which have not been heated. Previous studies have shown that heating of in vitro translated gK, even in SDS sample buffer, leads to complete aggregation of the protein (22). A few bands larger than 28 kDa were observed in the absence of microsomes (Fig. 3B, lane 1). These appear to be ubiquitin-conjugated gK proteins. The bands form a ladder with approximately 8-kDa spacing, consistent with addition of multiple ubiquitins (molecular mass 8.5 kDa). Rabbit reticulocyte lysates are known to be able to carry out ubiquitination reactions (39, 40). Unprocessed gK protein translated in the absence of microsomes is misfolded, and this abnormal protein is apparently recognized by ubiquitinylating enzymes to add ubiquitin to one or more of the six lysines in gK.


Fig. 2. A, schematic representation of gK protein. The closed box stands for the signal sequence. The open boxes represent hydrophobic domains 1, 2, 3, and 4. B, subcloning of gK for in vitro translation. gK gene was cloned downstream of the T7 promoter, forming the plasmid pgKwt. This figure shows the plasmid linearized with BamHI. The BstEII site within the gK open reading frame, which was used to make truncated DNA templates, is indicated. C, structures of gK mutants. Deleted amino acid residues are denoted by gaps in each polypeptide map. Open boxes stand for the RGSH4 epitope.

[View Larger Version of this Image (15K GIF file)]



Fig. 3. Protease protection assay. A, processed and unprocessed forms of yeast alpha -mating factor were synthesized by in vitro translation in the presence or absence of microsomes. The processed forms of alpha -mating factor were treated with proteinase K, Triton X-100, and PMSF as indicated. B, gKwt transcripts were translated in vitro in the presence or absence of microsomes, as indicated. The processed forms of gKwt were treated with proteinase K and Triton X-100 as indicated. Samples were analyzed on 15.5% SDS-PAGE gels.

[View Larger Version of this Image (48K GIF file)]


In the presence of microsomes, wild-type gK protein was mostly processed to a form with an apparent molecular mass of 38 kDa. A partially glycosylated form of approximately 35 kDa was also observed, as well as a small amount of the unprocessed 28-kDa form (Fig. 3B, lane 2). Ramaswamy and Holland (22) showed that 38-kDa and 35-kDa forms have undergone addition of N-linked carbohydrates and signal sequence cleavage. Treatment of in vitro translated and microsomally processed gK with proteinase K in the presence of Triton X-100 resulted in complete degradation of all forms of gK (Fig. 3B, lane 5). When microsomally processed gK samples were digested with proteinase K alone at concentrations of 2 or 0.5 µg/µl, protected bands of 26 and 23 kDa were observed (Fig. 3B, lanes 3 and 4). Since the NH2-terminal domain of gK was expected to be an ectodomain (22), this domain should be protected from protease digestion. This was verified by treating samples of microsomally processed, proteinase K-treated gK with endoglycosidases. After PNGase and Endo H treatment, the 26- and 23-kDa forms of gK were reduced in apparent size to 22 and 19 kDa, respectively (data not shown). Since the N-glycosylation sites are located in the NH2-terminal domain of gK, this confirmed that the NH2-terminal domain is an ectodomain.

To study the transmembrane topology of gK, truncated DNA templates were made either by cleavage at restriction sites within the gK open reading frame or by primer-mediated PCR mutagenesis (Fig. 2C). After in vitro translation of RNAs transcribed from these DNA templates, the proteins were separated and analyzed by SDS-PAGE. To analyze the function of hydrophobic domain 1 of gK, this domain was deleted by PCR mutagenesis to produce gKDelta 1. Truncated forms of wild-type gK and gKDelta 1 lacking hydrophobic domains 2, 3, and 4 were produced by two methods. In the first method, gK and gKDelta 1 templates were digested with BstEII prior to transcription and translation. The proteins produced were designated gKwtB2 and gKDelta 1B2 (Fig. 2C). Since we were concerned that proteins translated from mRNA lacking stop codons might be processed abnormally, we also constructed gK and gKDelta 1 templates with stop codons added at the BstEII site (gKwtB2S and gKDelta 1B2S) (Fig. 2C). As shown in Fig. 4A, both gKwtB2 and gKwtB2S were synthesized as 22-kDa proteins in the absence of pancreatic microsomes (Fig. 4A, lanes 1 and 5). In the presence of microsomes, the majority of this protein was processed to a form with an apparent molecular mass of 28 kDa. A partially glycosylated form of approximately 26 kDa was also observed, as well as a small amount of the unprocessed 22-kDa form (Fig. 4A, lanes 2 and 6). When the microsomally processed samples were subjected to proteinase K digestion, the apparent molecular masses of these fully and partially glycosylated forms were decreased by 3 kDa. This decrease in mass was consistent with cleavage within the 66-amino acid cytoplasmic tail of gKwtB2/2S. On the other hand, the small amount of unprocessed 22-kDa form was completely degraded (Fig. 4A, lanes 3 and 7). In contrast to the case for gKwtB2/2S, the microsomally processed 27-kDa and 24-kDa forms of gKDelta 1B2/2S were unaffected by proteinase K treatment, but the unprocessed 20-kDa form was degraded (Fig. 4B, lanes 3 and 7). This suggests that in the absence of HD1, the gKDelta 1B2/2S proteins were released into the interior of the microsomes, indicating that HD1 is a transmembrane domain.


Fig. 4. Analysis of hydrophobic domain 1 of gK. gKwtB2, gKwtB2S, gKDelta 1B2, and gKDelta 1B2S were translated in vitro in the presence or absence of microsomal membranes as indicated. After translation, proteinase K and Triton X-100 were added as indicated and the samples were run on a 15.5% SDS-PAGE gel. A, gKwtB2 and gKwtB2S. B, gKDelta 1B2 and gKDelta 1B2S.

[View Larger Version of this Image (64K GIF file)]


To determine the function of hydrophobic domains 2 and 3, three additional gK mutants (KR256, KR270, and KR281) were produced by PCR mutagenesis. To eliminate the effects of hydrophobic domain 4, PCR was used to produce transcription templates truncated upstream of this domain. These truncated open reading frames were terminated with stop codons. The mutant KR270, lacking hydrophobic domain 1 (amino acids 125-139) and hydrophobic domain 3 (amino acids 241-265), contains hydrophobic domain 2 only and terminates after residue 310 of wild-type gK (arginine). KR281, lacking hydrophobic domain 1 and hydrophobic domain 2 (amino acids 226-239), has hydrophobic domain 3 only and was truncated after residue 310 of wild-type gK (arginine). KR256, lacking hydrophobic domains 1-3, was terminated after residue 310 of wild-type gK (arginine). gKDelta 123 contains hydrophobic domain 4 but lacks hydrophobic domains 1-3 (Fig. 2C). After in vitro translation and proteinase K treatment, the processed forms of KR270 were reduced in apparent size from 34 and 30 kDa to 31 and 27 kDa (Fig. 5, lanes 2 and 3 of panels A and B). This decrease in mass was consistent with digestion of most of the peptide on the COOH-terminal side of HD2 (46 amino acids). In contrast, no reduction in size of KR281 was observed (Fig. 5A, lanes 6 and 7). These results indicate that hydrophobic domain 2 is a transmembrane domain, but that hydrophobic domain 3 is not. KR256, which lacks all hydrophobic domains, was completely protected from proteinase K degradation (Fig. 5B, lanes 5 and 6). This is consistent with secretion into the interior of the microsomes. gKDelta 123 also appeared to be unaffected by proteinase K treatment (Fig. 5B, lanes 8 and 9), but due to the small size of the domain COOH-terminal to hydrophobic domain 4 (13 amino acids), it could not be determined whether this domain was degraded.


Fig. 5. Analysis of hydrophobic domains 2 and 3. KR270, KR281, KR256, and gKDelta 1,2,3 were translated in vitro in the presence or absence of microsomal membranes as indicated. After translation, proteinase K and Triton X-100 were added as indicated and the samples were run on a 15.5% SDS-PAGE gel. A, KR270 and KR281. B, KR270, KR256, and gKDelta 1,2,3.

[View Larger Version of this Image (68K GIF file)]


Analysis of the COOH-terminal Domain of gK by Immunoprecipitation

To study the function of hydrophobic domain 4, two additional gK mutants were made by PCR mutagenesis. The MRGSH4 epitope was added to the COOH terminus of KR281 to generate gKDelta 1,2RGSH4 and to gKDelta 1,2 to generate gKDelta 1,2RGSH6. gKDelta 1,2RGSH4 contains hydrophobic domain 3 only, and gKDelta 1,2RGSH6 has hydrophobic domains 3 and 4 (Fig. 2C). gKDelta 1,2RGSH4 and gKDelta 1,2RGSH6 were translated in vitro in the presence or absence of microsomal membranes, as indicated in Fig. 6. After translation, proteinase K and Triton X-100 were added as indicated. Proteins reacting with anti-RGSH4 IgG1 were immunoprecipitated and analyzed by SDS-PAGE (26). This antibody precipitated both the unprocessed (29 kDa, 31 kDa) forms and microsomally processed (34 kDa, 36 kDa) forms of both gKDelta 1,2RGSH4 and gKDelta 1,2RGSH6, respectively (Fig. 6, lanes 1, 2, 5, and 6). After proteinase K digestion of microsomally processed gK, the 34-kDa form of gKDelta 1,2RGSH4 was immunoprecipitated, whereas the 36-kDa form of gKDelta 1,2RGSH6 was not (Fig. 6, lanes 3 and 7). This indicated that microsomally processed gKDelta 1,2RGSH4 was completely protected by the microsomes, and that the MRGSH4 epitope of gKDelta 1,2RGSH6 remained outside the microsomes. Together, this suggested that hydrophobic domain 4 is a transmembrane domain.


Fig. 6. Analysis of hydrophobic domain 4 of gK. gKDelta 1,2RGSH4 and gKDelta 1,2RGSH6 were translated in vitro in the presence or absence of microsomal membranes as indicated. After translation, proteinase K and Triton X-100 were added as indicated. Samples were immunoprecipitated by anti-RGSH4 IgG1 and analyzed by 15.5% SDS-PAGE. Protein bands immunoprecipitated by antibody are indicated by dots.

[View Larger Version of this Image (33K GIF file)]


Transmembrane Topology of Glycoprotein K

These studies indicated that gK is a membrane-bound glycoprotein with three transmembrane domains (amino acids 125-139, 226-239, and 311-325). These correspond to hydrophobic domains 1, 2, and 4, which had been identified by hydrophobicity analysis. Hydrophobic domain 3 (amino acids 241-265) is located in the extracellular loop. Therefore, gK has two ectodomains and two cytoplasmic domains. The amino-terminal ectodomain (amino acids 31-124) contains two N-linked glycosylation sites (N48, N58). The entire domain between residues 141 and 225 is located in the cytoplasm and does not traverse the membrane. The COOH terminus (amino acids 326-338) is also a cytoplasmic domain. The topological arrangement of gK based on the data presented in this study is shown in Fig. 7.


Fig. 7. The proposed transmembrane topology of gK. gK has been shown to have three transmembrane domains. These correspond to hydrophobic domains 1, 2, and 4 and are represented by closed boxes. Hydrophobic domain 3 is indicated by a gray box. The amino-terminal ectodomain contains two N-linked glycosylation sites (Asn48, Asn58). The amino-terminal region and the ectodomain loop may interact each other to form a complex tertiary structure that may be involved in the regulation of viral glycoprotein-induced cell fusion.

[View Larger Version of this Image (11K GIF file)]



DISCUSSION

We have determined the transmembrane topology of gK by examination of the post-translational processing and protease sensitivity of mutant forms of gK. In this study, we identified hydrophobic domains 1, 2, and 4 as transmembrane domains. Therefore, all known Syn mutations in gK are located in either the amino-terminal ectodomain or the ectodomain between hydrophobic domains 2 and 4, suggesting that these ectodomains are important functional domains of the gK glycoprotein.

In contrast to other HSV-1 glycoproteins, gK appears not to be expressed on plasma membranes of infected cells. This conclusion is based on the studies of Hutchinson et al. (18). First, immunofluorescence experiments showed that gK was localized almost exclusively to the perinuclear and nuclear membranes, whereas gD, an HSV-1 envelope protein used as a control, was found in the plasma membrane and Golgi, as well as the perinuclear and nuclear membranes. Second, the forms of gK detected in infected cells were sensitive to Endo H digestion, indicating that gK does not reach the Golgi, the site where N-linked oligosaccharides are processed to an Endo H-resistant form. Third, they found that gK expressed by an adenovirus vector in the absence of other HSV-1 proteins was localized to perinuclear and nuclear membranes. Our results also suggest that gK is likely to be sequestered to intracellular membranes. As we have demonstrated, the transmembrane domains of gK are relatively short (14-15 amino acids). Bretscher et al. (41) have noted that the transmembrane domains of proteins retained in intracellular membranes, such as the endoplasmic reticulum, are typically about 15 residues in length, compared with transmembrane domain lengths of 20-25 residues for plasma membrane proteins. The shorter intracellular transmembrane domains are also richer in the bulky residue phenylalanine (13.7% versus 5.2%) (41). The first two transmembrane domains of gK each contain two phenylalanines, for an average phenylalanine content of 13.8%. Taken together, these data suggest that gK is likely to be an ER protein. This is consistent with the reported role of gK in envelopment and virion maturation (19, 20).

If gK is localized to intracellular membranes, its role in cell fusion must be indirect. It is possible that gK may influence cell fusion by regulating the conformation or interactions of other HSV glycoproteins, specifically those involved in cell fusion (i.e. gB, gD, and gH:gL). Precedent for control of the conformation of a viral fusion protein by another viral membrane protein exists; fowl plague virus hemagglutinin assumes an abnormal conformation unless coexpressed with the fowl plague virus M2 protein (42), although the mechanism of action of M2 (transmembrane proton transport) is likely to be different from that of gK. It is possible that gK acts as an HSV-specific chaperone-like protein. Cellular chaperonins exist in both the cytoplasm and lumen of the endoplasmic reticulum and assist in the folding of nascent proteins (43). Both membrane-bound and soluble chaperonins have been found in the ER lumen (44, 45). The fact that gK Syn mutations map to the gK ectodomains suggests that it may act on the ectodomains of other HSV glycoproteins. It is not clear at this time whether the gK function affecting cell fusion is directly related to its roles in virion envelopment and egress or is a separate function.

Homologs of HSV-1 gK have been reported in a number of other members of the alphaherpesvirinae subfamily, including HSV-2, bovine herpesvirus 1, gallid herpesvirus 1, pseudorabiesvirus, equine herpesvirus 1, Marek's disease virus, and varicella zoster virus (46-52). Alignment of these proteins using the CLUSTALW program (53) shows substantial similarity among them.2 Structural features conserved among the gK homologs of these viruses include the amino-terminal signal sequence, the presence of N-linked glycosylation sites in the amino-terminal domains, and 7 of the 13 cysteine residues found in HSV-1 gK. Of the conserved cysteines, all but one are located in gK ectodomains, suggesting that they may participate in disulfide bridges important to the structure of the gK ectodomains. In addition, these proteins contain hydrophobic domains similar in structure and position to those of HSV-1 gK, indicating similar transmembrane structure.


FOOTNOTES

*   This work was supported by National Institutes of Health Grants R01 AI22162 and K04 AI00875.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Dagger    To whom correspondence should be addressed. Tel.: 313-577-1298; Fax: 313-577-1155; E-mail: Thomas_Holland{at}wayne.edu.
1   The abbreviations used are: HSV, herpes simplex virus; PCR, polymerase chain reaction; gK, glycoprotein K; bp, base pair(s); RM, rough microsomes; PMSF, phenylmethylsulfonyl fluoride; PNGase, peptide N-glycosidase F; Endo H, endoglycosidase H; PAGE, polyacrylamide gel electrophoresis; ER, endoplasmic reticulum; HD, hydrophobic domain.
2   C. Mo and T. C. Holland, unpublished data.

ACKNOWLEDGEMENTS

We thank Dr. Peter Walter (University of California at San Francisco) for the generous gift of canine pancreatic microsome membranes and Dr. Stan Person (Johns Hopkins University) for encouragement and helpful discussions.


REFERENCES

  1. Spear, P. G. (1993) in Membrane Fusion Induced by Herpes Simplex Virus: Viral Fusion Mechanisms (Bentz, J., ed), pp. 201-232, CRC Press, Boca Raton, FL
  2. Person, S., Knowles, R. W., Read, G. S., Warner, S. C., and Bond, V. C. (1975) J. Virol. 17, 183-190
  3. Brown, S. M., Ritchie, D. H., and Subak-Sharpe, J. H. (1973) J. Gen. Virol. 18, 329-346 [Abstract/Free Full Text]
  4. Spear, P. G. (1985) in Glycoproteins Specified by Herpes Simplex Virus: The Herpesviruses (Roizman, B., ed), Vol. 3, pp. 315-356, Plenum Press, New York
  5. Little, S. P., and Schaffer, P. A. (1981) Virology 112, 686-702 [CrossRef][Medline] [Order article via Infotrieve]
  6. Read, G. S., Person, S., and Keller, P. M. (1980) J. Virol. 35, 105-113 [Abstract/Free Full Text]
  7. Bond, V. C., and Person, S. (1984) Virology 132, 368-376 [CrossRef][Medline] [Order article via Infotrieve]
  8. Pogue-Geile, K. L., and Spear, P. G. (1987) Virology 157, 67-74 [CrossRef][Medline] [Order article via Infotrieve]
  9. Bzik, D. J., Fox, B. A., DeLuca, N. A., and Person, S. (1984) Virology 137, 185-190 [CrossRef][Medline] [Order article via Infotrieve]
  10. DeLuca, N., Bzik, D. J., Bond, V. C., Person, S., and Snipes, W. (1982) Virology 122, 411-423 [CrossRef][Medline] [Order article via Infotrieve]
  11. Jacobson, J. G., Martin, S. L., and Coen, D. M. (1989) J. Virol. 63, 1839-1843 [Abstract/Free Full Text]
  12. McGeoch, D. J., Dalrymple, M. A., Davison, A. J., Donlan, A., Frame, M. C., McNab, D., Perry, L. J., Scott, J. E., and Taylor, P. (1988) J. Gen. Virol. 69, 1531-1574 [Abstract/Free Full Text]
  13. Baines, J. D., Ward, P. L., Campadelli-Fiume, G., and Roizman, B. (1991) J. Virol. 65, 6414-6424 [Abstract/Free Full Text]
  14. Bond, V. C., Person, S., and Warner, S. C. (1982) J. Gen. Virol. 61, 245-254 [Abstract/Free Full Text]
  15. Roop, C., Hutchinson, L., and Johnson, D. C. (1993) J. Virol. 67, 2285-2297 [Abstract/Free Full Text]
  16. Debroy, C., Pederson, N., and Person, S. (1985) Virology 145, 36-48 [CrossRef][Medline] [Order article via Infotrieve]
  17. Hutchinson, L., Graham, F. L., Cai, W., Debroy, C., Person, S., and Johnson, D. C. (1993) Virology 196, 514-531 [CrossRef][Medline] [Order article via Infotrieve]
  18. Hutchinson, L., Roop-Beauchamp, C., and Johnson, D. C. (1995) J. Virol. 69, 4556-4563 [Abstract]
  19. Jayachandra, S., Baghian, A., and Kousoulas, K. G. (1997) J. Virol. 71, 5012-5024 [Abstract]
  20. Hutchinson, L., and Johnson, D. C. (1995) J. Virol. 69, 5401-5413 [Abstract]
  21. Dolter, K. E., Ramaswamy, R., and Holland, T. C. (1994) J. Virol. 68), 8277-8281 [Abstract/Free Full Text]
  22. Ramaswamy, R., and Holland, T. C. (1992) Virology 186, 579-587 [CrossRef][Medline] [Order article via Infotrieve]
  23. Terry-Allison, T., Montgomery, R. I., and Spear, P. G. (1997) The 22nd International Herpesvirus Workshop Aug. 2-8, 1997, p. 279 (abstr.)
  24. Higuchi, R. (1990) in Recombinant PCR; PCR Protocols: A Guide to Methods and Applications (Innis, M. A., Gelfand, D. H., Sninsky, J. J., and White, T. J., eds), pp. 177-183, Academic Press, San Diego
  25. Picard, V., Ersdal-Badju, E., Lu, A., and Bock, S. C. (1994) Nucleic Acids Res. 22, 2587-2591 [Abstract/Free Full Text]
  26. Pogge von Strandmann, E., Zoidl, C., Nakhei, H., Holewa, B., Pogge von Strandmann, R., Lorenz, P., Klein-Hitpass, L., and Ryffel, G. U. (1995) Protein Eng. 8, 733-735 [Free Full Text]
  27. Walter, P., and Blobel, G. (1983) Methods Enzymol. 96, 84-93 [Medline] [Order article via Infotrieve]
  28. Pelham, H. R., and Jackson, R. J. (1976) Eur. J. Biochem. 67, 247-256 [Medline] [Order article via Infotrieve]
  29. Laemmli, U. K. (1970) Nature 227, 680-685 [CrossRef][Medline] [Order article via Infotrieve]
  30. Eisenberg, D., Schwarz, E., Komaromy, M., and Wall, R. (1984) J. Mol. Biol. 179, 125-142 [CrossRef][Medline] [Order article via Infotrieve]
  31. Kyte, J., and Doolittle, R. F. (1982) J. Mol. Biol. 157, 105-132 [CrossRef][Medline] [Order article via Infotrieve]
  32. Walter, P., and Johnson, A. E. (1994) Annu. Rev. Cell Biol. 10, 87-119 [CrossRef]
  33. Rottier, P., Brandenburg, D., Armstrong, J., and van der Zeijst, B. (1984) Proc. Natl. Acad. Sci. U. S. A. 81, 1421-1425 [Abstract/Free Full Text]
  34. Locker, J. K., Rose, J. K., Horzinek, M. C., and Rottier, P. J. (1992) J. Biol. Chem. 267, 21911-21918 [Abstract/Free Full Text]
  35. Connolly, T., Collins, P., and Gilmore, R. (1989) J. Cell Biol. 108, 299-307 [Abstract/Free Full Text]
  36. Andersson, A. M., Melin, L., Persson, R., Raschperger, E., Wikstrom, L., and Pettersson, R. F. (1997) J. Virol. 71, 218-225 [Abstract]
  37. Al-Barazi, H. O., and Colberg-Poley, A. M. (1996) J. Virol. 70, 7198-7208 [Abstract/Free Full Text]
  38. Kurjan, J., and Herskowitz, I. (1982) Cell 30, 933-943 [CrossRef][Medline] [Order article via Infotrieve]
  39. Ciechanover, A., Heller, H., Elias, S., Haas, A. L., and Hershko, A. (1980) Proc. Natl. Acad. Sci. U. S. A. 77, 1365-1368 [Abstract/Free Full Text]
  40. Wilkinson, K. D., Urban, M. K., and Haas, A. L. (1980) J. Biol. Chem. 255, 7529-7532 [Abstract/Free Full Text]
  41. Bretscher, M. S., and Munro, S. (1993) Science 261, 1280-1281 [Free Full Text]
  42. Takeuchi, K., and Lamb, R. A. (1994) J. Virol. 68, 911-919 [Abstract/Free Full Text]
  43. Creighton, T. E. (ed) (1992) Protein Folding, W. H. Freeman and Co., New York
  44. Gething, M.-J., McCammon, K., and Sambrook, J. (1986) Cell 46, 939-950 [CrossRef][Medline] [Order article via Infotrieve]
  45. Bergeron, J. J. M., Brenner, M. B., Thomas, D. Y., and Williams, D. B. (1994) Trends Biochem. Sci. 19, 124-128 [CrossRef][Medline] [Order article via Infotrieve]
  46. DebRoy, C. (1990) Gene (Amst.) 88, 275-277 [CrossRef][Medline] [Order article via Infotrieve]
  47. Khadr, A., Tikoo, S. K., Babiuk, L. A., and van Drunen Littel-van den Hurk, S. (1996) Gene (Amst.) 168, 189-193 [CrossRef][Medline] [Order article via Infotrieve]
  48. Johnson, M. A., Prideaux, C. T., Kongsuwan, K., Tyack, S. G., and Sheppard, M. (1995) Arch. Virol. 140, 623-634 [CrossRef][Medline] [Order article via Infotrieve]
  49. Baumeister, J., Klupp, B. G., and Mettenleiter, T. C. (1995) J. Virol. 69, 5560-5567 [Abstract]
  50. Zhao, Y., Holden, R., Harty, R. N., and O'Callaghan, D. J. (1992) J. Virol. 66, 5363-5372 [Abstract/Free Full Text]
  51. Ren, D., Lee, L. F., and Coussens, P. M. (1994) Virology 204, 242-250 [CrossRef][Medline] [Order article via Infotrieve]
  52. Davison, A. J., and Scott, E. J. (1986) J. Gen. Virol. 67, 1759-1816 [Abstract/Free Full Text]
  53. Thompson, J. D., Higgins, D. G., and Gibson, T. J. (1994) Nucleic Acids Res. 22, 4673-4680 [Abstract/Free Full Text]

Volume 272, Number 52, Issue of December 26, 1997 pp. 33305-33311
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Virol.Home page
E. Avitabile, G. Lombardi, T. Gianni, M. Capri, and G. Campadelli-Fiume
Coexpression of UL20p and gK Inhibits Cell-Cell Fusion Mediated by Herpes Simplex Virus Glycoproteins gD, gH-gL, and Wild-Type gB or an Endocytosis-Defective gB Mutant and Downmodulates Their Cell Surface Expression
J. Virol., August 1, 2004; 78(15): 8015 - 8025.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
E. Avitabile, G. Lombardi, and G. Campadelli-Fiume
Herpes Simplex Virus Glycoprotein K, but Not Its Syncytial Allele, Inhibits Cell-Cell Fusion Mediated by the Four Fusogenic Glycoproteins, gD, gB, gH, and gL
J. Virol., June 15, 2003; 77(12): 6836 - 6844.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
T. P. Foster, X. Alvarez, and K. G. Kousoulas
Plasma Membrane Topology of Syncytial Domains of Herpes Simplex Virus Type 1 Glycoprotein K (gK): the UL20 Protein Enables Cell Surface Localization of gK but Not gK-Mediated Cell-to-Cell Fusion
J. Virol., December 6, 2002; 77(1): 499 - 510.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
T. P. Foster, G. V. Rybachuk, and K. G. Kousoulas
Glycoprotein K Specified by Herpes Simplex Virus Type 1 Is Expressed on Virions as a Golgi Complex-Dependent Glycosylated Species and Functions in Virion Entry
J. Virol., December 15, 2001; 75(24): 12431 - 12438.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
K. L. Mossman, R. Sherburne, C. Lavery, J. Duncan, and J. R. Smiley
Evidence that Herpes Simplex Virus VP16 Is Required for Viral Egress Downstream of the Initial Envelopment Event
J. Virol., July 15, 2000; 74(14): 6287 - 6299.
[Abstract] [Full Text]


Home page
J. Virol.Home page
P. Dietz, B. G. Klupp, W. Fuchs, B. Köllner, E. Weiland, and T. C. Mettenleiter
Pseudorabies Virus Glycoprotein K Requires the UL20 Gene Product for Processing
J. Virol., June 1, 2000; 74(11): 5083 - 5090.
[Abstract] [Full Text]


Home page
J. Immunol.Home page
R. S. B. Milne, C. Mattick, L. Nicholson, P. Devaraj, A. Alcami, and U. A. Gompels
RANTES Binding and Down-Regulation by a Novel Human Herpesvirus-6 {beta} Chemokine Receptor
J. Immunol., March 1, 2000; 164(5): 2396 - 2404.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
T. P. Foster and K. G. Kousoulas
Genetic Analysis of the Role of Herpes Simplex Virus Type 1 Glycoprotein K in Infectious Virus Production and Egress
J. Virol., October 1, 1999; 73(10): 8457 - 8468.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C. Mo, J. Suen, M. Sommer, and A. Arvin
Characterization of Varicella-Zoster Virus Glycoprotein K (Open Reading Frame 5) and Its Role in Virus Growth
J. Virol., May 1, 1999; 73(5): 4197 - 4207.
[Abstract] [Full Text]


Home page
J. Immunol.Home page
B. A. L. Owen and L. R. Pease
TAP Association Influences the Conformation of Nascent MHC Class I Molecules
J. Immunol., April 15, 1999; 162(8): 4677 - 4684.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
T. Terry-Allison, R. I. Montgomery, J. C. Whitbeck, R. Xu, G. H. Cohen, R. J. Eisenberg, and P. G. Spear
HveA (Herpesvirus Entry Mediator A), a Coreceptor for Herpes Simplex Virus Entry, also Participates in Virus-Induced Cell Fusion
J. Virol., July 1, 1998; 72(7): 5802 - 5810.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mo, C.
Right arrow Articles by Holland, T. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mo, C.
Right arrow Articles by Holland, T. C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1997 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement