JBC Transcription and Nuclear Factor Monoclonals

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lehmann, J. M.
Right arrow Articles by Willson, T. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lehmann, J. M.
Right arrow Articles by Willson, T. M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 6, Issue of February 7, 1997 pp. 3137-3140
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

COMMUNICATION:
Activation of the Nuclear Receptor LXR by Oxysterols Defines a New Hormone Response Pathway*

(Received for publication, December 5, 1996)

Jürgen M. Lehmann Dagger §, Steven A. Kliewer Dagger , Linda B. Moore Dagger , Tracey A. Smith-Oliver Dagger , Beverly B. Oliver Dagger , Jui-Lan Su , Scott S. Sundseth par , Deborah A. Winegar par , Daniel E. Blanchard **, Thomas A. Spencer ** and Timothy M. Willson Dagger Dagger

From the Departments of Dagger  Molecular Endocrinology, par  Metabolic Diseases,  Molecular Sciences, and Dagger Dagger  Medicinal Chemistry, Glaxo Wellcome Research and Development, Research Triangle Park, North Carolina 27709 and the ** Department of Chemistry, Dartmouth College, Hanover, New Hampshire 03755

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
FOOTNOTES
REFERENCES


ABSTRACT

Accumulation of cholesterol causes both repression of genes controlling cholesterol biosynthesis and cellular uptake and induction of cholesterol 7alpha -hydroxylase, which leads to the removal of cholesterol by increased metabolism to bile acids. Here, we report that LXRalpha and LXRbeta , two orphan members of the nuclear receptor superfamily, are activated by 24(S),25-epoxycholesterol and 24(S)-hydroxycholesterol at physiologic concentrations. In addition, we have identified an LXR response element in the promoter region of the rat cholesterol 7alpha -hydroxylase gene. Our data provide evidence for a new hormonal signaling pathway that activates transcription in response to oxysterols and suggest that LXRs play a critical role in the regulation of cholesterol homeostasis.


INTRODUCTION

Cholesterol (CH)1 is a major structural constituent of cellular membranes and serves as the biosynthetic precursor for bile acids and steroid hormones. Animal cells can obtain CH endogenously through de novo synthesis from acetyl-CoA or exogenously through receptor-mediated endocytosis of low density lipoproteins. Cells must balance the internal and external sources of CH so as to maintain mevalonate biosynthesis while at the same time avoiding the accumulation of excess CH, which can result in diseases such as atherosclerosis, gallstones, and several lipid storage disorders (1).

CH homeostasis is maintained in part through feedback regulation of the low density lipoprotein receptor gene and at least two genes encoding enzymes in the CH biosynthetic pathway, 3-hydroxy-3-methylglutaryl coenzyme A synthase and 3-hydroxy-3-methylglutaryl coenzyme A reductase (1). Although increases in dietary CH lead to the inhibition of expression of these genes in vivo, it remains unclear whether CH or CH metabolites are responsible for this inhibition (2). Experiments performed in vitro using several different cell lines have indicated that derivatives of CH that are oxygenated on the CH side chain are significantly more potent in the suppression of sterol biosynthesis than CH (3). These oxysterols are produced through the actions of P450 enzymes in various metabolic pathways including bile acid synthesis in the liver and sex hormone synthesis in the adrenal glands. The in vitro activities of oxysterols together with their presence in vivo suggests that oxysterols may serve in metabolic feedback loops to regulate CH homeostasis.

Although CH and its oxysterol metabolites can repress gene transcription, in at least one instance dietary CH has been shown to stimulate gene expression. Expression of the cholesterol 7alpha -hydroxylase (CYP7A) gene, which encodes the enzyme responsible for the initial and rate-limiting step in the conversion of CH to bile acids (4), is up-regulated in rats fed a CH-rich diet (5-7). This stimulatory effect provides a regulatory mechanism whereby excess dietary CH can be converted to more polar bile acids for subsequent removal from the body. Although the molecular mechanism is unknown, induction of CYP7A expression in the presence of CH occurs at the level of gene transcription (8, 9).

A variety of CH derivatives, including steroid hormones and vitamin D, exert effects on gene expression through interactions with members of the nuclear receptor superfamily (10). Members of this family function as ligand-activated transcription factors by binding to short stretches of DNA, termed hormone response elements, present in the regulatory regions of target genes. In addition to the nuclear receptors with known ligands, this superfamily includes a large number of structurally related members that contain DNA binding domains and putative ligand binding domains but lack identified ligands, the so-called "orphan receptors."

In this report, we have identified a binding site for the orphan nuclear receptor LXRalpha in the proximal promoter region of the rat CYP7A gene. LXRalpha and the closely related orphan receptor LXRbeta are broadly expressed and bind to DNA as heterodimers with the retinoid X receptors (RXRs) (11-14). As part of an effort to identify natural LXR ligands, we have found that the oxysterols 24(S),25-epoxycholesterol and 24(S)-hydroxycholesterol activate both LXRalpha and LXRbeta at concentrations consistent with those found in tissue extracts. Our results provide evidence for a novel oxysterol signaling pathway regulating hepatic CH homeostasis that may also be important in mediating other cellular and developmental effects of CH.


MATERIALS AND METHODS

Chemical Reagents

24(S),25-epoxycholesterol, 24(R),25-epoxycholesterol, 24(S)-hydroxycholesterol, and 24(R)-hydroxycholesterol were prepared as described previously (20, 21). 24-Ketocholesterol was synthesized from cholenic acid by conversion to the Weinreb amide and reaction with isopropyl magnesium chloride. All other compounds were obtained through commercial sources (Sigma; Steraloids).

Plasmids

To generate the plasmids pSG5-mLXRalpha , pSG5-hLXRbeta , and pSG5-hRXRalpha , the cDNAs encoding the murine LXRalpha , human LXRbeta , or human RXRalpha were inserted into the expression vector pSG5 (Stratagene). The GAL4-LXR constructs contain in the pSG5 expression vector the translation initiation sequence and amino acids 1-76 of the glucocorticoid receptor fused to the DNA-binding domain of the yeast transcription factor GAL4 (amino acids 1-147) and the SV40 large T antigen nuclear localization signal (APKKKRKVG). The cDNAs encoding amino acids 164-447 and 157-440 of the human LXRalpha and LXRbeta were amplified by polymerase chain reaction and inserted C-terminal to the nuclear localization sequence to generate the plasmids pSG5GAL4-hLXRalpha and pSG5GAL4-hLXRbeta , respectively. The reporter plasmids (CYP7-LXRE)4-tk-CAT and (DR-4)4-tk-CAT were generated by inserting four copies of the CYP7-LXRE (5'-gatcCCTTTGGTCACTCAAGTTCAAGTG) or the DR-4-LXRE (5'-gatcCCTTAGTTCACTCAAGTTCAAGTG) into the BamHI restriction site of pBLCAT2 (29).

Cotransfection Assay

CV-1 cells were plated in 24-well plates in Dulbecco's modified Eagle's medium supplemented with 10% charcoal-stripped fetal calf serum at a density of 1.2 × 105 cells/well. In general, transfection mixes contained 33 ng of receptor expression vector, 100 ng of reporter plasmid, 200 ng of beta -galactosidase expression vector (pCH110, Pharmacia Biotech Inc.), and 166 ng of carrier plasmid. Cells were transfected overnight by lipofection using Lipofectamine (Life Technologies Inc.) according to the manufacturer's instructions. The medium was changed to Dulbecco's modified Eagle's medium supplemented with 10% delipidated calf serum (Sigma), and compound was added for 24 h. Cell extracts were prepared and assayed for chloramphenicol acetyltransferase (CAT) and beta -galactosidase activities as described previously (30).

Gel Mobility Shift Assays

LXRalpha , LXRbeta , and RXRalpha were transcribed and translated in vitro using pSG5-mLXRalpha , pSG5-hLXRbeta , and pSG5-hRXRalpha as templates and the TNT coupled transcription/translation system (Promega). Gel mobility shift assays (20 µl) contained 10 mM Tris (pH 8.0), 40 mM KCl, 0.1% Nonidet P-40, 6% glycerol, 1 mM dithiothreitol, 0.2 µg of poly(dI-dC), 2.5 µl each of in vitro synthesized LXRalpha or LXRbeta , and RXR proteins. The total amount of reticulocyte lysate was maintained constant in each reaction (5 µl) through the addition of unprogrammed lysate. After a 10-min incubation on ice, 1 ng of 32P-labeled oligonucleotide was added, and the incubation continued for an additional 10 min. DNA-protein complexes were resolved on a 4% polyacrylamide gel in 0.5 × TBE (1 × TBE = 90 mM Tris, 90 mM boric acid, 2 mM EDTA). Gels were dried and subjected to autoradiography at -70 °C. Liver nuclear extracts were prepared as described previously (31). In experiments performed with liver nuclear extracts, 5 µg of extract was used, the amount of poly(dI-dC) in each reaction was increased to 8 µg, and DNA-protein complexes were resolved on 8% polyacrylamide gels. The following double-stranded oligonucleotides were synthesized and used in the gel mobility assay (sense strand shown, mutated nucleotides underlined): CYP7-LXRE, GATCCCTTTGGTCACTCAAGTTCAAGTGGATC; mCYP7-LXRE, GATCCCTTTGGTCACTCAAG<UNL>AA</UNL>CAAGTGGATC; and DR-4-LXRE, GATCCCTT<UNL>A</UNL>G<UNL>T</UNL>TCACTCAAGTTCAAGTGGATC.

For the antibody supershift assays, a pool of monoclonal antibodies was used. The antibodies were generated by fusing spleenocytes from an SJL mouse (male, 8 weeks old, Jackson, Bar Harbor, ME) immunized with histidine-tagged recombinant human LXRalpha protein (amino acids 164-447) with mouse myeloma cells as previously described (32).


RESULTS AND DISCUSSION

The CYP7A Promotor Contains an LXR-RXR Heterodimer Binding Site

Previous work had identified a region of the CYP7A promoter that interacts with nuclear proteins and contains a motif that closely resembles known binding sites for members of the nuclear receptor family (15, 16). This putative response element is composed of a nearly perfect tandem repeat of the nuclear receptor half-site recognition sequence AG(G/T)TCA separated by four nucleotides, a so-called DR-4 motif (17). This type of DR-4 response element has been shown to function as a high affinity binding site for heterodimers between RXR and the orphan nuclear receptors LXRalpha and LXRbeta (11-14).

To investigate whether the DR-4 motif in the CYP7A promoter could function as an LXR response element, we performed a series of gel retardation assays. First, to verify that the in vitro synthesized receptor proteins were functional, we used an oligonucleotide in which two nucleotides in the 5' half-site of the CYP7A direct repeat sequence were mutated to obtain an idealized, tandem repeat of the AGTTCA motif (Fig. 1A, DR4-LXRE). Consistent with previous findings (11-14), a strong complex was formed when either LXRalpha or LXRbeta was added together with RXR, indicating that high affinity DNA binding required the formation of LXR-RXR heterodimers (Fig. 1B, lane 3). Interestingly, a weaker complex migrating slightly faster than the LXR-RXR heterodimer was observed when LXRalpha was used in the absence of RXR (Fig. 1B, lane 1), suggesting the weak binding of an LXR homodimeric complex. In experiments performed with an oligonucleotide containing the CYP7A DR-4 element (Fig. 1A), strong binding was observed with both the LXRalpha -RXR and LXRbeta -RXR heterodimers (Fig. 1B, lane 6). This binding was sequence-specific because an excess of either the unlabeled CYP7 oligonucleotide or the idealized DR-4-LXRE oligonucleotide (Fig. 1B, lanes 7-10) competed efficiently for binding to the probe, but no competition for binding was seen with an oligonucleotide in which the 3' half-site had been mutated to a consensus glucocorticoid receptor half-site (mCYP7-LXRE) (Fig. 1, A and B, lanes 11 and 12). As observed with the DR-4-LXRE, a weak and slightly faster migrating complex of a potential LXRalpha homodimer was seen when LXRalpha was added alone to the CYP7A direct repeat element (Fig. 1B, lane 4). Based on these data, we refer to the DR-4 of the CYP7A promoter as the CYP7-LXRE.


Fig. 1. LXR response element in the proximal CYP7A promoter. A, schematic representation of the CYP7A gene and the sequences of the CYP7-LXRE located between nucleotides -72 and -57. For comparison, the sequences of the idealized DR-4-LXRE and the mCYP7-LXRE, in which the second half-site has been mutated to the GR recognition sequence, are shown. Arrows indicate potential response element half-site motifs. B, LXR binds with high affinity to the CYP7-LXRE as a heterodimer with RXR. Gel mobility shift assays are shown in which mLXRalpha (upper panel), hLXRbeta (lower panel), hRXRalpha , or a combination of LXR and RXR were incubated as indicated with radiolabeled probes corresponding to CYP7-LXRE or DR-4-LXRE. Specificity of the binding complex was tested by adding a 5- or 25-fold molar excess of CYP7-LXRE, DR-4-LXRE, or mCYP7-LXRE as indicated.
[View Larger Version of this Image (39K GIF file)]


LXRalpha is abundantly expressed in the liver (11, 12), the site of CYP7A expression. To determine whether endogenously expressed LXRalpha bound to the CYP7-LXRE, we prepared nuclear extracts from rat liver for use in gel retardation assays. A strong, shifted complex was observed in assays performed with the CYP7-LXRE and liver extracts (Fig. 2B, lane 3) that migrated at the same position as the one obtained with in vitro synthesized LXR and RXR protein (Fig. 2B, lane 1). A portion of this complex was supershifted (Fig. 2B, lane 4) upon the addition of a pool of monoclonal antibodies that specifically recognizes the LXRalpha but not the LXRbeta ligand binding domain (Fig. 2A). An analogous supershifted complex was seen in experiments performed with these antibodies and in vitro synthesized LXRalpha and RXR (Fig. 2B, lane 2). These data show that LXRalpha is one of the components present in liver extracts that binds to the CYP7-LXRE.


Fig. 2. LXRalpha in liver nuclear extracts binds to the CYP7-LXRE. A, in vitro synthesized LXRalpha -RXRalpha or LXRbeta -RXRalpha was incubated with radiolabeled CYP7-LXRE probe in the presence or the absence of a pool of monoclonal antibodies (Ab-LXRalpha ) generated against the LXRalpha ligand binding domain (amino acids 164-447). The arrow indicates the position of the antibody supershifted LXRalpha -RXR heterodimer. No supershifted complex was seen when the pool of antibodies was incubated with LXRbeta -RXRalpha or PPAR-RXRalpha (data not shown). B, in vitro synthesized LXRalpha -RXRalpha or nuclear extract prepared from rat liver was incubated with radiolabeled CYP7-LXRE probe in the presence or the absence of a pool of monoclonal antibodies (Ab-LXRalpha ). The arrow indicates the position of the antibody supershifted LXRalpha -RXR heterodimer.
[View Larger Version of this Image (20K GIF file)]


Oxysterols Activate LXRalpha and LXRbeta

The presence of a binding site for LXR in the promoter of the CYP7A gene, which encodes the rate-limiting enzyme responsible for the conversion of CH to bile acids, prompted us to test a comprehensive set of CH precursors and metabolites including bile acids, oxysterols, and steroids for their ability to activate LXRalpha or LXRbeta in cotransfection experiments (Fig. 3A). The compounds were initially tested using chimeric receptor proteins containing the ligand binding domains of either LXRalpha or LXRbeta fused to the DNA binding domain of the yeast transcription factor GAL4 (18). The use of chimeric receptors allowed us to avoid complications in the interpretation of the results caused by endogenous nuclear receptors as well as to identify compounds that mediated their effects through the ligand binding domains of these orphan receptors. Expression plasmids encoding the chimeric receptors were cotransfected into CV-1 cells together with a reporter plasmid containing five copies of the GAL4-binding site upstream of the minimal tk promoter driving the expression of CAT. All compounds were tested on the chimeric receptors at a concentration of 10 µM.


Fig. 3. Sterols with oxygenated cholesterol side chains are efficacious activators of LXRalpha and LXRbeta . A, CV-1 cells were cotransfected with expression plasmids for the GAL4-hLXRalpha (open bars) and GAL4-hLXRbeta (black bars) chimeras and the reporter plasmid (UAS)5-tk-CAT. Cells were then incubated for 24 h with dimethyl sulfoxide control or the indicated compound at a concentration of 10 µM. Normalized CAT activity was determined and plotted as fold activation relative to vehicle-treated cells. Results shown represent the average of three independent experiments performed in duplicate. DHEA, dehydroepiandrosterone. B, chemical structures of cholesterol, 24(S),25-epoxycholesterol, and 24(S)-hydroxycholesterol.
[View Larger Version of this Image (22K GIF file)]


As shown in Fig. 3A, neither of the LXR chimeras was activated in response to CH or its precursors lanosterol and desmosterol. Interestingly, however, significant activation of both the LXRalpha and LXRbeta chimeras was observed in transfected cells treated with the oxysterols 20(S)-, 22(R)-, and 24(S)-hydroxycholesterol (Fig. 3A). 25- and 27-hydroxycholesterol had relatively little or no effect on either LXR chimera (Fig. 3A). Notably, activation of the LXRs was more efficient with the naturally occurring 22(R)- and 24(S)-hydroxycholesterol enantiomers than with the synthetic 22(S)- and 24(R)-hydroxycholesterol stereoisomers. We note that while this manuscript was in preparation, several of these oxysterols were shown to activate LXRalpha (19). 24-Keto-cholesterol was also an efficacious activator of both LXRs (Fig. 3A). In contrast, no activation of either LXRalpha or LXRbeta was seen in the presence of additional, downstream intermediates in the steroid hormone biosynthetic pathway or in the presence of testosterone or progesterone (Fig. 3A). 7alpha -Hydroxycholesterol, its bile acid derivatives chenodeoxycholic acid and cholic acid, or bile salts also failed to activate the LXR chimeras (data not shown). In addition, steroids with the 3alpha -hydroxyl configuration were inactive (data not shown).

In addition to the various hydroxycholesterol derivatives, we also examined the activity of 24(S),25-epoxycholesterol (Fig. 3B). 24(S),25-Epoxycholesterol is derived from a shunt in the mevalonate pathway in which squalene epoxide, rather than undergoing cyclization to lanosterol, is instead metabolized to 24(S),25-epoxycholesterol (20). 24(S),25-epoxycholesterol has been identified in cultured cells (21) and in tissue homogenates prepared from human and rat livers (22, 23, 28). Because 24(S),25-epoxycholesterol is derived from a biosynthetic pathway different from that of any of the other oxysterols, it has been proposed that this epoxide might serve as a signaling molecule in the feedback regulation of CH biosynthesis (23). Indeed, we found that 24(S),25-epoxycholesterol was an efficacious activator of both LXRs (Fig. 3A). Taken together, the results of these transfecton studies indicate that the optimal structural requirement for LXR activation is a 3beta -sterol with an oxygen substituent at C-24 capable of forming a hydrogen bond.

24(S),25-Epoxycholesterol and 24(S)-Hydroxycholesterol Are Potent Activators of LXRalpha and LXRbeta

We next wished to determine whether the potencies of these oxysterols in the activation of the LXRs were consistent with their known abundance in vivo. Three of these compounds are particularly abundant in tissue extracts. 24(S)-hydroxycholesterol is present in brain extracts at concentrations of roughly 100 µM. Although its physiological relevance is not known, these high concentrations have led to 24(S)-hydroxycholesterol being termed "cerebrosterol." Although circulating levels of 24(S)-hydroxycholesterol are low in adults (~50 nM), this concentration can be elevated as much as 10-fold in children (24). 24(S),25-Epoxycholesterol has been isolated from human or rat livers at concentrations estimated to be 1-5 µM (22, 23, 28). Finally, 22(R)-hydroxycholesterol is present in adrenal extracts at micromolar concentrations. Other oxysterols are present in the circulation or in tissue extracts at concentrations that are nanomolar or lower (25).

We performed dose response analysis using expression plasmids for full-length LXRalpha or LXRbeta . Reporter constructs were generated that contained four copies of either the CYP7-LXRE or the idealized DR-4-LXRE driving CAT gene expression. In preliminary experiments performed with 10 µM 24(S),25-epoxycholesterol, we found that LXRalpha induced expression of both the CYP7A-LXRE-CAT and DR-4-LXRE-CAT reporter constructs but that LXRbeta only efficiently induced expression of the DR-4-LXRE-CAT reporter construct (data not shown). We speculate that LXRbeta may not bind to the CYP7A-LXRE with sufficient affinity to activate reporter expression. Subsequent dose response analyses with LXRalpha and LXRbeta were performed with the CYP7A-LXRE-CAT and DR-4-LXRE-CAT reporter constructs, respectively. LXRalpha and LXRbeta responded to 24(S),25-epoxycholesterol with EC50 values of 7.5 and 1.5 µM, respectively (Fig. 4A). 24(R),25-Epoxycholesterol, which has not been found to occur naturally, was significantly less active with an EC greater than 10 µM on both LXRs. 24(S)-Hydroxycholesterol had an activation profile similar to that of 24(S),25-epoxycholesterol on the LXRs, activating LXRalpha and LXRbeta with EC50 values of 7 and 1.5 µM, respectively (Fig. 4B). The synthetic isomer 24(R)-hydroxycholesterol was at least 1 order of magnitude less active. 20(R)-Hydroxycholesterol, 22(R)-hydroxycholesterol, and 24-ketocholesterol displayed EC50 values for LXR activation that were greater than 10 µM (data not shown).


Fig. 4. Dose reseponse analysis of LXRalpha and LXRbeta with both enantiomers of 24-hydroxycholesterol and 24,25-epoxycholesterol. Expression plasmids for mLXRalpha (open symbols) or hLXRbeta (closed symbols) were cotransfected into CV-1 cells with the CYP7-LXRE or DR-4-LXRE reporter construct, respectively. Transfected cells were treated for 24 h with the indicated concentrations of 24(S),25-epoxycholesterol (circles) or 24(R),25-epoxycholesterol (squares) (A) or of 24(S)-hydroxycholesterol (circles) or 24-(R)-hydroxycholesterol (squares) (B). Normalized CAT activity was determined and plotted as the percentage of the maximal response obtained.
[View Larger Version of this Image (31K GIF file)]


Based upon these data, we suggest that 24(S),25-epoxycholesterol, which is abundant in liver, and 24(S)-hydroxycholesterol, which is abundant in brain, may function as endogenous activators of LXRalpha and LXRbeta . We note that both LXRs are expressed in the liver. Interestingly, Northern analyses have demonstrated that LXRbeta is expressed in the brain (14). More detailed in situ studies have shown that LXRbeta is broadly expressed in fetal brain and that its expression becomes more restricted in postnatal and adult brains (26). Taken together, these findings support the suggestion that 24(S)-hydroxycholesterol may serve in the development and function of the brain via interactions with LXRbeta (22).

In summary, we have demonstrated that the LXRs are activated by the oxysterols 24(S),25-epoxycholesterol and 24(S)-hydroxycholesterol at concentrations consistent with those found in tissues. It is well known that oxysterols suppress de novo CH biosynthesis as well as cellular uptake of CH (1). However, oxysterols have a number of other biological effects including marked effects on DNA synthesis and cell growth and proliferation (25). Our data suggest that some of these effects may be mediated through the LXRs. It is interesting that the nuclear receptor family member most closely related to the LXRs is the insect ecdysone receptor (12, 13, 15). Ecdysone is a sterol hydroxylated at the 22 and 25 positions that functions as a temporal signal to coordinate tissue-specific morphogenetic changes during insect development (27). The use of nuclear receptor pathways as a means to transduce the effects of oxygenated sterols thus appears to have been conserved throughout a large part of evolution, from insects to man.


FOOTNOTES

*   This research was supported in part by Grant HL52069 from the National Institutes of Health (to T. A. S.). The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§   To whom correspondence should be addressed: Glaxo Wellcome Research and Development, 5 Moore Dr., Research Triangle Park, NC 27709. Tel.: 919-483-6332; Fax: 919-483-6147; E-mail: jml30414{at}glaxo.com.
1    The abbreviations used are: CH, cholesterol; CYP7A, cholesterol 7alpha -hydroxylase; RXR, retinoid X receptor; CAT, chloramphenicol acetyltransferase; DR, direct repeat; tk, thymidine kinase.

REFERENCES

  1. Goldstein, J. L., and Brown, M. S. (1990) Nature 343, 425-430 [CrossRef][Medline] [Order article via Infotrieve]
  2. Lund, E., and Björkhem, I. (1995) Acc. Chem. Res. 28, 241-249 [CrossRef]
  3. Kandutsch, A. A., Chen, H. W., and Heiniger, H.-J. (1978) Science 201, 498-501 [Abstract/Free Full Text]
  4. Myant, N. B., and Mitropoulos, K. A. (1977) J. Lipid Res. 18, 135-153 [Medline] [Order article via Infotrieve]
  5. Jelinek, D. E., Andersson, S., Slaughter, C. A., and Russell, D. W. (1990) J. Biol. Chem. 265, 8190-8197 [Abstract/Free Full Text]
  6. Li, Y. C., Wang, D. P., and Chiang, J. Y. L. (1990) J. Biol. Chem. 265, 12012-12019 [Abstract/Free Full Text]
  7. Ramirez, M. I., Karaoglu, D., Haro, D., Barillas, C., Bashirzadeh, R., and Gil, G. (1994) Mol. Cell. Biol. 14, 2809-2821 [Abstract/Free Full Text]
  8. Pandak, W. M., Li, Y. C., Chiang, J. Y. L., Studer, E. J., Gurley, E. C., Heuman, D. M., Vlahcevic, Z. R., and Hylemon, P. B. (1991) J. Biol. Chem. 266, 3416-3421 [Abstract/Free Full Text]
  9. Russel, D. W., and Setchell, K. D. R. (1992) Biochemistry 31, 4737-4749 [CrossRef][Medline] [Order article via Infotrieve]
  10. Mangelsdorf, D. J., Thummel, C., Beato, M., Herrlich, P., Schütz, G., Umesono, K., Blumberg, B., Kastner, P., Mark, M., Chambon, P., and Evans, R. M. (1995) Cell 83, 835-839 [CrossRef][Medline] [Order article via Infotrieve]
  11. Apfel, R., Benbrook, D., Lernhardt, E., Ortiz, M. A., Salbert, G., and Pfahl, M. (1994) Mol. Cell. Biol. 14, 7025-7035 [Abstract/Free Full Text]
  12. Willy, P. J., Umesono, K., Ong, E. S., Evans, R. M., Heyman, R. A., and Mangelsdorf, D. J. (1995) Genes & Dev. 9, 1033-1045 [Abstract/Free Full Text]
  13. Song, C., Kokontis, J. M., Hiipakka, R. A., and Liao, S. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 10809-10813 [Abstract/Free Full Text]
  14. Teboul, M., Enmark, E., Li, Q., Wikström, A. C., Pelto-Huikko, M., and Gustafsson, J.-A. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 2096-2100 [Abstract/Free Full Text]
  15. Hoekman, M. F. M., Rientjes, J. M. J., Twisk, J., Planta, R. J., Princen, H. M. G., and Mager, W. H. (1993) Gene (Amst.) 130, 217-223 [CrossRef][Medline] [Order article via Infotrieve]
  16. Chiang, J. Y. L., and Stroup, D. (1994) J. Biol. Chem. 269, 17502-17507 [Abstract/Free Full Text]
  17. Umesono, K., Murakami, K. K., Thompson, C. C., and Evans, R. M. (1991) Cell 65, 1255-1266 [CrossRef][Medline] [Order article via Infotrieve]
  18. Lehmann, J. M., Moore, L. B., Smith-Oliver, T. A., Wilkison, W. O., Willson, T. M., and Kliewer, S. A. (1995) J. Biol. Chem. 270, 12953-12956 [Abstract/Free Full Text]
  19. Janowski, B. A., Willy, P. J., Rama Devi, T., Falck, J. R., and Mangelsdorf, D. J. (1996) Nature 383, 728-731 [CrossRef][Medline] [Order article via Infotrieve]
  20. Nelson, J. A., Steckbeck, S. R., and Spencer, T. A. (1981) J. Biol. Chem. 256, 1067-1068 [Abstract/Free Full Text]
  21. Saucier, S. E., Kandutsch, A. A., Taylaor, F. R., Spencer, T. A., Phirwa, S., and Gayen, A. K. (1985) J. Biol. Chem. 260, 14571-14579 [Abstract/Free Full Text]
  22. Spencer, T. A., Gayen, A. K., Phirwa, S., Nelson, J. A., Taylor, F. R., Kandutsch, A. A., and Erickson, S. K. (1985) J. Biol. Chem. 260, 13391-13394 [Abstract/Free Full Text]
  23. Spencer, T. A. (1994) Acc. Chem. Res. 27, 83-90
  24. Lütjohann, D., Breuer, O., Ahlborg, G., Nennesmo, I., Siden, A., Diczfalusy, U., and Björkhem, I. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 9799-9804 [Abstract/Free Full Text]
  25. Smith, L. L., and Johnson, B. H. (1989) Free Radical Biol. & Med. 7, 285-332 [CrossRef][Medline] [Order article via Infotrieve]
  26. Kainu, T., Kononen, J., Enmark, E., Gustafsson, J. A., and Peltohuikko, M. (1996) J. Mol. Neurosci. 7, 29-39 [CrossRef][Medline] [Order article via Infotrieve]
  27. Thummel, C. S. (1995) Cell 83, 871-877 [CrossRef][Medline] [Order article via Infotrieve]
  28. Taylor, F. R., Kandutsch, A. A., Gayen, A. K., Nelson, J. A., Steckbeck Nelson, S., Phirwa, S., and Spencer, T. A. (1986) J. Biol. Chem. 261, 15039-15044 [Abstract/Free Full Text]
  29. Luckow, B., and Schütz, G. (1987) Nuclei Acids Res. 15, 5490 [Free Full Text]
  30. Husmann, M., Lehmann, J., Hoffmann, B., Hermann, T., Tzukerman, M., and Pfahl, M. (1991) Mol. Cell. Biol. 11, 4097-4103 [Abstract/Free Full Text]
  31. Gorski, K., Carneiro, M., and Schiebler, U. (1986) Cell 47, 767-776 [CrossRef][Medline] [Order article via Infotrieve]
  32. Su, J.-L., Becherer, J. D., Edwards, C., Bukhart, W., McGeehan, G. M., and Champion, B. R. (1995) Hybridoma 14, 383-390 [Medline] [Order article via Infotrieve]

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Lipid Res.Home page
C. A. Major, K. Ryan, A. J. Bennett, A. L. Lock, D. E. Bauman, and A. M. Salter
Inhibition of stearoyl CoA desaturase activity induces hypercholesterolemia in the cholesterol-fed hamster
J. Lipid Res., July 1, 2008; 49(7): 1456 - 1465.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
M. Ouimet, M.-D. Wang, N. Cadotte, K. Ho, and Y. L. Marcel
Epoxycholesterol Impairs Cholesteryl Ester Hydrolysis in Macrophage Foam Cells, Resulting in Decreased Cholesterol Efflux
Arterioscler. Thromb. Vasc. Biol., June 1, 2008; 28(6): 1144 - 1150.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
K. Wang and Y.-J. Y. Wan
Nuclear Receptors and Inflammatory Diseases
Experimental Biology and Medicine, May 1, 2008; 233(5): 496 - 506.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Smoak, J. Madenspacher, S. Jeyaseelan, B. Williams, D. Dixon, K. R. Poch, J. A. Nick, G. S. Worthen, and M. B. Fessler
Effects of Liver X Receptor Agonist Treatment on Pulmonary Inflammation and Host Defense
J. Immunol., March 1, 2008; 180(5): 3305 - 3312.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
K. R. Stayrook, P. M. Rogers, R. S. Savkur, Y. Wang, C. Su, G. Varga, X. Bu, T. Wei, S. Nagpal, X. S. Liu, et al.
Regulation of Human 3{alpha}-Hydroxysteroid Dehydrogenase (AKR1C4) Expression by the Liver X Receptor {alpha}
Mol. Pharmacol., February 1, 2008; 73(2): 607 - 612.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Zhou, W. He, Z. Huang, A. M. Gotto Jr., D. P. Hajjar, and J. Han
Genetic Deletion of Low Density Lipoprotein Receptor Impairs Sterol-induced Mouse Macrophage ABCA1 Expression: A NEW SREBP1-DEPENDENT MECHANISM
J. Biol. Chem., January 25, 2008; 283(4): 2129 - 2138.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Wong, C. M. Quinn, I. C. Gelissen, and A. J. Brown
Endogenous 24(S),25-Epoxycholesterol Fine-tunes Acute Control of Cellular Cholesterol Homeostasis
J. Biol. Chem., January 11, 2008; 283(2): 700 - 707.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Yan, M. I. Mayranpaa, J. Wong, J. Perttila, M. Lehto, M. Jauhiainen, P. T. Kovanen, C. Ehnholm, A. J. Brown, and V. M. Olkkonen
OSBP-related Protein 8 (ORP8) Suppresses ABCA1 Expression and Cholesterol Efflux from Macrophages
J. Biol. Chem., January 4, 2008; 283(1): 332 - 340.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
S. Talukdar, S. Bhatnagar, S. Dridi, and F. B. Hillgartner
Chenodeoxycholic acid suppresses the activation of acetyl-coenzyme A carboxylase-{alpha} gene transcription by the liver X receptor agonist T0-901317
J. Lipid Res., December 1, 2007; 48(12): 2647 - 2663.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. A. Birrell, M. C. Catley, E. Hardaker, S. Wong, T. M. Willson, K. McCluskie, T. Leonard, S. N. Farrow, J. L. Collins, S. Haj-Yahia, et al.
Novel Role for the Liver X Nuclear Receptor in the Suppression of Lung Inflammatory Responses
J. Biol. Chem., November 2, 2007; 282(44): 31882 - 31890.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
B. Herzog, M. Hallberg, A. Seth, A. Woods, R. White, and M. G. Parker
The Nuclear Receptor Cofactor, Receptor-Interacting Protein 140, Is Required for the Regulation of Hepatic Lipid and Glucose Metabolism by Liver X Receptor
Mol. Endocrinol., November 1, 2007; 21(11): 2687 - 2697.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
M. Heverin, S. Meaney, A. Brafman, M. Shafir, M. Olin, M. Shafaati, S. von Bahr, L. Larsson, A. Lovgren-Sandblom, U. Diczfalusy, et al.
Studies on the Cholesterol-Free Mouse: Strong Activation of LXR-Regulated Hepatic Genes When Replacing Cholesterol With Desmosterol
Arterioscler. Thromb. Vasc. Biol., October 1, 2007; 27(10): 2191 - 2197.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
C. C. van der Hoogt, W. de Haan, M. Westerterp, M. Hoekstra, G. M. Dallinga-Thie, J. A. Romijn, H. M. G. Princen, J. W. Jukema, L. M. Havekes, and P. C. N. Rensen
Fenofibrate increases HDL-cholesterol by reducing cholesteryl ester transfer protein expression
J. Lipid Res., August 1, 2007; 48(8): 1763 - 1771.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
E. K.-H. Chow, B. Razani, and G. Cheng
Innate immune system regulation of nuclear hormone receptors in metabolic diseases
J. Leukoc. Biol., August 1, 2007; 82(2): 187 - 195.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. E. Matsukuma, L. Wang, M. K. Bennett, and T. F. Osborne
A Key Role for Orphan Nuclear Receptor Liver Receptor Homologue-1 in Activation of Fatty Acid Synthase Promoter by Liver X Receptor
J. Biol. Chem., July 13, 2007; 282(28): 20164 - 20171.
[Abstract] [Full Text] [PDF]


Home page
Toxicol PatholHome page
C. G. Woods, J. P. Vanden Heuvel, and I. Rusyn
Genomic Profiling in Nuclear Receptor-Mediated Toxicity
Toxicol Pathol, June 1, 2007; 35(4): 474 - 494.
[Abstract] [PDF]


Home page
J. Lipid Res.Home page
H. Fuda, N. B. Javitt, K. Mitamura, S. Ikegawa, and C. A. Strott
Oxysterols are substrates for cholesterol sulfotransferase
J. Lipid Res., June 1, 2007; 48(6): 1343 - 1352.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. Geyeregger, M. Zeyda, W. Bauer, E. Kriehuber, M. D. Saemann, G. J. Zlabinger, D. Maurer, and T. M. Stulnig
Liver X receptors regulate dendritic cell phenotype and function through blocked induction of the actin-bundling protein fascin
Blood, May 15, 2007; 109(10): 4288 - 4295.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. M. Beyea, C. L. Heslop, C. G. Sawyez, J. Y. Edwards, J. G. Markle, R. A. Hegele, and M. W. Huff
Selective Up-regulation of LXR-regulated Genes ABCA1, ABCG1, and APOE in Macrophages through Increased Endogenous Synthesis of 24(S),25-Epoxycholesterol
J. Biol. Chem., February 23, 2007; 282(8): 5207 - 5216.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
T. Li, W. Chen, and J. Y. L. Chiang
PXR induces CYP27A1 and regulates cholesterol metabolism in the intestine
J. Lipid Res., February 1, 2007; 48(2): 373 - 384.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
W. A. Alrefai, F. Annaba, Z. Sarwar, A. Dwivedi, S. Saksena, A. Singla, P. K. Dudeja, and R. K. Gill
Modulation of human Niemann-Pick C1-like 1 gene expression by sterol: role of sterol regulatory element binding protein 2
Am J Physiol Gastrointest Liver Physiol, January 1, 2007; 292(1): G369 - G376.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
D. D. Moore, S. Kato, W. Xie, D. J. Mangelsdorf, D. R. Schmidt, R. Xiao, and S. A. Kliewer
International Union of Pharmacology. LXII. The NR1H and NR1I Receptors: Constitutive Androstane Receptor, Pregnene X Receptor, Farnesoid X Receptor {alpha}, Farnesoid X Receptor beta, Liver X Receptor {alpha}, Liver X Receptor beta, and Vitamin D Receptor
Pharmacol. Rev., December 1, 2006; 58(4): 742 - 759.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
K. E. Matsukuma, M. K. Bennett, J. Huang, L. Wang, G. Gil, and T. F. Osborne
Coordinated control of bile acids and lipogenesis through FXR-dependent regulation of fatty acid synthase
J. Lipid Res., December 1, 2006; 47(12): 2754 - 2761.
[Abstract] [Full Text] [PDF]


Home page