JBC Advanced Glycation Endproducts

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cuevo, R. S.
Right arrow Articles by Horowitz, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cuevo, R. S.
Right arrow Articles by Horowitz, J. M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 6, Issue of February 7, 1997 pp. 3813-3822
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Detection and Functional Characterization of p180, a Novel Cell Cycle Regulated Yeast Transcription Factor That Binds Retinoblastoma Control Elements*

(Received for publication, May 17, 1996, and in revised form, November 11, 1996)

Raymund S. Cuevo Dagger , Stephen Garrett § and Jonathan M. Horowitz par **

From the Departments of  Molecular Cancer Biology, par  Microbiology, Dagger  Medicine, and § Biochemistry, Duke University Medical Center, Durham, North Carolina 27710

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
Acknowledgments
REFERENCES


ABSTRACT

In recent years it has become apparent that the cellular machinery governing cell cycle progression and transcription control are often homologous in yeast and mammalian cells. We and others have previously shown that the SP family of mammalian transcription factors regulates the transcription of a number of genes whose activities are governed by the product of the retinoblastoma (Rb) susceptibility gene, including c-FOS, c-MYC, TGFbeta -1, IGF-II, and c-JUN. To determine whether a similar pathway of transcriptional regulation may function in yeast, we explored the possibility that transcription factors with nucleotide-binding specificities akin to those of the SP family are expressed in Saccharomyces cerevisiae and Schizosaccharomyces pombe. Here we report the detection of novel yeast proteins (S. cerevisiae, p180; S. pombe, p200) that specifically bind Rb-regulated promoter elements in vitro dependent on nucleotides that are also required for binding and trans-activation by SP family members in vivo. Our results indicate that the S. cerevisiae retinoblastoma control element-binding activity 1) requires zinc for association with DNA; 2) does not bind to SCB, MCB, or E2F sites in vitro; 3) is cell cycle-regulated in a SWI6-independent fashion; and 4) maximally stimulates retinoblastoma control element-mediated transcription in early- to mid-S phase. Taken together, these data suggest that p180 may regulate the transcription of a subset of yeast genes whose expression is coincident with the onset and/or progression of DNA replication.


INTRODUCTION

Functional inactivation of the retinoblastoma (Rb)1 protein is associated with the genesis of a number of human tumors, including retinoblastoma, osteosarcoma, and breast, bladder, and small cell lung carcinomas (for reviews see Refs. 1, 2). The Rb protein is believed to control cell proliferation at least in part via the transcriptional regulation of a wide variety of growth-related genes. Although capable of associating with DNA in a sequence-nonspecific fashion, Rb regulates transcription indirectly via its physical or functional interaction with trans-acting factors that specifically bind to DNA (3). To date, nearly a dozen sequence-specific DNA-binding proteins have been shown to be targets of Rb function in vivo. Interestingly, the functional consequence of Rb's interaction with these transcription factors is dependent on the factors themselves and the cell types in which their interaction is analyzed.

The transcriptional response of a subset of Rb-regulated genes, including c-FOS, c-MYC, TGFbeta -1, IGF-II, and c-JUN, is dependent on GC-rich promoter elements termed retinoblastoma control elements (RCEs, Refs. 3-8). At least three ubiquitously expressed nuclear proteins (retinoblastoma control proteins, RCPs), including SP1 and SP3, bind to RCEs in vitro, and the interaction of one or more of these proteins with RCEs in vivo is required for RCE-mediated transcription (7, 9-11). Co-expression of Rb and SP1 or SP3 in transient transfection assays leads to a marked stimulation of RCE transcription, a phenomenon we have termed "superactivation" (10, 11). Regions of Rb that are targets of mutation in human tumors are required for Rb-mediated superactivation, suggesting that the functional interaction of Rb with SP1/SP3 plays a significant role in the regulation of cell cycle progression (11). The mechanism(s) by which Rb stimulates SP-mediated transcription has yet to be clearly defined. Physical interactions between Rb and members of the SP family of transcription factors have not as yet been detected in vitro or in vivo perhaps suggesting that Rb interacts with these transcription factors in the context of a large macromolecular complex. Consistent with this supposition, Rb has been proposed to modulate the transcriptional activity of SP family members via their liberation from negative regulators or by indirectly "bridging" their trans-activation domains to components of the basal transcription machinery (8, 12, 13). Trans-activation mediated by transcription factors such as ATF-2, NF-IL6, MYOD, and myogenin is also stimulated and/or facilitated by Rb in vivo (14-17). Unlike SP family members, Rb forms physical complexes with these latter factors although the mechanism by which Rb augments their transcriptional activity has not as yet been determined. In contrast to these functional effects, interactions of Rb with transcription factors such as E2F, ELF-1, and UBF lead to the suppression of transcriptional activity (18-20). Rb forms cell cycle-regulated complexes with factors such as E2F and ELF-1 in vivo, sequestering their trans-activation domains from components of the basal transcription complex (18, 19, 21). Hence, Rb is believed to control the transcription of at least some cell cycle-regulated genes via periodic interactions with sequence-specific DNA-binding proteins.

The Rb protein is phosphorylated in concert with the progression of the mammalian cell cycle. Quiescent cells, post-mitotic cells, and cells in early G1 carry un- or underphosphorylated Rb protein (22-25). In cycling cells, Rb becomes increasingly phosphorylated on serine and threonine residues beginning in late G1 (the "restriction point") and extending through G2 and then is abruptly de-phosphorylated in anaphase (26). Rb is a substrate of a number of cyclin-dependent kinases (cdks), including cyclin D/CDK4 and cyclin E/CDK2 (27). In addition, a novel cell cycle-regulated Rb and histone H1 kinase has recently been described that associates with the Rb amino terminus in G2/M phases (28, 29). Given that the initiation of DNA synthesis occurs subsequent to Rb phosphorylation, it is widely suspected that phosphorylation of Rb is a necessary step for normal cells to transit through the G1/S boundary. This view is consistent with the observations that 1) transcription factors that control gene expression at the G1/S boundary, such as E2F, are bound exclusively by un- or underphosphorylated Rb; and 2) phosphorylation of Rb by cdks in vitro inactivates Rb as an inhibitor of E2F-mediated transcription (18, 21, 30).

The recent identification of homologues of E2F and Rb in Drosophila and suggestions of an Rb-like protein in plants serves to support the contention that a conserved pathway of transcriptional regulation may operate in many, if not all, eukaryotic cells (31-35). To date, a structural homologue of Rb has not been identified in yeast, but proteins that are similar to mammalian targets of Rb function have been noted. For example, a 47-kDa factor in Saccharomyces cerevisiae that specifically binds E2F sites in a cell cycle-dependent fashion has been reported, and a similar factor has been detected in Schizosaccharomyces pombe (36, 37). In concert with these findings, when expressed in S. cerevisiae Rb is phosphorylated by yeast cdks at sites that are targets of phosphorylation in mammalian cells (38). Moreover, Rb phosphorylation in yeast appears to be temporally controlled in a manner that is similar to that which occurs in mammalian cells; Rb is phosphorylated prior to the initiation of DNA synthesis in yeast coincident with the cell cycle checkpoint termed "Start" (27). Given these observations, it is tempting to speculate that yeast may harbor proteins functionally analogous to Rb that integrate progression of the cell cycle with transcriptional regulation. Yet, exogenous expression of human Rb in yeast does not appreciably alter cell cycle progression, suggesting that should yeast carry Rb-like proteins their targets of function may not be closely related to their mammalian counterparts (37).

In S. cerevisiae, cell cycle-regulated transcription of a number of critical genes has been shown to be at least partly dependent on two heterodimeric transcription factors, SBF and MBF, and their interaction with SCB (SWI4-SWI6 cell cycle box) and MCB (MluI cell cycle box) promoter elements, respectively (39, 40). SCB promoter elements (5'-CACGAAA-3') govern the periodic transcription of genes such as the HO endonuclease and cyclins (CLN1 and CLN2). MCB elements (5'-ACGCGTNA-3') direct the transcription of a variety of genes including many required at the G1/S boundary for entry into S phase, such as thymidylate synthase (TMP1) and B-type cyclins (CLB5 and CLB6). SBF is composed of the SWI4 and SWI6 proteins, whereas active MBF complexes result from the heterodimerization of MBP1 and SWI6 proteins. Transcription factors that are structurally and functionally similar to SWI4, SWI6, and MBP1 have also been isolated from S. pombe (40). Given that RCEs share limited sequence homology (5'-GCGCCACC-3') with yeast SCB and MCB elements, we hypothesized that RCEs might represent a related family of cell cycle-regulated yeast promoter elements. Furthermore, we speculated that yeast RCE-binding proteins might be functionally, and perhaps structurally, homologous with mammalian RCPs. In this report we characterize the biochemical and functional properties of a novel cell cycle-regulated RCE-binding protein, p180, that is synthesized in S. cerevisiae and whose DNA-binding domain is functionally homologous to that of SP1, SP3, and perhaps other members of the SP family of mammalian transcription factors.


EXPERIMENTAL PROCEDURES

Strains and Culture Conditions

Table I lists the yeast strains used in this study. Cells were grown in YEPD (1% yeast extract, 2% peptone, 2% dextrose) at 30 °C or in selective SDmin media for strains transformed with URA3-based plasmids. For cell cycle studies, temperature-sensitive cdc mutants were grown in YEPD at 23 °C to an A600 nm of 0.4, pelleted, resuspended in prewarmed YEPD, and incubated at 37 °C for 5 h. Arrest was confirmed by documenting terminal arrest phenotypes under light microscopy. Cdc17 cells arrest heterogeneously at S phase (38 °C) or G2 (34 °C) and were treated at 38 °C in this study (41).

Table I.

Yeast strain list and source


Strain Relevant genotype

S. cerevisiae
  YRC1 MATa ura3 his3 leu2 TRP1 ade8 ras1::HIS3 bar1::LEU2 RAS2 CAN cyhrr (this study)
  BY600 MATa swi6 Delta TRP1-197 ade2 holacZ ura3 leu2-3,-112 trp1-1 can1-100 met- (Linda Breeden, University of Washington)
  BY602 MATa SWI+ (Linda Breeden)
  BY606 MATa swi4 Delta leu2-194 (Linda Breeden)
  H6C1A1 MATa ural his7 cdc6 (Daniel Burke, University of Virginia)
  H13C1A1 MATa ural his7 cdc13 (Daniel Burke)
  H28C1A5 MATa his7 hom3 can1 cdc28 (Daniel Burke)
  H16C1A2 MATa ural his7 cdc16-2 (Daniel Burke)
  H23C1A1 MATa ural his7 cdc23-1 (Daniel Burke)
  H17C1A1 MATa ural his7 cdc17-1 (Daniel Burke)
  H2C2A2 MATa ural his7 cdc2-2 (Daniel Burke)
  MSY272 MATa bar1 his6 cdc7-1 leu2,3,112 ura3-52 trpl-287 (Daniel Burke)
  7546-22 MATa ura3 cdc14 his7 can1 cyh2 (Daniel Burke)
  753F16 MATa ura3 cdc15 his7 can1 cyh2 (Daniel Burke)
  DLY204 MATa cln2::LEU2 ura3 trpl his2 ade1 bar1 (Daniel Lew, Duke University)
S. pombe
  972h- (Thomas Chappell, I.C.R.F., UK)

Plasmid Constructions

A high copy, URA3-based plasmid (pJLB; 42) containing a UAS-less cytochrome c (CYC1) promoter upstream of the LACZ gene was a kind gift from Stephen Johnston (University of Texas-Southwestern, Dallas, TX). A synthetic oligonucleotide and its complement carrying three tandem copies of an octameric p180-binding site (pNUT; 5'-TCGAGCGCCACCGCGCCACCGCGCCACC-3') or a mutated derivative and its complement lacking a p180-binding site (pWEE; 5'-TCGAGCTTCACCGCTTCACCGCTTCACC-3') were cloned upstream of the CYC1 promoter at a unique XhoI site. Plasmids containing one or two copies of pNUT or one to three copies of pWEE upstream of LACZ were identified by double-stranded DNA sequencing (43) and named pNUT1, pNUT2, pWEE1, pWEE2, and pWEE3, respectively. To further differentiate between independent clones that were examined for beta -galactosidase activity, a lowercase letter was appended to each plasmid name (e.g. pNUT2b is a second clone with two copies of a wild-type trimer). Cell transformations and beta -galactosidase assays were performed using previously described protocols (44). To quantify p180-mediated transcription as a function of cell cycle progression, a mutated derivative of the CLN2 gene (Cln2x/s; a kind gift of David Stuart, Scripps Research Institute, La Jolla, CA) encoding a nonfunctional protein was cloned downstream of a p180-dependent promoter by linking together a 1.5-kb DNA fragment containing the pNUT2b promoter, a 1.5-kb DNA fragment of pUC19CLN2x/s,2 and plasmid pRS306, a single copy URA3-containing vector (45). A plasmid dependent on a promoter lacking a p180-binding site, pWEE3a, was prepared in a similar manner. The resulting plasmids, pNUT2bCLN2x/s and pWEE3aCln2x/s, carry the defective CLN2 gene in the same transcriptional orientation as URA3. High copy plasmids carrying these CLN2 reporter genes were prepared by transferring pNUT- or pWEE-dependent genes to plasmid pRS202, a URA3-containing vector,3 producing plasmids P5Cln202 and W1Cln202, respectively.

Protein-DNA Binding Assays

Yeast extracts were prepared by bead-beating 1 × 109 cells for 30 min at 4 °C following their suspension in 1.0 M Tris-HCl (pH 7.5), 0.2 M NaCl, 5 mM EDTA, 20% glycerol, 90 mM beta -mercaptoethanol, 1 mM phenylmethylsulfonyl fluoride, 20 µg/ml pepstatin A and leupeptin (Sigma). This suspension was clarified by centrifugation at 16,000 × g at 4 °C. Supernatants were transferred to tubes containing an equal volume of 0.5 M HEPES (pH 7.4), 30 mM KCl, 0.4 mM EDTA, 20% glycerol, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 20 µg/ml pepstatin A, and 20 µg/ml leupeptin; protein concentrations were determined by a colorimetric assay (Bio-Rad), and aliquots were stored at -80 °C. Radiolabeled probes were prepared and employed in protein-DNA binding assays as described previously (9, 46). Oligonucleotides used as radiolabeled probes or competitor DNAs are listed in Table II. Radiolabeled probes had a specific activity of 105 cpm/ng DNA, and 1-2 × 105 cpm of probe was typically combined with 5 µg of yeast proteins. Competition experiments with unlabeled oligonucleotides typically employed a 50-200-fold molar excess of DNA relative to radiolabeled probes. Following resolution on polyacrylamide gels and transfer to paper, protein-DNA binding assays were exposed to film (Kodak XAR-5) for 2 days at -80 °C or directly analyzed in a PhosphorImager (Molecular Dynamics, Inc., Sunnyvale, CA).

Table II.

Wildtype and mutated oligonucleotides

Nucleotides required for binding of relevant transcription factors are underlined. Mutated nucleotides are denoted by italics.
Name Sequence Reference

Fos 5'-CCCGC<UNL>GCGCCACC</UNL>CCTCTG<UNL>GCGCCACC</UNL>GTG-3' 9
5'RCP- 5'-CCCGC<UNL><IT>AAAAA</IT>ACC</UNL>CCTCTG<UNL>GCGCCACC</UNL>GTG-3' This study
3'RCP- 5'-CCCGC<UNL>GCGCCACC</UNL>CCTCTG<UNL><IT>AAAAA</IT>ACC</UNL>GTG-3' This study
dbl RCP- 5'-CCCGC<UNL><IT>AAAAAA</IT>CC</UNL>CCTCTG<UNL><IT>AAAAAA</IT>CC</UNL>GTG-3' 10
dbl E2F- 5'-CCCGC<UNL>G<IT>TT</IT>CCACC</UNL>CCTCTG<UNL><IT>AA</IT>GCCACC</UNL>GTG-3' This study
3'Fos-WT             5'-CCCTCTG<UNL>GCGCCACC</UNL>GTG-3' 9
5'Fos-WT 5'-CCCGC<UNL>GCGCCACC</UNL>CCTCT-3' 9
5'Fos-8 5'-CTTGC<UNL>GCGCCACC</UNL>CCTCT-3' 9
5'Fos-4 5'-CCCTT<UNL>GCGCCACC</UNL>CCTCT-3' 9
5'Fos-3 5'-CCCGC<UNL><IT>TT</IT>GCCACC</UNL>CCTCT-3' 9
5'Fos-2 5'-CCCGC<UNL>GC<IT>TT</IT>CACC</UNL>CCTCT-3' 9
5'Fos-1 5'-CCCGC<UNL>GCGC<IT>TT</IT>CC</UNL>CCTCT-3' 9
5'Fos-5 5'-CCCGC<UNL>GCGCCA<IT>TT</IT></UNL>CCTCT-3' 9
5'Fos-6 5'-CCCGC<UNL>GCGCCACC</UNL>TTTCT-3' 9
5'Fos-7 5'-CCCGC<UNL>GCGCCACC</UNL>CCAAT-3' 9
RCE7       (5'-<UNL>GCCACC</UNL>CCTCT-3') × 6 This study
pNUT 5'-TCGA<UNL>GCGCCACCGCGCCACCGCGCCACC</UNL>-3' This study
pWEE 5'-TCGA<UNL>GC<IT>TT</IT>CACCGC<IT>TT</IT>CACCGC<IT>TT</IT>CACC</UNL>-3' This study
HIP 5'AATTCTGCGA<UNL>TTTCGCGCCAAA</UNL>CTTGACG-3' 49
E/J 5'AATTCTGCGA<UNL>TTTC<IT>T</IT>CGC<IT>A</IT>AAA</UNL>CTTGACG-3' 49
MCB 5'-G<UNL>ACGCGT</UNL>CTCGAG<UNL>ACGCGT</UNL>C-3' 58
SCB 5'-GACATGTGCGT<UNL>CACGAAAA</UNL>AAGAAATCAATC-3' 59
AP-1 5'-GATCTAAAA<UNL>TGAGTCA</UNL>AGTGG-3' 60
GCN4 5'-CTAGACGGGCG<UNL>ATGACTCAT</UNL>CGCCCGT-3' 46
HIS3 5'-TCGAGCGG<UNL>ATGACTCT</UNL>TTTTTTTTC-3' 61

Photoaffinity Labeling

A plasmid carrying six copies of the sequence 5'-GCCACCCCTCT-3' (RCE7, Table II) was cleaved with EcoRI and XbaI liberating a DNA fragment that was used as a template for primer extension from the EcoRI end of the probe. Primer extension was carried out using a synthetic primer (5'-CGAGCTCGCCC-3'), bromodeoxyuridine (BUdR, Sigma), dTTP, dATP, radiolabeled dGTP and dCTP (3000 Ci/mmol; ICN Biomedicals, Inc., Irvine, CA), and Klenow enzyme (New England BioLabs, Beverly, MA) as described elsewhere (9). A BUdR-substituted probe (12 × 106 cpm) with a specific activity of 109 cpm/ng was employed in a protein-DNA binding assay with 35 µg of yeast proteins. Following resolution on a polyacrylamide gel, protein-DNA complexes were irradiated by UV light in situ and visualized by exposure of the gel to film, and excised complexes were applied to an SDS-polyacrylamide gel. Following electrophoresis, dried gels were exposed to film for 2 days at -80 °C. Apparent molecular weights of resulting protein-DNA complexes were determined by comparison with molecular weight markers resolved in parallel.

Synchronization of Yeast Cells with alpha  Factor

Yeast cultures were grown in YEPD to approximately A600 nm = 0.5 at 30 °C, and alpha  factor pheromone (Sigma) was added to a final concentration of 10 ng/ml. After 2.5 h of incubation, cell cycle arrest was confirmed by microscopic examination. Cells were then pelleted, resuspended in 3 ml of sterile deionized water, sonicated, and added to fresh, prewarmed YEPD media. Subsequently, 50 ml of cells were collected by centrifugation at 15-min intervals for the preparation of protein extracts or RNA. Small aliquots of cells were also fixed in 4 volumes of 3.7% formaldehyde, 0.15 M NaCl to establish a budding index by microscopic inspection. Fresh, prewarmed YEPD was added every 45 min during synchronous growth to maintain a stable concentration of cells. Cultures of cells containing high copy reporter plasmids were grown in YEPD because synchrony was not optimal in selective minimal media. No more than 7% of cells (as determined by replica plating onto YEPD and selective minimal media plates) lost their respective plasmids during synchronous growth in YEPD.

Northern Blot Analysis

RNA extracts were obtained using a modification of a previously described procedure (47). Briefly, cells were resuspended in a sodium acetate buffer and treated with 1% SDS. Phenol equilibrated in sodium acetate buffer was added to disrupted cells and incubated at 70 °C for 4 min with periodic agitation. The mixture was cooled rapidly for 10-15 s in an ethanol/dry ice bath and subsequently clarified by centrifugation. The aqueous phase was re-extracted with phenol and finally with chloroform, and RNA was precipitated and resuspended in distilled H2O. Following quantification by UV spectroscopy, 10 µg of RNA was resolved in a 1.8% agarose-formaldehyde gel as described previously (48) and then transferred to BioTrans+ filters (ICN Biomedicals, Inc. Irvine, CA). Blots were baked, prehybridized, and hybridized with 2 × 106 cpm/ml (specific activity of 0.8-1.0 × 109 cpm/µg DNA) of radiolabeled probe. Radiolabeled probes used for these studies were prepared from a 1.5-kb BamHI fragment of pUC19Cln2x/s, a BamHI-BglII fragment of pSKACT1 (ACT1 probe), and a HindIII fragment of pMS202 (copy II of the yeast histone H4 gene; Ref. 49). Probes were prepared using a random primer kit following instructions of the manufacturer (Promega, Inc., Madison, WI). Following washing, blots were quantified by PhosphorImaging (Molecular Dynamics) and subjected to autoradiography (Hyperfilm-MP, Amersham Corp.). Blots were stripped prior to the addition of supplementary probes by agitating in several exchanges of boiling 0.1% SDS.

Analysis of S. cerevisiae Genome Data Base

The S. cerevisiae genome data base maintained by the Stanford University Department of Genetics was examined for the occurrence of RCE sites by employing the FASTA algorithm (50) available at their website (http://genome-www.stanford.edu/Saccharomyces/).


RESULTS

Proteins That Specifically Bind Retinoblastoma Control Elements (RCEs) Are Expressed in S. cerevisiae and S. pombe

To determine whether S. cerevisiae and/or S. pombe express RCE-binding proteins (RCE-BPs), a 31-base pair oligonucleotide corresponding to the human c-FOS RCE was radiolabeled and employed with yeast extracts in protein-DNA binding ("gel-shift") assays. As shown in Fig. 1, several protein-DNA complexes resulted when this oligonucleotide was incubated with either yeast extract. To determine if one or more of these protein-DNA complexes results from the specific association of yeast proteins with the c-FOS RCE, excess unlabeled homologous or heterologous oligonucleotides were added as competitor DNAs. For both S. cerevisiae and S. pombe extracts, a single slowly migrating protein-DNA complex is eliminated by excess unlabeled homologous oligonucleotides (Fig. 1, +Fos) but not by an irrelevant oligonucleotide carrying binding sites for the transcription factor AP-1 (Fig. 1, +AP-1). The abundance of additional faster migrating protein-DNA complexes was not appreciably affected by the inclusion of either competitor oligonucleotide, and we have found that their abundance in yeast extracts is quite variable, often being undetectable (for example see Fig. 2). To determine if yeast RCE-BPs require nucleotides for complex formation that are shared with mammalian RCPs, we employed two mutated RCE oligonucleotides that have previously been shown to strongly interact (Fig. 1, 5'Fos-4) or not interact (Fig. 1, 5'Fos-5) with SP1 and SP3 (9). As shown in Table II, oligonucleotides 5'Fos-4 and 5'Fos-5 include 18 nucleotides derived from the 5'-half of the c-FOS RCE and carry dinucleotide substitutions that respectively increase or abolish mammalian RCP-binding activity relative to wild-type sequences. Akin to our previous result with mammalian RCPs, the abundance of the slowest migrating yeast protein-DNA complexes was abolished by inclusion of an excess of 5'Fos-4 and not appreciably diminished by 5'Fos-5 (Fig. 1). Wild-type oligonucleotides corresponding to RCEs within the TGFbeta -1 and c-MYC promoters also eliminated the slowest migrating protein-DNA complex when employed as competitors in parallel protein-DNA binding assays (data not shown). Thus, S. cerevisiae and S. pombe express at least one protein that specifically binds RCEs in vitro. As is more clearly illustrated in the rightmost panel of Fig. 1, we note that the specific protein-DNA complex detected in S. cerevisiae extracts migrates slightly faster than its counterpart in S. pombe extracts.


Fig. 1. Protein-DNA binding assays with S. cerevisiae and S. pombe cell extracts and a radiolabeled c-FOS RCE oligonucleotide. Full-length c-FOS RCE oligonucleotides (FOS in Table II) were radiolabeled and incubated with yeast cell extracts alone (-) or in conjunction with a 200-fold molar excess of unlabeled competitor oligonucleotides that carry (+Fos, +5'Fos-4) or lack (+AP-1, +5'Fos-5) mammalian RCP-binding activity. Following resolution on a native 4% polyacrylamide gel and transfer to paper, protein-DNA complexes were visualized by autoradiography for 2 days at -80 °C.
[View Larger Version of this Image (97K GIF file)]



Fig. 2. Protein-DNA binding assays with S. cerevisiae cell extracts and radiolabeled wild-type and mutated c-FOS RCE oligonucleotides. Protein-DNA binding assays were performed as in Fig. 1. A, radiolabeled wild-type c-FOS oligonucleotides were incubated with yeast cell extracts alone (-) or in conjunction with a 200-fold molar excess of competitor oligonucleotides that carry (+Fos, +5'Fos-WT, +3'Fos-WT, +5'Fos-4, +5'Fos-6, +5'Fos-7, +5'Fos-8, +5'RCP-, +3'RCP-, +dbl E2F-) or lack (+AP-1, +5'Fos-1, +5'Fos-2, +5'Fos-3, +5'Fos-5, +dbl RCP-) mammalian RCP-binding activity. B, wild-type (WT) and mutated c-FOS RCE oligonucleotides were radiolabeled and incubated with cell extracts as above. C, effect of zinc chelation of the formation of yeast protein-RCE complexes. Yeast extracts were incubated with (+EDTA) or without (-) EDTA for 10 min at room temperature prior to addition of radiolabeled wild-type c-FOS RCE oligonucleotides supplemented with excess ZnCl2 (+Zn) or MgCl2 (+Mg). Final concentrations of ZnCl2 and MgCl2 were 1 mM and EDTA was 0.25 mM.
[View Larger Version of this Image (58K GIF file)]


Yeast and Mammalian RCE-binding Proteins Require Identical Nucleotides and Zinc for DNA Binding

To extend our comparison of mammalian and yeast RCE-binding proteins and map nucleotides that are important for protein-DNA complex formation, protein-DNA binding assays were performed in the presence of a large panel of synthetic oligonucleotides whose RCP-binding activities have been previously established with mammalian cell extracts (9). As shown in Table II, these additional oligonucleotides carry hexanucleotide or dinucleotide substitutions within discrete portions of the c-FOS RCE. Consistent with our previous results for SP1, the slowly migrating protein-DNA complex detected in S. cerevisiae extracts was abolished in competition experiments with the 5' (5'Fos-WT) and the 3' (3'Fos-WT) octameric repeats of the c-FOS RCE (Fig. 2A; Ref. 10). These results indicate that as for SP1, both octameric sites within the c-FOS RCE are bound by yeast RCE-BPs. This conclusion is supported by evidence that mutational disruption of both octameric sites (dbl RCP-) generates an oligonucleotide with little or no protein-binding activity, whereas mutations within either the 5' (5'RCP-) or 3' (3'RCP-) octameric repeat result in oligonucleotides that function as competitors (Fig. 2A). To further map the nucleotides required for yeast RCE-binding activity, synthetic oligonucleotides containing dinucleotide mutations within the 5' 18 bases of the c-FOS RCE were employed as competitor DNAs. An excess of mutants 5'Fos-1, -2, -3, and -5, which contain dinucleotide mutations within the octameric repeat, were unable to compete for the formation of the single yeast protein-DNA complex. In contrast, inclusion of synthetic oligonucleotides carrying dinucleotide substitutions outside the octameric site (mutants 5'Fos-4, -6, -7, and -8) did not diminish RCE-binding activity. Taken together, these data indicate that the minimum RCE nucleotides required for binding of yeast RCE-BPs is the octameric 5'-GCGCCACC-3' sequence. A similar series of experiments performed with S. pombe extracts gave identical results (data not shown). To confirm that mutated oligonucleotides carrying dinucleotide substitutions retained or lost their ability to bind yeast RCE-BPs, a panel of wild-type and mutated c-FOS oligonucleotides were examined directly for yeast RCE-BP-binding activity. Each oligonucleotide was radiolabeled and incubated with yeast extracts, and protein-DNA complexes were resolved by electrophoresis. Consistent with earlier protein-DNA binding assays, those oligonucleotides that do not function as competitors (mutants 5'Fos-1, -2, -3, and -5) also did not form protein-DNA complexes when examined as radiolabeled probes (Fig. 2B). Additionally, mutated oligonucleotides that function as competitors had wild-type protein-binding activity (Fig. 2B, mutants 5'Fos-6, -7, and -8). Interestingly and consistent with our previous results using mammalian cell extracts, mutant 5'Fos-4 has greater protein-binding activity than wild-type RCE oligonucleotides (Fig. 2B). In summary, we conclude from these results that extracts prepared from S. cerevisiae and S. pombe carry at least one protein that forms specific protein-DNA complexes with the c-FOS RCE. Moreover, nucleotides required for the formation of these complexes are identical to those required for the binding of mammalian RCPs, such as SP1 and SP3. These data suggest that the DNA-binding domains of yeast and mammalian RCE-binding proteins are functionally, and perhaps structurally, conserved. Consistent with the notion that yeast RCE-BPs may be structurally related to SP family members, addition of potent zinc chelating agents, such as EDTA or 1,10-phenanthroline, to yeast extracts inhibits the formation of protein-RCE complexes in a zinc-dependent manner (Fig. 2C and data not shown).

Yeast RCE-binding Proteins Do Not Bind E2F, SCB, or MCB Elements and Do Not Require SWI4 or SWI6 for DNA-binding Activity

Since RCE nucleotides required for the binding of yeast proteins in vitro are similar to those found in yeast SCB and MCB elements, we wished to determine whether such elements could compete for the formation of yeast RCE-BP·RCE complexes. Additionally, since the RCE-BP-binding site of a mutated RCE oligonucleotide with increased affinity for yeast proteins (5'Fos-4; 5'-TTGCGCCACC-3') resembles the consensus site for the mammalian transcription factor E2F (5'-TTTCGCGC-3'), we wished to determine whether yeast RCE-BPs might be related to a previously described yeast E2F-like activity (36). Thus, oligonucleotides carrying E2F sites from the mouse DHFR and adenovirus E2 promoters as well as oligonucleotides carrying consensus SCB and MCB elements were analyzed as competitors in protein-DNA binding assays (Table II and Ref. 52). As shown in Fig. 3A, inclusion of a 50- and 100-fold molar excess of oligonucleotides (HIP and E/J; Ref. 51) carrying wild-type and mutated E2F sites from the DHFR promoter did not result in a reduction in RCE protein-DNA complexes. In contrast, an E2F site containing oligonucleotide (E2-WT) derived from the E2 promoter diminished protein-RCE complexes; however, a mutated derivative (E2-Mut) in which the E2F sites were destroyed could also effectively compete for DNA-binding activity (52). Taken together, these data indicate that the DNA-binding domains of yeast RCE-binding proteins are not likely to be functionally analogous to that of E2F. To determine if yeast RCE-BPs bound SCB and MCB elements in vitro, oligonucleotides carrying consensus elements were examined in protein-DNA binding assays. As shown in Fig. 3A, a 100-fold molar excess of these unlabeled oligonucleotides did not diminish the recovery of RCE protein-DNA complexes. To establish if factors important for the binding and trans-activation of SCB and MCB elements may be necessary for yeast RCE-binding activity, extracts were prepared from yeast strains carrying disruptions of SWI4 or SWI6, and these extracts were employed in protein-DNA binding assays. As shown in Fig. 3B, disruption of these genes had no discernible effect on the abundance or mobility of protein-DNA complexes. Thus, we conclude that 1) under the conditions we have employed, yeast RCE-BPs do not bind to E2F, SCB, and MCB elements in vitro and 2) yeast RCE-BPs do not require SWI4 or SWI6 for RCE-binding activity.


Fig. 3. Protein-DNA binding assays with S. cerevisiae cell extracts and radiolabeled wild-type c-FOS RCE oligonucleotides and photoaffinity labeling of yeast RCE-binding proteins. Protein-DNA binding assays were performed as in Fig. 1. A, radiolabeled 5'Fos-4 oligonucleotides were incubated with yeast cell extracts alone (-) or in conjunction with a 50- or 100-fold molar excess of competitor oligonucleotides that carry (+5'Fos-4) or lack (+5'Fos-2) mammalian RCP-binding activity, oligonucleotides that carry wild-type (+HIP, +E2 WT) or mutated (+E/J, +E2 Mut) E2F sites, or oligonucleotides that carry wild-type SCB (+SCB) or MCB (+MCB) yeast promoter elements. B, radiolabeled 5'Fos-4 oligonucleotides were incubated with extracts prepared from wild-type (YRC1, WT; BY602, swi4/6) yeast cells or cells carrying gene disruptions (BY600, swi6; BY606, swi4). Extracts of BY606 were also examined for 5'Fos-4 binding activity in the presence of unlabeled competitor oligonucleotides (+5'Fos-4, +5'Fos-3). C, photoaffinity labeling of S. cerevisiae (left) and S. pombe (right) RCE-binding proteins covalently linked to radiolabeled, BUdR-substituted RCE7 oligonucleotides. Molecular mass markers are indicated on the right.
[View Larger Version of this Image (46K GIF file)]


Yeast RCE-binding Activity Consists of at Least One High Molecular Weight Protein

To determine the number and apparent molecular weight(s) of the yeast RCE-binding proteins, we employed a photoaffinity labeling technique (UV cross-linking) with a multimerized RCE probe (RCE7) that was radiolabeled and substituted with bromodeoxyuridine (BUdR). This probe contains six contiguous copies of an oligonucleotide that spans the middle six bases of the octameric sequence previously shown to be critical for the binding of yeast RCE-BPs (Table II). We have previously used this multimerized probe for the analysis of mammalian RCPs, and prior to UV cross-linking experiments we confirmed that RCE7 would efficiently compete for the binding of yeast RCE-BPs (data not shown). Following radiolabeling and substitution with BUdR, RCE7 was incubated with extracts prepared from S. cerevisiae and S. pombe; protein-DNA complexes were resolved on nondenaturing gels, and bound proteins were covalently cross-linked to the probe in situ via irradiation with UV light. Protein-DNA complexes were excised and subsequently resolved on an SDS-polyacrylamide gel. As shown in Fig. 3C, a single protein-DNA complex with an apparent molecular mass of 180 kDa (denoted p180) was recovered from S. cerevisiae extracts. Consistent with the lessened relative mobility of protein-DNA complexes produced by extracts prepared from S. pombe, similar cross-linking assays performed with S. pombe extracts resulted in the detection of a single protein-DNA complex of approximately 200 kDa (Fig. 3C). The simplest interpretation of these data is that S. cerevisiae and S. pombe express a single large RCE-binding protein that may be cross-linked to DNA. However, we are mindful of the possibility that additional yeast proteins may participate in RCE protein-DNA complexes that were not detected by UV cross-linking. The remaining studies in this report were performed with S. cerevisiae cells and extracts.

RCE-mediated Transcription Is Dependent on an Intact p180-binding Site

To determine if an intact p180-binding site is required for RCE-mediated transcription, a multimer carrying three tandem copies of the octameric site shown to be a target for p180 binding (pNUT; Fig. 4A and Table II) or a multimer carrying three copies of a mutated octamer that lacks a binding site for p180 (pWEE; Fig. 4A and Table II) were cloned upstream of a LACZ reporter gene whose expression is directed by a basal CYC1 promoter (42). In control experiments p180 bound pNUT but not pWEE when examined in protein-DNA binding assays both as probes and unlabeled competitors (data not shown). Asynchronously growing populations of yeast transformed with either construction or the parent plasmid were permeabilized with SDS and chloroform and assayed for beta -galactosidase activity. As shown in Fig. 4B, plasmids carrying one or two copies of the pNUT trimer increased beta -galactosidase activity 31- and 370-fold, respectively, relative to the parent plasmid lacking a p180-binding site. Similar levels of pNUT trans-activation were also obtained in cells lacking SWI6 function (BY600; data not shown). pNUT-mediated trans-activation was also independent of the orientation of the octameric repeat cloned upstream of beta -galactosidase (Fig. 4B). In contrast to results with pNUT, one to three copies of the pWEE trimer resulted in little or no increase in beta -galactosidase activity (Fig. 4B). We conclude from these results that an intact p180-binding site is required for RCE-mediated yeast transcription. Given that a dinucleotide substitution that ablates p180-binding activity in vitro also inactivates transcriptional activity in vivo, these data also strongly suggest that p180 can function as a stimulatory transcription factor.


Fig. 4. Intact p180-binding sites are required for RCE-mediated transcription in vivo. A, sequence of oligonucleotides cloned in single copies or as multimers upstream of the CYC1 promoter and LACZ that carry (pNUT) or lack (pWEE) p180-binding sites. Mutated nucleotides that abrogate p180-binding activity are underlined in pWEE. B, beta -galactosidase activities of cells transformed with plasmids carrying single (e.g. pNUT1a) or multiple copies (e.g. pNUT2a) of oligonucleotides that do (pNUT) or do not (pWEE) bind p180 in vitro. Measurements presented represent the average beta -galactosidase activities of two or three independent cell clones carrying the indicated constructions. Arrowheads indicate the orientation of individual oligonucleotides relative to the site of transcriptional initiation.
[View Larger Version of this Image (33K GIF file)]


p180 Abundance and/or DNA-binding Activity and Resulting Transcription Is Cell Cycle Regulated

Should RCEs function as transcriptional targets of a Rb-like pathway in yeast, we speculated that p180 DNA-binding and/or transcriptional activity might vary in concert with cell cycle progression. This speculation was buoyed by the observation that extracts prepared from cells arrested with nocodazole showed significantly lower p180 DNA-binding activity relative to extracts prepared from asynchronously growing cultures (data not shown). To further examine the abundance of p180 DNA-binding activity during the cell cycle, extracts were prepared from a panel of S. cerevisiae temperature-sensitive cdc mutants grown at the permissive and nonpermissive temperatures. All cdc mutant strains grown asynchronously at the permissive temperature (30 °C) contained significant amounts of p180 DNA-binding activity (Fig. 5, top row of left panel). At the nonpermissive temperature (38 °C), mutants whose functions are required during G1, G2, or M phases showed little or no p180 DNA-binding activity (Fig. 5, center row of left panel), yet these cell extracts are clearly functional since they retained GCN4 DNA binding activity (Fig. 5, bottom row of left panel). In contrast, mutants whose functions are required in early to mid-S phase (cdc6, cdc7, and cdc17) contained wild-type levels of p180 DNA-binding activity. Interestingly, a distinct S phase mutant, cdc2, did not have detectable p180 DNA-binding activity at the nonpermissive temperature for function (Fig. 5, center row of left panel). Importantly, the abundance of p180·DNA complexes were not appreciably altered in extracts prepared from a wild-type strain grown at either temperature. Although these results suggested that p180 abundance and/or DNA-binding activity is maximal during early to mid-S phase, we were concerned that these results might be compromised by artifacts induced by cell cycle arrest and wished to perform similar analyses with synchronously growing cell populations. Thus, cells were synchronized by incubation with alpha  factor, extensively washed and incubated in growth medium, and protein extracts were prepared in 15-min intervals. Equivalent amounts of total cell proteins were subsequently examined in protein-DNA binding assays (Fig. 6A). Microscopic inspection of alpha  factor-treated cells showed that greater than 95% of cells entered S phase synchronously during the course of two population doublings (Fig. 6B). Consistent with evidence from growth-arrested cdc mutants, maximal p180 DNA-binding activity was detected at time points that immediately precede the peak of accumulated budded cells (Fig. 6). The abundance of p180 DNA-binding activity throughout the cell cycle was directly quantified by PhosphorImaging and determined to vary at least 2-fold during the course of two cell cycles.


Fig. 5. Protein-DNA binding assays using extracts prepared from wild-type and cdc strains grown at the permissive (30 °C) or nonpermissive (38 °C) temperatures for function. Radiolabeled 5'Fos-4 or GCN4 oligonucleotides were incubated with cell extracts, and protein-DNA complexes were detected as indicated in Fig. 1. Cdc strains used for these studies as well as the approximate cell cycle position within which their functions are required are indicated at the top left panel of the figure. Protein-DNA complexes resulting from cell extracts from a wild-type strain (YRC1) grown at 30 and 38 °C are shown in the leftmost lane of the left panels for comparison. Left panel, extracts prepared from strains grown at the permissive temperature (top row) and the nonpermissive temperature (center row) for function were examined for p180 binding activity. As a control for extract intergrity, extracts prepared from strains grown at the nonpermissive temperature were also examined for GCN4 DNA-binding activity (bottom row). Right panel, extracts prepared from wild-type cells were incubated with radiolabeled GCN4 oligonucleotides alone (-) or in the presence of a 200-fold molar excess of unlabeled homologous (+GCN4, +HIS3) or heterologous (+5'Fos-4, 5'Fos-5, +MCB) competitor oligonucleotides.
[View Larger Version of this Image (47K GIF file)]



Fig. 6. Cell cycle regulation of p180·DNA complex abundance in synchronized populations of cells. A, protein-DNA binding assays. Extracts prepared from asynchronously growing cells (-), cells arrested with alpha  factor (alpha ), or alpha  factor-treated cells that were washed and incubated in growth medium for varying lengths of time were examined for the abundance of p180·DNA complexes using radiolabeled 5'Fos-4 oligonucleotides. Equal quantities of yeast cell proteins were examined in each lane. B, quantification of p180·DNA complexes as a function of cell cycle progression. The abundance of p180·DNA complexes in the assay shown in A was determined directly using a PhosphorImager and plotted (indicated by triangles) against the percentage of budded cells (indicated by squares) at each time point following alpha  factor arrest.
[View Larger Version of this Image (38K GIF file)]


Since the abundance of p180 DNA-binding activity varies during cell cycle progression, becoming maximal during S phase, we wished to determine whether p180-mediated transcription was similarly regulated. The promoter regions from pNUT2b, containing six copies of a wild-type p180-binding site upstream of a basal CYC1 promoter, or from pWEE3a, containing nine copies of a mutated p180-binding site, were cloned upstream of a disrupted CLN2 gene (clnx/s) and inserted into a high copy URA3-containing vector (pRS202). The resulting constructions (P5Cln202 and W1Cln202, respectively) were subsequently used to transform a yeast strain (DLY204) carrying a disruption of CLN2, and Northern blots carrying total RNAs from cells containing either construction were examined for exogenous CLN2 mRNA with a CLN2-specific probe. DLY204 has previously been shown to express an unstable CLN2 mRNA of 0.6 kb.4 Each transformed yeast strain expressed a minor transcript of 2.0 kb (Fig. 7A, top panel; asterisk) whose synthesis was independent of the integrity of plasmid-borne p180-binding sites. In contrast, a single prominent transcript of 3.0 kb was expressed exclusively in cells carrying plasmids with intact p180-binding sites (Fig. 7A, top panel; CLN). To determine whether the abundance of the 3.0-kb pair mRNA was cell cycle-dependent, cells containing P5Cln202 were synchronized with alpha  factor and then incubated in growth medium. Total RNA was isolated from synchronized cells at 15-min intervals; CLN2 expression was examined with a CLN2-specific probe, and the abundance of the 3.0-kb CLN2 mRNA was directly quantified in a PhosphorImager and normalized to the abundance of actin mRNA (Fig. 7A, middle panel). In successive experiments, the abundance of p180-dependent CLN2 mRNA varied by an average of 3-4-fold during the cell cycle with peaks of transcription occurring coincident with maximal p180 DNA-binding activity (compare Figs. 6B and 7B). In contrast to these results, the abundance of the 2.0-kb CLN2-related mRNA was largely unchanged during the course of these experiments (Fig. 7A, top panel). As an additional measure of cell cycle synchrony and to mark the position of S phase, Northern blots probed for CLN2 mRNA were re-examined for the abundance of histone H4 message. With the exception of RNA harvested from alpha  factor-arrested cells, maximal amounts of p180-dependent CLN2 mRNA were detected coincident with the accumulation of histone H4 mRNA (Fig. 7A, bottom panel; Ref. 53). We do not as yet understand why residual CLN2 mRNA is apparent in alpha  factor-arrested cells. Nonetheless, for populations of synchronously growing cells, cell cycle-regulated fluctuations in p180 DNA-binding activity in vitro are temporally correlated with periodicity in the abundance of RCE-mediated transcription in vivo. Moreover, RCE-mediated transcription is maximal during early- to mid-S phase.


Fig. 7. Cell cycle regulation of RCE-mediated transcription in synchronized populations of cells. As in Fig. 6, cells arrested with alpha  factor were washed and incubated in growth medium for varying lengths of time. A, Northern blots of RNAs prepared from asynchronous (Asynch) and synchronized cells. CLN2 transcripts synthesized by cells carrying plasmids driven by a wild-type RCE, P5Cln202 (pNUT), or mutated RCE, W1Cln202 (pWEE), are depicted in the left panel. Sizes of resulting CLN2 transcripts are depicted on the left. Total cell RNA was prepared from alpha  factor-arrested cells (alpha ) or synchronized populations of cells at the indicated time intervals and examined by Northern blotting. The Northern presented was hybridized with a CLN2-specific probe and then subsequently hybridized with actin and histone H4 probes. An asterisk indicates a CLN2-specific transcript whose synthesis is independent of RCE integrity and cell cycle position. B, quantification of mRNA abundance in synchronized populations of cells. The abundance of each mRNA was determined directly using a PhosphorImager. Levels of RCE-mediated CLN2 transcripts (indicated by triangles) were normalized to those of actin and plotted against the percentage of budded cells (indicated by squares) at each time point following alpha  factor arrest. The relative abundance of CLN2 mRNA at the 15-min time point was arbitrarily assigned a value of 1.0. The abundance of histone H4 mRNA is also indicated (circles) as a function of cell cycle progression.
[View Larger Version of this Image (35K GIF file)]



DISCUSSION

The promoters of a number of Rb-responsive genes (e.g. c-FOS, c-MYC, TGFbeta -1, IGF2, IL6, c-JUN, and c-NEU) carry GC-rich sequences, termed retinoblastoma control elements (RCEs) that are necessary and sufficient for Rb-mediated transcriptional regulation (3). Previous analyses have determined that RCEs are bound by several mammalian proteins (RCPs) in vitro, and these proteins have been revealed to be members of the SP family of transcription factors. To determine if an RCE-like pathway of transcriptional control exists in lower eukaryotes, we sought to identify RCE-binding proteins (RCE-BPs) in yeast cells. We reasoned that if RCEs are evolutionarily conserved promoter elements then yeast RCE-BPs may be functional homologues of Rb-targeted transcription factors (e.g. SP1 or SP3), and the activities of such proteins might be regulated by a yeast Rb-like molecule. This report characterizes a novel transcription factor expressed in S. cerevisiae, termed p180, that specifically binds to RCEs during early- to mid-S phase utilizing nucleotides that are required for binding and trans-activation by SP1/SP3. Directly correlated with this binding activity is a cell cycle-regulated stimulation of RCE-mediated transcription in vivo. We also report that a 200-kDa RCE-binding protein (termed p200) with similar RCE-binding activity is expressed in S. pombe.

Based on photoaffinity labeling experiments, a single high molecular weight RCE-binding protein expressed in S. cerevisiae and S. pombe may be cross-linked to DNA in vitro. We note that these data do not preclude the possibility that additional yeast proteins participate in p180·DNA and p200·DNA complexes or that RCEs are bound and regulated by as yet undetected proteins in vivo. However, given the tight correlation between the nucleotide binding specificity of p180 in vitro and the transcriptional activity of wild-type and mutated RCEs in vivo, this latter possibility is unlikely. Consistent with our cross-linking results, preliminary affinity chromatography experiments indicate that RCE-binding activity in S. cerevisiae extracts co-fractionates with a polypeptide of approximately 180 kDa as well as several smaller proteins.5 Determining whether one or more of these proteins account for p180 DNA-binding activity will require additional rounds of protein purification. We also note that the large apparent molecular weight of yeast RCE-binding proteins is not without precedent as a number of S. cerevisiae transcription factors ranging between 170 and 220 kDa have previously been noted, including MOT1, RIF1, SIN3, and SNF2 (54, 55).

p180 and p200 bind RCEs via nucleotides that are identical to those bound by SP1 and SP3. Dinucleotide substitutions introduced within a 10-base pair sequence, 5'-GCGCGCCACC-3', within the c-FOS RCE dramatically alter the recovery of yeast protein-RCE complexes in vitro and perturb RCE-mediated transcription in vivo. For example, several dinucleotide substitutions within the RCE (5'Fos-1, -2, -3, -5) ablate the binding of p180/p200 and SP family members to RCEs, and a single dinucleotide substitution (5'Fos-4) increases their DNA-binding activity concordantly. That identical mutations similarly affect the DNA-binding activities of yeast and mammalian RCE-binding proteins strongly suggests that their DNA-binding domains are functionally homologous. It is less certain, however, that their respective DNA-binding domains are closely related in structure. Consistent with the notion that yeast and mammalian RCE-binding proteins may be structurally related, we have shown that each requires zinc for DNA-binding activity. The SP family of transcription factors are well characterized "zinc-finger" proteins carrying three tandem zinc-binding motifs of the Cys2-His2 class (56). Although likely to be metalloproteins, whether p180/p200 will be "zinc-finger" proteins of the same or a similar class will require their eventual cloning and sequencing. Despite their common nucleotide specificities and zinc requirement, three additional observations suggest that the primary sequence of the SP family members are not likely to be closely related to that of p180 or other yeast transcription factors. First, using polyclonal antisera prepared against the entirety of the SP1 trans-activation domain, we have been unable to deplete yeast extracts of p180.5 Second, the expression of SP1 in S. cerevisiae does not result in the trans-activation of reporter genes regulated by several SP1-binding sites (57). Moreover, co-expression of a component of the human basal transcription complex, TATA-box binding protein, did not facilitate SP1-mediated yeast transcription. This latter result may indicate that yeast lack one or more general transcription factors necessary for SP1-mediated transcription, perhaps co-activators that bridge glutamine-rich trans-activation domains to the basal transcription complex. Finally, expression of human Rb in S. cerevisiae does not appreciably alter yeast cell growth or progression of the cell cycle (38). Thus, should p180/p200 be structurally related to SP1/SP3 we anticipate that their homology may not extend further than their respective DNA-binding domains.

In accord with the notion that p180 is a cell cycle-regulated transcription factor, we have consistently noted that maximal levels of RCE-mediated transcription are coincident with the peak of histone H4 mRNA abundance. Although we have observed on average a 3-4-fold difference in cell cycle-regulated RCE-mediated transcription, it is possible that this may not accurately reflect the magnitude of periodic p180 activity for the following reasons. First, our trans-activation assays were performed with a promoter construct carrying a wild-type c-FOS RCE cloned upstream of a basal promoter. It is not as yet clear that the c-FOS RCE is an optimal binding site for p180, and it is possible that small perturbations in sequence can greatly affect p180-mediated transcription. For example, dinucleotide substitutions at two distal positions within the RCE (5'Fos-4) result in a substantial increase in p180 DNA-binding activity and resulting trans-activation in vivo.5 Second, it is also likely that the promoter context of p180-binding sites and their juxtaposition to other trans-acting factors and the site of transcriptional initiation may play important roles in the regulation of periodic p180-mediated transcription. Thus, a more definitive cell cycle analysis of p180-mediated transcription will require the identification of genes regulated by p180 and a careful examination of their promoters. Given that p180 DNA-binding activity and RCE-mediated transcription are confined to a temporal "window" of early- to mid-S phase, it is tempting to speculate that p180 may play a role in the trans-activation of 1) genes associated with the biogenesis of DNA and/or 2) other S phase genes, such as histones and the B-type cyclins CLB3 and CLB4 (58, 59). Although sequences closely related to the c-FOS RCE are not contained within the promoters of these S phase genes, evaluating whether p180 plays a role in their regulation will require the cloning and functional characterization of p180. Interestingly, a computer-assisted search of the S. cerevisiae genome data base with the c-FOS RCE revealed predicted sites of p180 binding upstream of the KIP1 and UBC13 genes. KIP1 is a kinesin-related protein required for spindle assembly, and its abundance is maximal in M phase (60).6 UBC13 is thought to encode a ubiquitin-conjugating enzyme; however, it is not known whether its expression is cell cycle-regulated. Whether p180 plays a direct role in the synthesis of these genes remains to be determined. Since p180 does not bind SCB and MCB elements in vitro or require SWI4/SWI6 proteins for DNA-binding or transcriptional activity, we hypothesize that p180 may function as a regulator of a novel subset of periodically transcribed RCE-dependent yeast genes. However, since it is possible that our in vitro DNA binding assays may be insensitive to weak interactions of p180 with SCB/MCB elements, p180-mediated transcription may also partially account for cell viability in the absence of cell cycle regulators such as MBF (39).


FOOTNOTES

*   This work was supported in part by the National Cancer Institute, National Institutes of Health, Grant CA01694 (to R. S. C.) and Grants 3273 from the Council for Tobacco Research and Faculty Research Award A-73970 from the American Cancer Society (to J. M. H.). The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
**   Supported by the Pew Scholars Program in the Biomedical Sciences. To whom correspondence should be addressed: Depts. of Molecular Cancer Biology and Microbiology, Box 3686, Duke University Medical Center, Durham, NC. 27710. Tel.: 919-613-8617; Fax: 919-613-8604; E-mail: jmh{at}galactose.mc.duke.edu.
1    The abbreviations used are: Rb, retinoblastoma; RCP, retinoblastoma control protein; RCE, retinoblastoma control element; kb, kilobase pair(s); BUdR, bromodeoxyuridine.
2    D. Stuart, unpublished data.
3    P. Hieter, personal communication.
4    D. Lew, personal communication.
5    R. S. Cuevo and J. M. Horowitz, unpublished observations.
6    D. M. Roof, personal communication.

Acknowledgments

We are indebted to Daniel Lew for helpful discussions and for providing yeast strains as well as K. Helen Kranbuhl and Philip Borden for technical assistance. We also thank Daniel Burke and Linda Breeden for providing mutant yeast strains, Peggy Farnham for oligonucleotides, and David Stuart and Joseph R. Nevins for plasmids used in this study.


REFERENCES

  1. Weinberg, R. A. (1989) Cancer Res. 49, 3713-3721 [Free Full Text]
  2. Sang, N., Baldi, A., and Giordano, A. (1995) Mol. Cell. Diff. 3, 1-29
  3. Horowitz, J. M., and Udvadia, A. J. (1995) Mol. Cell. Diff. 3, 275-314
  4. Robbins, P. D., Horowitz, J. M., and Mulligan, R. C. (1990) Nature 346, 668-671 [CrossRef][Medline] [Order article via Infotrieve]
  5. Pietenpol, J. A., Munger, K., Howley, P. M., Stein, R. W., and Moses, H. L. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 10227-10231 [Abstract/Free Full Text]
  6. Kim, S.-J., Lee, H.-D., Robbins, P. D., Busam, K., SPorn, M. B., and Roberts, A. B. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 3052-3056 [Abstract/Free Full Text]
  7. Kim, S.-J., Onwuta, U. S., Lee, Y. I., Li, R., Botchan, M. R., and Robbins, P. D. (1992) Mol. Cell. Biol. 12, 2455-2463 [Abstract/Free Full Text]
  8. Chen, L. I., Nishinaka