JBC INTERFERin siRNA transfection reagent

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sarig, G.
Right arrow Articles by Fry, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sarig, G.
Right arrow Articles by Fry, M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 7, Issue of February 14, 1997 pp. 4474-4482
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Purification and Characterization of qTBP42, a New Single-stranded and Quadruplex Telomeric DNA-binding Protein from Rat Hepatocytes*

(Received for publication, March 12, 1996, and in revised form, October 10, 1996)

Galit Sarig , Pnina Weisman-Shomer , Ronit Erlitzki and Michael Fry Dagger

From the Unit of Biochemistry, the Bruce Rappaport Faculty of Medicine, Technion, Israel Institute of Technology, P.O. Box 9649, Haifa 31096 Israel

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
Acknowledgments
REFERENCES


ABSTRACT

Telomeres of vertebrate chromosomes terminate with a short 5'-d(TTAGGG)-3' single-stranded overhang that can form in vitro tetrahelical structures. Here we describe a new protein from rat hepatocyte nuclei designated quadruplex telomere-binding protein 42 (qTBP42) that tightly binds 5'-d(TTAGGG)n-3' and 5'-d(CCCTAA)n-3' single-stranded and tetraplex forms of 5'd(TTAGGG)n-3'. The thermostable qTBP42 was isolated from boiled nuclear extracts and purified to near homogeneity by successive steps of column chromatography on DEAE-cellulose, phosphocellulose, and phenyl-Sepharose. A subunit molecular size of 42.0 ± 2.0 kDa was determined for qTBP42 by Southwestern blotting and SDS-polyacrylamide gel electrophoresis of the protein and its UV cross-linked complex with labeled telomeric DNA. A native size of 53.5 ± 0.9 kDa, estimated by Superdex© 200 gel filtration, suggests that qTBP42 is a monomeric protein. Sequences of five tryptic peptides of qTBP42 contained motifs shared by a mammalian CArG box-binding protein, hnRNP A/B, hnRNP C, and a human single-stranded telomeric DNA-binding protein. Complexes of qTBP42 with each complementary strand of telomeric DNA and with quadruplex forms of the guanine-rich strand had 3.7-14.6 nM dissociation constants, Kd, whereas complexes with double-stranded telomeric DNA had up to 100-fold higher Kd values. By associating with tetraplex and single-stranded telomeric DNA, qTBP42 increased their heat stability and resistance to digestion by micrococcal nuclease.


INTRODUCTION

Telomeres, the DNA-protein structures at the end of linear eukaryotic chromosomes, form protective caps that shield chromosome termini against degradative processes or fusion with other chromosome ends (1-4). The evolutionarily conserved nucleotide sequence of telomeric DNA consists of short nucleotide sequences repeated in tandem. All vertebrates, slime molds, filamentous fungi, and Trypanosoma have a repeated 5'-d(TTAGGG)-3' sequence of the telomeric strand oriented 5' to 3' toward the chromosome terminus, the "G-strand". The 3'-terminal G-strand stretch ends with an unpaired 12-16-nucleotide-long overhang (1-4). This single-stranded tract can form in vitro under physiological conditions hairpin (5-7) or unimolecular or bimolecular tetrahelical structures (5-13), which may function in telomere transactions.

The telomere hypothesis of cellular senescence and tumorigenesis states that progressive shortening of telomeres in somatic cells leads to cessation of their division and to cellular aging (16). In contrast, maintenance of a stable telomere length in germ line and cancer cells is associated with their infinite division and immortality. This hypothesis is supported by evidence showing that whereas telomeric DNA becomes progressively shortened in the course of the aging of diverse somatic cells, its length remains stable in infinitely dividing stem and tumor cells (17-21). The G-strand of telomeric DNA is extended by telomerase, a ribonucleoprotein enzyme whose complementary cytosine-rich RNA component serves as a template for the synthesis of the G-strand (3, 4, 22). Whereas telomerase activity is undetectable in various somatic tissues and in dividing primary cells, many cancer cells retain an active telomerase (Refs. 18-21 and 23; reviewed in Ref. 17). More recent results suggest, however, that telomerase might not be the sole factor that determines telomere length. Thus, some tumor cells whose telomere length remains stable have no measurable telomerase activity (24), and conversely, an active telomerase was detected in normal human (25) and mouse cells (26). Further, the removal of 50-200-nucleotide-long segments of telomeric DNA with each round of replication in somatic cells (27, 28) suggests that, in addition to the loss of telomerase activity, termini of telomeric DNA may also be shortened by exonucleolytic attack.

Stabilization or destabilization of telomeric DNA may be affected by telomeric DNA-binding proteins that have been identified in diverse species. Proteins such as a monomeric 51-kDa polypeptide from Euplotes crassus (29), a 34-kDa Chlamydomonas protein (30), and a Xenopus protein (31) bind tightly to single-stranded telomeric DNA. Another group of proteins bind to or accelerate the formation of tetraplex structures of telomeric DNA. A heterodimeric protein from Oxytricha nova consisting of a 56-kDa alpha  and a 41-kDa beta  subunit, dimerizes in the presence of single-stranded telomeric DNA and binds to it cooperatively (32). Without detectably binding to quadruplex DNA, the beta  subunit facilitates tetraplex formation 105- to 106-fold (33). The yeast KEM1 protein binds to tetraplex DNA and cuts a single-stranded sequence 5' to the quadruplex structure (34). Shortened telomeres and a senescent phenotype of KEM1 null mutants suggest that the formation of G-strand tetrahelix and KEM1 nuclease activity are required for telomeric DNA extension (35). Two additional yeast proteins, the 42-kDa G4p1 (36) and the 32-kDa G4p2 (37), bind with similar affinities to parallel and antiparallel tetraplex DNA. The yeast protein RAP1 binds duplex telomeric DNA (38), is required for telomere maintenance (39), and associates with and promotes the formation of parallel stranded quadruplex telomeric DNA (40, 41). A protein from Tetrahymena thermophila also binds specifically to parallel-stranded tetraplex telomeric DNA (42). Proteins of a third class such as a 10-kDa polypeptide from Physarum polycephalum (43) and hTRF, a 50-kDa HeLa cell protein (44-46) associate specifically with the duplex region of telomeric DNA.

In searching for a mammalian cell protein that interacts with terminal telomeric DNA sequences, we identified in rat hepatocytes a protein that binds tightly both single strands of telomeric DNA and tetraplex forms of the guanine-rich strand. Here we describe the purification and characterization of this protein and report its effects on the bound DNA.


EXPERIMENTAL PROCEDURES

Materials and Enzymes

[32P]ATP (~3000 Ci/mmol) and molecular mass RainbowTM marker proteins were from Amersham Corp. Synthetic DNA oligomers, listed in Table I, were purchased from Operon Technologies. Midland Reagent supplied the HPLC-purified1 RNA oligomer r(UUAGGG)4. The RNA oligomer rRAND was a gift of Dr. Ashwini Loeb (University of Washington). Sigma provided boric acid, dithiothreitol (DTT), N-ethylmaleimide, salmon sperm DNA, thymidine 3',5'-diphosphate, dimethyl sulfate, leupeptin, aprotinin, benzamidine, phenylmethylsulfonyl fluoride; Nonidet P-40, Sephadex G-50, phenyl-Sepharose, soybean trypsin inhibitor (STI), trypsin, and micrococcal nuclease. Whatman supplied DEAE-cellulose (DE-52); phosphocellulose (P-11), and DE-81 filter paper. Bacteriophage T4 polynucleotide kinase was from Promega. Acrylamide:bisacrylamide (19:1 or 30:1.2) was purchased from Amresco. IBI provided Kodak autoradiographic film, urea, TEMED, bromphenol blue, and xylene cyanol FF. Superdex© 200 gel filtration column was the product of Pharmacia Biotech Inc. Gelman Sciences supplied Biotrace polyvinylidene difluoride binding matrix membranes. Bio-Rad provided reagents for SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and molecular weight protein standards.

Table I.

DNA and RNA oligomers used in this study


Oligomer designation Length Nucleotide sequence

TeR 24-mer 5'-d(TTA<UNL>GGG</UNL>TTA<UNL>GGG</UNL>TTA<UNL>GGG</UNL>TTA<UNL>GGG</UNL>)-3'
rTeR 24-mer 5'-r(UUA<UNL>GGG</UNL>UUA<UNL>GGG</UNL>UUA<UNL>GGG</UNL>UUA<UNL>GGG</UNL>)-3'
TeR1 17-mer 5'-d(TAGACATGTTA<UNL>GGG</UNL>TTA)-3'
Long TeR1 24-mer 5'-d(TCATGACTAGACATGTTA<UNL>GGG</UNL>TTA)-3'
TeR2 23-mer 5'-d(TAGACATGTTA<UNL>GGG</UNL>TTA<UNL>GGG</UNL>TTA)-3'
Long TeR2 30-mer 5'-d(TCATGACTAGACATGTTA<UNL>GGG</UNL>TTA<UNL>GGG</UNL>TTA)-3'
Anti-TeR 24-mer 5'-d(<UNL>CCC</UNL>TAA<UNL>CCC</UNL>TAA<UNL>CCC</UNL>TAA<UNL>CCC</UNL>TAA)-3'
TeR C 23-mer 5'-d(<UNL>CCC</UNL>TAA<UNL>CCC</UNL>TAA<UNL>CCC</UNL>GGGTCGAC)-3'
TeR G 23-mer 5'-d(GTCGACCC<UNL>GGG</UNL>TTA<UNL>GGG</UNL>TTA<UNL>GGG</UNL>)-3'
Long TeR G 38-mer 5'-(GTCGACCC<UNL>GGG</UNL>TTA<UNL>GGG</UNL>TTA<UNL>GGG</UNL>TTA<UNL>GGG</UNL>TTA<UNL>GGG</UNL>TTA)-3'
Q 20-mer 5'-d(TACA<UNL>GGGG</UNL>AGCT<UNL>GGGG</UNL>TAGA)-3'
Long Q 36-mer 5'-d(TCGATACATAGATCGATACA<UNL>GGGG</UNL>AGCT<UNL>GGGG</UNL>TAGA)-3'
rRAND 46-mer 5'-r(GCGCG2A2GCU2G2CUGCAGA2UAU2GCUAGCG3A2U2CG2CGCG)-3

Preparation of Single-stranded, Double-stranded, and Tetraplex DNA Oligomers

Full-length DNA oligomers were purified by electrophoresis through an 8 M urea, 15% polyacrylamide denaturing gel (acrylamide:bisacrylamide, 19:1) as we described previously (47). The purified DNA or RNA oligomers were 5'-end-labeled with 32P as described (48). Oligomers were maintained in their single-stranded conformation when stored as a 0.25 µM solution in 1.0 mM EDTA, 10 mM Tris-HCl buffer, pH 8.0 (TE buffer) and boiled immediately prior to use. Double-stranded DNA was prepared by heating at 90 °C for 2 min an equimolar mixture of complementary DNA oligomers (20 µM each in TE buffer) followed by slow cooling to room temperature. Duplex DNA molecules were resolved from residual DNA single strands by electrophoresis through a nondenaturing 15% polyacrylamide gel (acrylamide:bisacrylamide, 30:1.2), and the double-stranded DNA was eluted from an excised gel slice and isolated as described (47). To prepare unimolecular tetraplex G'4 TeR DNA, a solution of 0.25 µM TeR DNA in TE buffer was heated at 95 °C for 2 min and cooled rapidly to 4 °C, and NaCl was added to a final concentration of 50 mM. A compact structure of TeR DNA was formed in the presence of 50 mM NaCl and identified by its rapid migration in a nondenaturing 15% polyacrylamide gel relative to the mobility of bacteriophage M13 17-mer universal primer DNA marker. Following UV cross-linking, this form also migrated rapidly in a denaturing 8 M urea, 12% polyacrylamide gel (9). The folded DNA structure was resistant to methylation with dimethyl sulfate, indicating its stabilization by Hoogsteen hydrogen bonds (49). To prepare G'2 TeR DNA, a bimolecular tetraplex form of oligomer TeR, 10 µM TeR2 DNA in TE buffer was heated at 95 °C for 2 min followed by incubation of the DNA at 37 °C for 20 h in the presence of 1.0 M KCl. That a multimolecular DNA complex was accumulated was shown by its retarded electrophoretic migration in a nondenaturing 15% polyacrylamide gel relative to the mobility of single-stranded oligomer TeR2. The bimolecular stoichiometry of the electrophoretically retarded complex was demonstrated according to Sen and Gilbert (50), using the short and long oligomers TeR2 and long TeR2, respectively. A parallel G4 quadruplex form of oligomer Q was prepared, and its tetramolecular stoichiometry was demonstrated, using oligomers Q and long Q, as described (50).

Electrophoretic Mobility Shift Assays, SDS-PAGE, and Southwestern Blotting

The DNA binding activity of qTBP42 was monitored by electrophoretic mobility shift assay as we described previously (47). Briefly, to assay for the binding of single-stranded TeR DNA, G4 quadruplex oligomer Q or double-stranded DNA, 0.2-2.0 ng of 32P-5'-end-labeled DNA were incubated at 4 °C for 20 min with 10-400 ng of purified or crude protein fraction in a 10-µl final volume of buffer D (0.5 mM DTT, 1.0 mM EDTA, 20% glycerol in 25 mM Tris-HCl buffer, pH 7.5). Gel mobility shift electrophoresis was conducted as described previously (47), and gels dried on DE-81 filter paper were exposed to x-ray film or to a phosphor-imaging plate (Fuji). Amounts of free and qTBP42-bound TeR DNA were deduced from phosphor-imaging quantification and the known specific activity of the labeled DNA probe. One unit of qTBP42 DNA binding activity was defined as the amount of qTBP42 that bound 0.05 ng of single-stranded TeR DNA under the described standard conditions. Binding of tetraplex G'2 TeR or G'4 TeR DNA was assayed as detailed above except that 10 mM KCl or 50 mM NaCl, respectively, was added to the DNA binding mixture to preserve the quadruplex structure of the DNA, the 0.5 × TBE gel running buffer contained 10 mM KCl or 50 mM NaCl, and electrophoresis was performed at 4 °C.

SDS-PAGE and silver staining of resolved protein bands were carried out as we described previously (47).

Southwestern analysis was conducted essentially according to Petracek et al. (30) except that 1.6 µg of 32P-5'-end-labeled TeR DNA were used and nonspecifically adsorbed DNA was removed by washing the blots at 4 °C for 10 min, first three times with 600 ml each of binding buffer that contained 0.25% Marvel nonfat dry milk and than three more times with 200 ml each of binding buffer that contained 0.05% Nonidet P-40. The blots were dried and exposed to autoradiographic film.

Purification of qTBP42

Protein qTBP42 was typically purified from 500-1000 g of liver tissue from adult rats. Salt extracts of non-histone nuclear proteins were prepared from isolated nuclei of hepatocytes as we described (52) except that the extraction buffer contained 0.4 M NaCl, 1 mM phenylmethylsulfonyl fluoride, 0.1 mM benzamidine, and 20 µg/ml each of STI, leupeptin, and aprotinin in buffer D. Preparation of protein extracts and every subsequent step of qTBP42 purification were conducted at 4 °C.

Electrophoretic mobility shift assays and Southwestern analysis showed that rat liver extracts contained a relatively heat-stable TeR DNA binding activity (see "Results"). Two alternative strategies were employed to purify this activity. In procedure 1, qTBP42 was purified to near homogeneity in a scheme that included boiling of the nuclear extract for 10 min as an initial step of purification. The binding activity that was recovered in the heat-resistant fraction was then further purified by successive steps of column chromatography. To ascertain that properties of the TeR DNA-binding protein were not modified by the initial heat treatment, it was also purified by an alternative method, procedure 2, in which the TeR DNA binding activity was resolved by steps of column chromatography without exposure of the protein to heat.

In procedure 1, the nuclear extract was heated at 100 °C for 10 min, and denatured proteins were removed by ultracentrifugation at 80,000 × g for 35 min. TeR DNA binding activity that was recovered in the supernatant was loaded onto a DE-52 column equilibrated in buffer D at a ratio of 5.0 mg of protein/ml of packed resin. The protein-loaded column was washed with a single packed column volume of the equilibration buffer, and bound proteins were eluted by a 10-column volume gradient of 0-500 mM NaCl in buffer D. Nonspecific adsorption of qTBP42 to glass and plastic was found to be prevented by Nonidet P-40, which did not detectably decrease DNA binding activity at detergent concentration of up to 5%. Thus, in this and in all of the following steps of chromatography, 40 fractions were collected into Nonidet P-40 at a final concentration of 0.05%. Forty fractions were collected and dialyzed overnight against ~200 volumes of buffer D. To detect binding activity, parallel assays were conducted using 32P-5'-end-labeled single-stranded TeR DNA, G'4 TeR DNA, or a G4 quadruplex form of oligomer Q as probes. In this and all of the succeeding purification steps, electrophoretic mobility shift analysis revealed overlapping peaks of DNA binding activity with all three probes. Binding activity was detected in fractions that were eluted from the DE-52 column by 70-290 mM NaCl. These fractions were pooled together, dialyzed overnight against ~200 volumes of buffer P (1.0 mM EDTA, 0.5 mM DTT, 20% glycerol in 80 mM KPO4 buffer, pH 8.5), and loaded onto a P-11 column equilibrated in buffer P at a ratio of 2.0 mg of protein/ml of packed resin. The loaded column was washed with a single packed column volume of buffer P, and resin-bound proteins were eluted by a 10-column volume linear gradient of 80-350 mM KPO4 buffer, pH 8.5, that contained 1.0 mM EDTA, 0.5 mM DTT, 20% glycerol. Forty fractions were collected and dialyzed overnight against ~200 volumes of buffer D. Fractions eluted by 100-200 mM KPO4 contained binding activity and were pooled together, dialyzed overnight against ~200 volumes of buffer S (4.0 M NaCl, 1.0 mM EDTA, 0.5 mM DTT, in 25 mM Tris-HCl buffer, pH 7.5), and loaded at a ratio of 1.0 mg of protein/ml of packed resin onto a phenyl-Sepharose column equilibrated in buffer S. The loaded column was washed with a single column volume of the equilibration buffer, and bound proteins were eluted by a 10-column volume gradient of 4.0-0.0 M NaCl in 1.0 mM EDTA, 0.5 mM DTT, 25 mM Tris-HCl buffer, pH 7.5. Forty fractions were collected and dialyzed overnight against ~200 volumes of buffer D. DNA binding activity was detected in fractions that were eluted from the phenyl-Sepharose column by 0.5-0.0 M NaCl. These fractions contained a single major 42-kDa protein band as revealed by SDS-PAGE (see "Results"). Typically, the concentration of protein in this fraction was lower than 25 µg/ml, and the DNA binding activity was progressively lost in the course of its storage at -80 °C. The DNA binding activity was stabilized by collecting eluted fractions into Nonidet P-40 and STI protein stabilizer at final concentrations of 0.05% and 200 µg/ml, respectively. The STI and Nonidet P-40-stabilized protein retained full TeR DNA binding activity for at least 6 months when stored at -80 °C.

In purification procedure 2, salt-extracted nuclear proteins were first precipitated by ammonium sulfate, and TeR DNA binding activity was recovered in the 50-70% (NH4)2SO4 precipitate and was dialyzed overnight against ~200 volumes of buffer D. The dialyzed fraction was incubated with denatured salmon sperm DNA at 4 °C for 30 min at a protein:DNA ratio of 30:1 (w/w). The TeR DNA binding activity bound to the denatured DNA, which (due to its polyanionic nature) bound strongly to DEAE cellulose. The protein-DNA mixture was loaded onto a DE-52 column equilibrated in buffer D at a ratio of 5.0 mg of protein/ml of packed resin. Weakly bound proteins were eluted from the column by successive stepwise washes with a single packed column volume each of 50, 100, and 150 mM NaCl in buffer D. The TeR DNA binding activity that tightly associated with the bound denatured DNA was eluted by a single packed column volume of 225 mM NaCl in buffer D. Following overnight dialysis against ~200 volumes of buffer P, the binding activity was chromatographed on a column of P-11 as described above. TeR DNA binding activity was eluted from the column by 140-160 mM KPO4, and after overnight dialysis against ~200 volumes of buffer S, it was chromatographed on a column of phenyl-Sepharose as detailed above. TeR DNA binding activity was detected in fractions that were eluted from phenyl-Sepharose by 0.5-0.0 M NaCl.

Determination of the Amino Acid Sequence of qTBP42 Peptides

To determine a partial amino acid sequence of qTBP42, a Coomassie Blue-stained SDS-PAGE-resolved band of qTBP42 was excised, and the protein was eluted from the gel and digested with trypsin. Resulting tryptic peptides were separated by reverse-phase HPLC, and the amino acid sequences of selected peptides were determined by a standard automated procedure.

Determination of the Amount of Protein

The Bio-Rad protein assay kit was used to determine the amount of protein in qTBP42 fractions that did not contain STI protein stabilizer.


RESULTS

Purification of the Tetraplex Telomeric DNA-binding Protein qTBP42

Activity that bound tetraplex and single-stranded forms of the vertebrate telomeric sequence TeR, 5'-d(TTAGGG)4-3' was detected by electrophoretic mobility shift analysis in extracts of non-histone nuclear proteins from rat hepatocyte. Southwestern analysis indicated that nuclear extracts exhibited two TeR DNA-binding protein bands of ~40 and ~78 kDa, but only the ~40-kDa polypeptide, here designated qTBP42, was heat-stable, partially resisting heating of the extracts at 100 °C for 10 min (Fig. 1A). To purify qTBP42, the nuclear extracts were initially boiled for 10 min, and the denatured proteins were removed by ultracentrifugation. Heat-resistant TeR DNA binding activity that was recovered in the supernatant was further purified by successive steps of chromatography on columns of DE-52, P-11, and phenyl-Sepharose. Overlapping peaks of binding activity were obtained when single-stranded TeR DNA, TeR G'4 DNA, or a G4 form of oligomer Q were used as probes in electrophoretic mobility shift analysis (data not shown). SDS-PAGE of proteins resolved by the successive steps of extract boiling and chromatography on columns of DE-52 and P-11 revealed a progressive depletion of proteins (Fig. 1B). Note that a major 42-kDa protein band became prominent in the P-11-purified fraction of qTBP42 (Fig. 1B). The level of TeR binding activity in the P-11-resolved fractions was found to be directly related to the intensity of this silver-stained 42-kDa protein (results not shown). Phenyl-Sepharose hydrophobic column chromatography was ultimately used to obtain a nearly homogeneous fraction of qTBP42. As seen in Fig. 2A, TeR DNA binding activity was detected by mobility shift electrophoresis in phenyl-Sepharose fractions 34-38. Covalent UV cross-linking of labeled TeR DNA to phenyl-Sepharose-resolved proteins revealed a 52.5-kDa protein-DNA complex in fractions 34-38 (Fig. 2B) or a 51.0-kDa complex with the G'4 tetraplex form of TeR DNA and a 49.5-kDa complex with the G4 form of oligomer Q (results not shown). Similar average complex sizes of 51.5, 51.0, and 48.0 kDa were obtained when labeled TeR DNA, G'4 TeR, and G4 oligomer Q, respectively, were UV-cross-linked to qTBP42 that was purified by procedure 2. As seen in Fig. 2C, silver staining of SDS-PAGE-resolved proteins revealed in fractions 34-38 a single major protein band of 42 kDa. This protein also remained the only detectable major stained band when no STI protein stabilizer was added to these phenyl-Sepharose-resolved fractions (results not shown). The heat-stable ~40-kDa binding protein detected by Southwestern analysis of nuclear extracts (Fig. 1A) as well as the 42-kDa size of the highly purified active protein (Fig. 2, A and C) and the 46-53-kDa size of its complex with DNA (Fig. 2B) strongly suggested that the 42-kDa protein represented qTBP42. The yield of qTBP42 purified by procedure 1 was low, but whereas 96% of the extract proteins became denatured by boiling, 8-15% of the initial TeR DNA binding activity was recovered in the supernatant.


Fig. 1. Southwestern analysis of TeR binding activity in nuclear extract and protein purification. A, Southwestern blotting of TeR DNA binding activity in rat hepatocyte nuclear extract. Non-histone protein extracts form rat hepatocytes were either left untreated or boiled for 10 min, and the denatured proteins were removed by centrifugation (see "Experimental Procedures"). The untreated and heat-treated extract samples were electrophoresed through an SDS-12% polyacrylamide gel, the resolved proteins were renatured and exposed to 32P-5'-end-labeled TeR DNA, and unbound probe was washed as detailed under "Experimental Procedures." Shown is an autoradiogram of the dried blotted gel. B, SDS-PAGE analysis of proteins in successively purified fractions of qTBP42. Approximately 4.0 µg of protein of crude nuclear extract, boiled extract, and DE-52- and P-11-purified fractions of qTBP42 were electrophoresed through an SDS-12% polyacrylamide gel, and the resolved protein bands were stained with silver (see "Experimental Procedures").
[View Larger Version of this Image (32K GIF file)]



Fig. 2. TeR DNA binding activity and SDS-PAGE of proteins in phenyl-Sepharose-purified fractions of qTBP42. A phosphocellulose-purified fraction of qTBP42 (3.25 mg of protein) was loaded onto a column of phenyl-Sepharose (4.0-ml packed volume), and proteins were eluted by a linear gradient of 4.0-0.0 M NaCl in 1.0 mM EDTA, 0.5 mM DTT, 25 mM Tris-HCl buffer, pH 7.5. Forty fractions were collected into Nonidet P-40 and STI protein stabilizer at final concentrations of 0.05% and 20 µg/ml, respectively. A, mobility shift electrophoresis of fractions resolved by phenyl-Sepharose. Each fraction was assayed for the presence of 32P-5'-end-labeled TeR DNA binding activity as detailed under "Experimental Procedures." B, resolution by SDS-PAGE of UV-cross-linked phenyl-Sepharose-resolved fractions. To bind TeR DNA to qTBP42, a 1.0-µl aliquot of each phenyl-Sepharose-resolved fraction was incubated at 4 °C for 15 min with 0.2 ng of 32P-5'-end-labeled TeR DNA in the presence of 0.05% Nonidet P-40, 200 µg/ml STI in a final volume of 20 µl. Protein-DNA complexes were covalently cross-linked by irradiating the samples at 4 °C for 5 min in a microtiter plate at a distance of 6 cm from a UVP (San Gabriel, CA) UV light source (254 nm, 580 microwatts/cm2 at 6 inches). The irradiated samples were electrophoresed through an SDS-12% polyacrylamide gel, which was dried and exposed to autoradiographic film. CL, UV-cross-linked complex. C, silver staining of SDS-PAGE-resolved phenyl-Sepharose fractions. Electrophoresis and silver staining of proteins were conducted as indicated under "Experimental Procedures." An arrow marks the position of a 42-kDa band that is present in fractions 34-38, and the position of the stained STI protein stabilizer is indicated at the bottom of the gel.
[View Larger Version of this Image (34K GIF file)]


Chemical-physical Properties of qTBP42

Some properties of qTBP42 are shown in Table II. The proteinaceous nature of qTBP42 was demonstrated by its inactivation by SDS or trypsin. Protein qTBP42 appeared to be relatively heat-stable such that purified qTBP42, which resisted 10 min of boiling in the nuclear extract, retained 60% of its activity after an additional 2 min at 100 °C and became nearly fully inactivated only after 60 min of boiling (Table II). The resistance of qTBP42 to digestion with micrococcal nuclease (Table II) suggested that it did not contain an essential nucleic acid component. An only slight decrease of qTBP42 activity in the presence of 8.5 mM N-ethylmaleimide (Table II) indicated that reduced protein sulfhydryl groups were not directly involved in its interaction with DNA.

Table II.

Binding of the G4 form of oligomer Q by phenyl-Sepharose-purified qTBP42

Binding was conducted without or with the indicated treatments. The qTBP42-G4 DNA complex was resolved by mobility shift electrophoresis, and its amount was quantified by phosphor imaging.
Treatment Percentage of initial activity

None 100
100 °C, 2 min 60
100 °C, 60 min 10
Trypsin digestiona 22
0.25% SDS 0.0
Micrococcal nucleaseb 103
8.5 mM N-ethylmaleimidec 82

a  qTBP42 protein (9.0 activity units), which did not contain STI stabilizer, was incubated at 37 °C for 60 min with 375 µg/ml trypsin, and the proteolytic digestion was terminated by the addition of STI to a final concentration of 2.0 mg/ml. Shown is an average result of three independent determinations.
b  qTBP42 protein, (9.0 activity units) was incubated at 37 °C for 30 min with 3.25 µg/ml micrococcal nuclease in the presence of 1.0 mM CaCl2. Digestion was terminated by the addition of EGTA and pTp to final concentrations of 33.0 and 1.0 mM, respectively. Shown is an average result of three determinations.
c  qTBP42 protein (9.0 activity units) was incubated at 4 °C for 15 min with N-ethylmaleimide, and the reaction was terminated by the addition of 18 mM DTT. The average result of three experiments is shown.

Protein qTBP42 migrated on SDS-PAGE as a 42.0 ± 2.0-kDa polypeptide (n = 6). Protein qTBP42 that was purified by procedure 1 or procedure 2 had apparent native molecular size of 53.5 ± 0.9 kDa (n = 3) or 55.0 kDa, respectively, as determined by Superdex 200© gel filtration. The different sizes of denatured and native qTBP42, ~42 versus ~54 kDa, respectively, could be due to the contribution of the shape of the protein molecule to its migration through the Superdex 200© gel. The ~40-kDa apparent size of qTBP42 in a Southwestern blot (Fig. 1A) and the 48-52.5-kDa mass of its UV cross-linked complexes with different DNA probes (see above) indicated that in its native form qTBP42 was most probably a 42-kDa monomeric protein.

Specificity of DNA Binding by qTBP42

DNA sequence and structure specificity of binding to qTBP42 were first assessed by binding competition between 32P-5'-end-labeled TeR DNA and excess of different unlabeled DNA sequences. A 50-fold molar excess of unlabeled d(A)16, d(G)16, or the oligomer 5'-d(A2TC2GTCGTCGAGCAGAGT2)-3' failed to detectably compete with the binding of either single-stranded or quadruplex G4 oligomer Q (results not shown). Essentially identical results were obtained for qTBP42 that was purified by either procedure 1 or procedure 2 (data not shown). Several DNA sequences and structures did compete, however, with TeR DNA at variable efficiencies. To accurately determine the relative affinity of qTBP42 for the competing DNA species, the dissociation constants, Kd, of their complex with the protein were determined. Fig. 3 shows a typical equilibrium binding measurement of the binding of qTBP42 to G'4 TeR DNA. A constant amount of the P-11 fraction of qTBP42 purified by procedure 1, was incubated at 4 °C for 20 min with increasing amounts of 32P-5'-end-labeled G'4 TeR DNA, and the protein-DNA complex was then separated from unbound DNA by mobility shift electrophoresis (Fig. 3A). Amounts of bound and free DNA were determined by phosphor-imaging measurements of the respective bands. The dissociation constant, Kd, was inferred from the negative reciprocal of the slope of a Scatchard plot of the results (Fig. 3B). Table III compiles Kd values determined for complexes of qTBP42 with DNA sequences that measurably competed with the TeR DNA on its binding to the protein. The presented results indicate that qTBP42 bound the guanine-rich telomeric single strand with nanomolar binding affinity. Interestingly, the cytosine-rich DNA strands anti-TeR or TeR C DNA, which contained four and three clusters, respectively, of three cytosine residues each, formed complexes with qTBP42 that had Kd values of 3.7-4.8 × 10-9 mol/liter, values similar to qTBP42 complexes with TeR DNA (Table III). To ascertain that these cytosine-rich oligomers remained single-stranded rather than tetraplex structures, they were electrophoresed through a nondenaturing 10% polyacrylamide gel at pH 8.0 with or without added salt. Control TeR DNA formed under the same experimental conditions a rapidly migrating unimolecular tetraplex in an alkali ion-dependent fashion, and a UV-cross linked TeR oligomer remained in a compact form with or without salt (see "Experimental Procedures"). By contrast, neither anti-TeR nor TeR C DNA exhibited any change in its electrophoretic mobility, and both migrated as unfolded structures with or without the presence of ions (results not shown). A possible mechanism for the observed association between qTBP42 and the cytosine-rich sequences might have been the pairing of these sequences with residual complementary guanine-rich DNA that could have remained bound to the protein. To examine this possibility, phosphocellulose-purified qTBP42 was incubated at 37 °C for 10 min with 16.6 ng/µl of micrococcal nuclease in the presence of 3.3 mM CaCl2. The nucleolytic digestion was terminated by the addition of EGTA and thymidine 3',5'-diphosphate to a final concentration of 8.0 and 0.45 mM, respectively, and the efficiency of anti-TeR and TeR C binding to the protein was assessed by electrophoretic mobility shift analysis. Although control unbound TeR DNA was completely digested under the described conditions, the binding of both anti-TeR and TeR C DNA by qTBP42 remained unaltered after exposure of the protein to the nuclease (data not shown). Hence, the binding of the cytosine-rich telomeric DNA to qTBP42 appeared not to be due to interaction between this DNA strand and a protein-associated complementary sequence. That qTBP42 displayed a preference for telomeric sequences was demonstrated by the ~85-fold higher Kd value of its complex with the single-stranded guanine-rich oligomer Q (Table III). Complexes of qTBP42 with the G'4 unimolecular and the G'2 bimolecular quadruplex structures of TeR DNA, as well as complexes with the tetramolecular quadruplex form of oligomer Q, also had nanomolar Kd values similar to those of single-stranded TeR, anti-TeR, and TeR C DNA. In contrast to its tight binding of tetraplex telomeric DNA, qTBP42 bound poorly to double-stranded telomeric DNA with or without a single-stranded d(TTAGGG)2 overhang. Complexes that qTBP42 formed with these molecules had Kd values 40-73-fold higher than the rate constants of complexes of qTBP42 with single-stranded TeR DNA or G4 oligomer Q (Table III). It is noteworthy that qTBP42 bound with a similar nanomolar affinity to the single-stranded telomeric sequence RNA oligomer rTeR as to the divergent RNA sequence rRAND (Table III). The sequence-independent binding of RNA by qTBP42 and its similar binding affinities for RNA and DNA sequences are in contrast to the highly specific binding of telomeric RNA sequence by previously described mammalian hnRNPs (see Ref. 59 and "Discussion"). Last, we note that qTBP42 did not bind exclusively to the described DNA sequences and tetraplex structures. Competition and equilibrium binding measurements revealed that qTBP42 also bound to d(T)16 and d(C)17, forming complexes that had Kd values of 8.0 and 28.0 × 10-9 mol/liter, respectively. To test whether the observed DNA sequence and structure binding preferences of qTBP42 were not artificially modified by the heat treatment of proteins during purification by procedure 1, Kd values were measured for complexes that were formed between DNA ligands and qTBP42 that was purified by procedure 2. It was found that the rate constants were very similar for heat-treated and untreated binding protein. For instance, Kd values for complexes of unheated qTBP42 with TeR DNA, anti-TeR, and the G4 form of oligomer Q were 1.75 × 10-9, 30.0 × 10-9, and 7.0 × 10-9 mol/liter, respectively, values close to those obtained with complexes of heat-treated qTBP42 and the same DNA ligands (Table III).


Fig. 3. Determination of the dissociation constant for a qTBP42-G'4 TeR DNA complex. Phosphocellulose-purified qTBP42 protein (2.5 activity units) was incubated at 4 °C for 20 min with increasing amounts of G'4 TeR DNA in the presence of 50 mM NaCl. The qTBP42-TeR DNA complex was resolved by mobility shift electrophoresis in a nondenaturing 6% polyacrylamide gel as detailed under "Experimental Procedures." A, mobility shift electrophoresis pattern of qTBP42 with increasing amounts of G'4 TeR DNA probe. B, Scatchard plot of the results shown in A and quantified by phosphor imaging.
[View Larger Version of this Image (30K GIF file)]


Table III.

Dissociation constants of complexes of qTBP42 with different DNA sequences and structures

The dissociation constants, Kd, of complexes between purified qTBP42 and different forms of the TeR telomeric DNA sequence and the guanine-rich immunoglobulin switch region oligomer Q were inferred from Scatchard plots of protein-DNA binding kinetics as described in the legend to Fig. 3. The number of independent Scatchard plots executed for the determination of the Kd value for each DNA ligand is indicated in parentheses. Both phosphocellulose and phenyl-Sepharose-purified fractions of qTBP42 were used with each DNA probe with no significant difference in the measured Kd values.
DNA Kd

10-9 mol/liter
Single stranded DNA or RNAa
  TeR 5.2  ± 2.1 (4)
  anti TeR 27.0  ± 8.0 (3)
  TeR C 3.7  ± 1.9 (3)
  oligomer Q 300.0 (1)
  rTeR 4.8  ± 0.9 (3)
  rRAND 6.8  ± 3.1 (2)
Double stranded DNAb
  Blunt-ended TeR G-TeR C 220.0  ± 28.3 (2)
  Long TeR G-TeR C with a SS G-strand overhang 280.0  ± 28.3 (2)
Tetraplex DNA
  G'4 TeRc 11.5  ± 6.5 (3)
  G'2 TeRd 14.6  ± 9.9 (5)
  G4 oligomer Qe 3.8  ± 1.7 (3)

a  Oligomers were maintained in a single-stranded conformation as described under "Experimental Procedures," and DNA binding was conducted in the absence of salt to preserve the single strandedness of the DNA.
b  The blunt-ended hybrid between TeR G and TeR C and the hybrid between long TeR G and TeR C that has a single-stranded guanine-rich overhang were annealed and isolated as described under "Experimental Procedures." Duplex TeR G-TeR C molecules with or without a single-stranded (SS) overhang were designed according to Petracek et al. (30) to remain in a single register (see Table I). Following annealing, the duplex molecules were purified by nondenaturing PAGE followed by excision and extraction of the annealed duplex band.
c  The maintenance of the unimolecular tetraplex form of telomeric DNA, G'4 TeR, and DNA binding were conducted in the presence of 50 mM NaCl to preserve the tetraplex structures of a single molecule of telomeric DNA.
d  The bimolecular tetraplex form of telomeric DNA, G'2 TeR, was prepared, and its stoichiometry was verified as described under "Experimental Procedures." The protein binding reaction was conducted in the presence of 10 mM KCl to preserve the bimolecular G'2 TeR complex.
e  The G4 tetramolecular quadruplex form of oligomer Q was prepared and preserved, and its stoichiometry was verified as described under "Experimental Procedures."

To investigate the minimal sequence requirements for the binding of guanine-rich telomeric DNA strand by qTBP42, protein purified by procedure 1 was incubated at 4 °C for 20 min with 32P-5'-end-labeled single-stranded TeR DNA in the presence of an increasing molar excess of either unlabeled TeR1 or long TeR1 DNA that contained a single d(TTAGGG) repeat unit or with an excess of either unlabeled TeR2 or long TeR2 DNA, which contained two d(TTAGGG) repeats each (Table I). Whereas 32P-5'-end-labeled TeR DNA was dislodged from its complex with qTBP42 in direct proportion to the molar excess of the unlabeled TeR DNA homologous competitor, both TeR1 and long TeR1 competitor oligomers were ineffective in displacing TeR DNA from its complex with qTBP42 (Fig. 4). Competing TeR2 DNA that contained two telomeric DNA repeat units dislodged TeR DNA from its complex with qTBP42 at an efficiency lower than the homolog TeR sequence (Fig. 4). Long TeR2 DNA competitor, which also contained two d(TTAGGG) clusters, was more efficient in displacing TeR DNA, probably because of its greater length (Fig. 4). These results suggest, therefore, that whereas a single d(TTAGGG) cluster was not sufficient for qTBP42 binding, two repeats of this sequence allowed binding at an efficiency approaching that of TeR DNA, which contained four repeats.


Fig. 4. Competition analysis of the relative binding by qTBP42 of oligomers containing 1, 2, or 4 clusters of d(TTAGGG). Binding of 10.0 ng of 32P-5'-end-labeled TeR DNA to phenyl-Sepharose-purified qTBP42 (18.0 activity units) was conducted in the presence of an increasing molar excess of TeR, TeR1, TeR2, long TeR1, or long TeR2 DNA oligomers under standard conditions. Protein-DNA complexes were separated from unbound labeled DNA by mobility shift electrophoresis. Indicated at the bottom are the relative amounts of protein-TeR DNA complex as determined by phosphor imaging.
[View Larger Version of this Image (48K GIF file)]


Association with qTBP42 Stabilizes Tetraplex and Single-stranded TeR DNA

To inquire whether the stability of quadruplex TeR DNA was affected by its association with qTBP42, we compared the rate of heat denaturation of naked and protein-bound bimolecular tetraplex G'2 TeR DNA. In a procedure originally applied to the thermostable quadruplex DNA-binding protein QUAD (53), free or qTBP42-bound 32P-5'-end-labeled G'2 TeR DNA was incubated at 50 °C for different periods of time, incubation was terminated, the protein residue was removed by the addition of SDS to a final concentration of 0.25%, and the tetraplex and single-stranded forms of TeR DNA were resolved by electrophoresis through a nondenaturing polyacrylamide gel. As seen in Fig. 5, unbound bimolecular tetraplex G'2 TeR DNA became 50% denatured into single strands after 4.5 min at 50 °C. By contrast, the tetrahelical structure of the qTBP42-bound G'2 TeR DNA was almost fully retained after 8 min at 50 °C (Fig. 5), and only 25% of the tetrahelix became denatured after 15 min at 50 °C (results not shown). Parallel measurements disclosed that the amount of protein-DNA complex in samples not exposed to SDS was only slightly diminished during a similar heat treatment (results not shown). Additional experiments showed that G'2 TeR DNA and the G4 tetramolecular quadruplex form of oligomer Q were also stabilized by qTBP42 at 37 and 60 °C, respectively (data not shown).


Fig. 5. qTBP42 stabilizes G'2 TeR DNA against heat denaturation. Samples, 2 ng each, of 32P-5'-end-labeled G'2 TeR DNA were incubated at 4 °C for 20 min without or with phosphocellulose-purified qTBP42 (2.5 activity units) and were than heated at 50 °C for the indicated periods of time. Heating was terminated by rapid cooling of the samples to 4 °C, and SDS was added to a final concentration of 0.25% to separate the DNA from bound qTBP42. The DNA samples were electrophoresed through a nondenaturing 6% polyacrylamide gel to resolve G'2 TeR DNA from the rapidly migrating denatured TeR DNA. Gels were dried, and amounts of G'2 and single-stranded TeR DNA were determined by phosphor imaging. black-triangle------black-triangle, heated qTBP42-bound G'2 TeR DNA; black-square------black-square, heated unbound G'2 TeR DNA.
[View Larger Version of this Image (14K GIF file)]


To further inquire whether qTBP42 affected the stability of the bound telomeric DNA, unbound single-stranded TeR DNA or G'4 TeR DNA or their complexes with qTBP42 were exposed to 0.75 ng/µl micrococcal nuclease at 20 °C for different lengths of time. Following termination of the nucleolytic digestion by the addition of SDS to a final concentration of 0.25%, the DNA samples were electrophoresed through a 6% nondenaturing polyacrylamide gel to separate the intact DNA oligomer from its digestion products, which migrated at the front of the gel. Fig. 6A shows that under the experimental conditions employed, unbound single-stranded TeR DNA became completely digested within 30 s. By contrast, 50 or 25% of the qTBP42-bound TeR DNA remained unbroken after exposure to the nuclease for 1 or 2 min, respectively (Fig. 6A). Similarly, unbound G'4 TeR DNA became fully digested 15 s after being exposed to micrococcal nuclease, whereas 50 or 25% of the protein-associated tetraplex DNA remained intact after 30 or 60 s of digestion, respectively (Fig. 6B). To ascertain that the observed protection of TeR G'4 and TeR DNA by qTBP42 was a direct result of the interaction between the DNA ligands and their binding protein, the kinetics of nuclease digestion was examined for the oligomer d(CCAGA16G), which was not detectably bound by qTBP42. Under the described experimental conditions, d(CCAGA16G) was digested at the same kinetics with or without added qTBP42 (results not shown). Hence, qTBP42 by itself appeared not to have interfered with the nuclease action, and the observed protection of TeR G'4 and TeR DNA was due to their binding to qTBP42.


Fig. 6. qTBP42 stabilizes TeR and G'4 TeR DNA against nuclease digestion. A, protection of TeR DNA by qTBP42 against nuclease attack. Samples, 2.0 ng each, of single-stranded TeR DNA were incubated at 4 °C for 20 min with or without phosphocellulose-purified qTBP42 (2.2 activity units). The unbound or protein-bound DNA was exposed to 15 ng of micrococcal nuclease at 20 °C for the indicated periods of time in the presence of 1.0 mM CaCl2. Nuclease digestion was terminated, and TeR DNA was separated from its complex with qTBP42 by the addition of SDS to a final concentration of 0.25%. The DNA samples were electrophoresed through a nondenaturing 6% polyacrylamide gel to separate intact DNA from its digestion products, which migrate at the front of the gel. Intact DNA and its digestion products were quantified by phosphor imaging analysis. black-triangle------black-triangle, nuclease-treated qTBP42-bound TeR DNA; black-square------black-square, nuclease-treated unbound TeR DNA. B, protection of G'4 TeR DNA by qTBP42 against nuclease attack. Determination of the kinetics of digestion by micrococcal nuclease of unbound and qTBP42-bound G'4 TeR DNA was conducted as in A except that the reaction mixture contained 50 mM NaCl to preserve the G'4 TeR DNA in its tetraplex form. black-triangle------black-triangle, nuclease-treated qTBP42-bound G'4 TeR DNA; black-square------black-square, nuclease-treated unbound G'4 TeR DNA.
[View Larger Version of this Image (15K GIF file)]


Protein qTBP42 Possesses Sequence Motifs Shared by Other Mammalian DNA- and RNA-binding Proteins

Amino acid sequences of five tryptic peptides of qTBP42 were determined (see "Experimental Procedures"). A computerized search of GenBankTM revealed close homology between the amino acid sequence of every tested qTBP42 peptide and sequences of several known nucleic acid-binding proteins. The amino acid sequences of qTBP42 peptides III and V were closely homologous to two consensus RNA binding motifs (RNP motifs) shared by many RNA-binding proteins. Peptide V of qTBP42, GFGFILF(K), displays similarity to the consensus sequence of RNP1, (K)<UNL>GFGF</UNL>VX<UNL>F</UNL>; and qTBP42 peptide III, (K)SFVGGL(S), corresponds to the consensus sequence RNP2, L<UNL>F</UNL><UNL>V</UNL><UNL>G</UNL>N<UNL>L</UNL> (54, 55). More specifically, the sequences of peptide V and peptide III of qTBP42, respectively, were found to be fully or nearly homologous to the RNP1 or RNP2 motifs, respectively, of the human RNA-binding protein hnRNP A/B (Table IV and Ref. 56). Additional amino acid sequences of hnRNP A/B shared extensive similarity with qTBP42 peptides I, II, and IV (Table IV). Although the sequence of qTBP42 peptides I, II, and IV was highly similar to a partial sequence deduced from a cDNA fragment of rat hnRNP C (Table IV and Ref. 57) they were not identical to each other (Table IV). Hence, rat qTBP42 cannot be equated with the known hnRNP C from this species. The highest degree of sequence homology was noted for peptides of qTBP42 and of the Mus musculus DNA-binding protein CBF-A, which specifically binds to CArG box motifs in myogenic cells (58). As shown in Table IV, qTBP42 peptides II, IV, and V displayed 100% sequence homology with CBF-A, whereas qTBP42 peptides I and III differed from CBF-A by only a single residue each out of total peptide lengths of 14 and 8 amino acids, respectively (Table IV). Last, qTBP42 peptide sequences I, II, and V were found to closely resemble, but not to be identical with, the sequences of tryptic peptides derived from a group of HeLa cell nuclear proteins, B39, B41, and B37, which bind both the pre-mRNA 3'-splice site r(UUAG/G) and single-stranded telomeric DNA d(TTAGGG)n (Table IV and Ref. 59).

Table IV.

Amino acid sequence of tryptic peptides of qTBP42 and of homologous proteins.

The amino acid sequences of isolated tryptic peptides were derived from SDS-PAGE-resolved phenyl-Sepharose-purified qTBP42 as described under "Materials and Methods." Nonhomologous amino acids, which were detected by a computerized search through the GenBankTM sequence data base, are underlined.
qTPB42 and homolog protein peptides Amino acid sequence Ref.

qTBP42 peptide I     GFVFITFKEEQPVK
M. musculus CBF-A     GFVFITFKEE<UNL>D</UNL>PVK 58
Rat hnRNP C     GFCFITFKEE<UNL>E</UNL>PVK 57
Human hnRNP A/B     GFVFITFKEE<UNL>E</UNL>PVK 56
Human SS TBP B39; B41     GFCFITFKEE<UNL>E</UNL>PVK 59
qTBP42 peptide II    KIFVGGLNPEATEEK
M. musculus CBF-A    KIFVGGLNPEATEEK 58
Rat hnRNP C    KIFVGGL<UNL>S</UNL>P<UNL>DTP</UNL>EEK 57
Human hnRNP A/B    KIFVGGLNPE<UNL>SPT</UNL>E<UNL>E</UNL> 56
Human SS TBP B37     IFVGGLNPEATEEK 59
qTBP42 peptide III        KSFVGGLS
M. musculus CBF-A        K<UNL>M</UNL>FVGGLS 58
Rat hnRNP C  ---
Human hnRNP A/B        K<UNL>I</UNL>FVGGL<UNL>N</UNL> 56
qTBP42 peptide IV IREYFGQFGEIEAIELPIDPK
M. musculus CBF-A IREYFGQFGEIEAIELPIDPK 58
Rat hnRNP C IREYFG<UNL>G</UNL>FGE<UNL>V</UNL>ESIELPD<UNL>M</UNL>D<UNL>N</UNL>K 57
Human hnRNP A/B IREYFG<UNL>E</UNL>FGEIEAIELP<UNL>M</UNL>DPK 56
qTBP42 peptide V        GFGFILFK
M. musculus CBF-A        GFGFILFK 58
Rat hnRNP C  ---
Human hnRNP A/B        GFGFILFK 56
Human SS TBP B39        GFGF<UNL>V</UNL>LFK 59


DISCUSSION

The new rat telomeric DNA-binding protein qTBP42 appears to differ from every other protein that was found to bind telomeric DNA in vitro. Telomeric DNA-binding proteins from a wide variety of organisms fall into two classes, based on their binding preference for double stranded or single-stranded DNA. Some of these proteins were also found to associate with tetrahelical telomeric DNA or to promote its formation.

The relatively low affinity of qTBP42 for double-stranded telomeric DNA, with or without a guanine-rich single-stranded overhang (Table III) clearly distinguishes it from double-stranded telomeric DNA-binding proteins such as a P. polycephalum protein (43) or the HeLa cell hTRF protein (44, 45).

A distinct amino acid sequence and characteristic physical properties and DNA binding preferences distinguish qTBP42 from known single-stranded or tetraplex telomeric DNA-binding proteins from a variety of sources. Despite their similar subunit size and their ability to bind tetraplex DNA, qTBP42 and the yeast 42-kDa telomeric DNA-binding protein G4p1 differ by their native size, their lack of shared amino acid sequence (Table IV and Ref. 36), and their different relative affinities for single- or double-stranded guanine-rich DNA and for tetraplex G4 DNA (36). The ~32-kDa yeast tetraplex DNA-binding protein, G4p1, does not share an amino acid sequence homology with qTBP42 and fails to bind single- or double-stranded guanine-rich DNA (37). The major telomeric DNA binding protein in yeast RAP1 (60) is distinguished from qTBP42 by its 92.5-kDa molecular mass, lack of amino acid sequence homology, and binding preference for duplex telomeric DNA. Protein qTBP42 also differs from an E. crassus 51-kDa protein that binds the guanine-rich telomeric DNA strand but fails to bind the complementary cytosine-rich sequence (61). The O. nova heterodimer of alpha  and beta  subunits binds specifically to the single-stranded overhang d(T4G4T4G4) of each macronuclear terminus and protects it from nucleolytic attack (62). However, while promoting the formation of quadruplex DNA, the beta  subunit, unlike qTBP42, does not measurably bind to it (34). A 34-kDa GBP protein from Chlamydomonas binds a d(TTTTAGGG)n single strand, but in contrast to qTBP42, it fails to associate with the complementary cytosine-rich DNA sequence or with r(UUUUAGGG)n (30). The T. thermophila TGP protein binds a parallel stranded G4 tetraplex form of the sequence d(T2G4)4, but in contrast to qTBP42, it does not recognize single-stranded (T2G4)4, duplex d(T2G4)4/(C4A2)4, or r(U2G4)4 (42). Unlike qTBP42 (Table III) the Xenopus laevis 50-kDa XTEF protein binds preferentially a single-stranded d(TTAGGG) overhang at the 3'-end of duplex telomeric DNA but does not bind tetraplex telomeric DNA (31).

In addition to its ability to bind tightly single-stranded and tetraplex telomeric DNA, qTBP42 associates at similar nanomolar affinity with the RNA sequences rTeR and rRAND (Table III). In addition, qTBP42 shares an extensive amino acid sequence homology with mammalian hnRNP A/B and hnRNP C (Table IV), and it contains amino acid tracts similar to the consensus motifs RNP1 and RNP2 of RNA-binding proteins (54, 55). Further, qTBP42 displays amino acid sequences that are closely similar but not identical to sequences identified in human proteins that bind both the pre-mRNA splice junction sequence r(UUAG/G) and the telomeric sequence d(TTAGGG)n (Ref. 59 and Table IV). These human cell proteins are distinguished from qTBP42 by small differences in their amino acid sequence as well as by their complete heat inactivation after 5 min at 70 °C, their strict sequence specificity of binding r(UUAGGG)n and d(TTAGGG)n, and their clear preference for the binding of the RNA over the DNA oligomer (59). Another hnRNP species that does not share sequence homology with qTBP42 was also shown to bind RNA more tightly than DNA (63, 64). It is notable, however, that qTBP42 displays its closest sequence homology with the mouse CBF-A protein that binds the muscle-specific CArG box motif as well as single-stranded DNA (Table IV and Ref. 58).

The ability of qTBP42 to efficiently form complexes with both RNA and DNA (Table III) and the amino acid sequence homology of this protein with both DNA- and RNA-binding proteins (Table IV) raise questions about its primary in vivo nucleic acid binding target. Numerous nucleic acid-binding proteins interact with both RNA and DNA or fulfill more than a single function. For instance, the yeast RAP1 protein is essential for telomere maintenance but it also functions as either an activator or repressor of transcription (14). A multifunctional protein is the yeast G4p2 protein that binds tetraplex DNA but also participates in protein kinase-mediated signal transduction pathways and in cell cycle progression (37). Further, the G4p1 (36) and G4p2 proteins (37) bind tetraplex DNA and RNA structures at a similar efficiency. Likewise, some RNA-binding hnRNPs also bind telomeric DNA (59, 63, 64). Hence, as suggested for these proteins, qTBP42 might also function in transactions of both RNA and telomeric DNA. A potential role for qTBP42 in telomere metabolism might be the binding and stabilization of the telomeric DNA strands as they separate to allow their extension by telomerase and DNA polymerase. Another potential function of qTBP42 could be the stabilization of a tetraplex structure of the guanine-rich strand overhang. It was proposed that unimolecular quadruplex telomeric DNA structures prevent overextension of telomeric DNA by telomerase (15) and that multimolecular tetraplex telomeric synapses participate in the pairing of meiotic homolog chromosomes (51). The stabilization by qTBP42 of tetraplex conformations of telomeric DNA could thus contribute to one or more of these functions.


FOOTNOTES

*   This study was supported in part by grants from the United States-Israel Binational Science Fund, the Council for Tobacco Research, the Israel Cancer Association through the Dorot Foundation in memory of Karl Friedreich First, and the Fund for Promotion of Research in the Technion (to M. F.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Dagger    To whom correspondence should be addressed. Tel.: 972-4-829-5328; Fax: 972-4-851-0735.
1    The abbreviations used are: HPLC, high pressure liquid chromatography; DTT, dithiothreitol; STI, soybean trypsin inhibitor; TEMED, N,N,N',N'-tetramethylethylenediamine; PAGE, polyacrylamide gel electrophoresis.

Acknowledgments

We thank the Technion Protein Research Center (Professor Arie Admon) for skillfully conducting peptide microsequencing.


REFERENCES

  1. Blackburn, E. H. (1991) Nature 350, 569-573 [CrossRef][Medline] [Order article via Infotrieve]
  2. Blackburn, E. H. (1994) Cell 77, 621-623 [CrossRef][Medline] [Order article via Infotrieve]
  3. Greider, C. W. (1994) Curr. Opin. Genet. Develop. 4, 203-211