|
Volume 272, Number 8,
Issue of February 21, 1997
pp. 4795-4803
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.
VMA11 and VMA16 Encode Second and Third
Proteolipid Subunits of the Saccharomyces cerevisiae
Vacuolar Membrane H+-ATPase*
(Received for publication, July 23, 1996, and in revised form, November 5, 1996)
Ryogo
Hirata
,
Laurie A.
Graham
§,
Akira
Takatsuki
,
Tom H.
Stevens
§ and
Yasuhiro
Anraku
¶
From the Institute of Physical and Chemical Research
(RIKEN), Hirosawa, Wako-shi, Saitama 351-01, Japan, the
§ Institute of Molecular Biology, University of Oregon,
Eugene, Oregon 97403-1229, and the ¶ Department of Biological
Sciences, Graduate School of Science, University of Tokyo, Hongo,
Bunkyo-ku, Tokyo 113, Japan
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
Acknowledgments
REFERENCES
ABSTRACT
The vacuolar membrane
H+-ATPase (V-ATPase) of the yeast Saccharomyces
cerevisiae is composed of peripheral catalytic (V1)
and integral membrane (V0) domains. The 17-kDa proteolipid
subunit (VMA3 gene product; Vma3p) is predicted to
constitute at least part of the proton translocating pore of
V0. Recently, two VMA3 homologues,
VMA11 and VMA16 (PPA1), have been
identified in yeast, and VMA11 has been shown to be
required for the V-ATPase activity. Cells disrupted for the
VMA16 gene displayed the same phenotypes as those lacking
either Vma3p or Vma11p; the mutant cells lost V-ATPase activity and
failed to assemble V-ATPase subunits onto the vacuolar membrane.
Epitope-tagged Vma11p and Vma16p were detected on the vacuolar membrane
by immunofluorescence microscopy. Density gradient fractionation
of the solubilized vacuolar proteins demonstrated that the tagged
proteins copurified with the V-ATPase complex. We conclude that Vma11p
and Vma16p are essential subunits of the V-ATPase. Vma3p contains a
conserved glutamic acid residue (Glu137) whose carboxyl
side chain is predicted to be important for proton transport activity.
Mutational analysis of Vma11p and Vma16p revealed that both proteins
contain a glutamic acid residue (Vma11p Glu145 and Vma16p
Glu108) functionally similar to Vma3p Glu137.
These residues could only be functionally substituted by an aspartic
acid residue, because other mutations we examined inactivated the
enzyme activity. Assembly and vacuolar targeting of the enzyme complex
was not inhibited by these mutations. These results suggest that the
three proteolipid subunits have similar but not redundant functions,
each of which is most likely involved in proton transport activity of
the enzyme complex. Yeast cells contain V0 and
V1 subcomplexes in the vacuolar membrane and in the
cytosol, respectively, that can be assembled into the active
V0V1 complex in vivo. Surprisingly, loss-of-function mutations of either Vma11p Glu145 or
Vma16p Glu108 resulted in a higher degree of assembly of
the V1 subunits onto the V0 subcomplex in the
vacuolar membrane.
INTRODUCTION
The vacuolar membrane ATPase
(V-ATPase)1 of the yeast
Saccharomyces cerevisiae belongs to the vacuolar-type
(V-type) proton pump (1-7). The V-type ATPase acidifies various
endomembrane organelles in eucaryotic cells, including the Golgi
apparatus, lysosomes, coated vesicles, and chromaffin granules (8).
This type of proton pump is also found in the plasma membrane of
certain specialized cells (9). Organelle acidification and/or membrane energization by the V-type ATPase is important for such processes as
receptor-mediated endocytosis, protein sorting, zymogen activation, and
solute uptake into a specific organelle (8, 10, 11).
The V-type ATPase consists of two structural domains, V1
and V0, both of which are composed of several different
subunits (4, 7, 12). The peripheral V1 domain possesses the
nucleotide binding site(s) required for ATP hydrolysis (5, 7, 12, 13).
The integral V0 domain translocates protons across the membrane and anchors the peripheral V1 domain to the
membrane (4, 7, 12). The yeast V-ATPase is composed of at least seven
V1 subunits (69, 60, 54, 42, 32, 27, and 14 kDa) and three V0 subunits (100, 36, and 17 kDa) (14-26). The 36-kDa
subunit is not an integral membrane protein but stably associates with
the V0 subcomplex and thus is considered to be a
nonintegral component of the V0 domain (20, 27). Recently,
another essential subunit of 13 kDa was identified (28). The membrane
disposition of this subunit has not yet been unambiguously
determined.
Yeast cells also express genes that encode proteins with sequence
similarity to the 100-kDa (Vph1p) and the 17-kDa
(Vma3p)2 V-ATPase subunits (29-31).
STV1 encodes a polypeptide of 102 kDa with 54% amino acid
identity to Vph1p (14, 29). Stv1p is localized to nonvacuolar
membranes, possibly endosomal and/or Golgi membrane, and is not
required for vacuolar membrane V-ATPase activity. Overexpression of
Stv1p induces mislocalization of this protein to the vacuolar membrane
and can partially complement the phenotypes associated with the loss of
V-ATPase activity in vph1 mutant cells (29). From these
observations, it has been proposed that yeast cells possess another
V-type ATPase acidifying organelles (containing Stv1p) other than
vacuoles and that the 100-kDa subunit isoforms are responsible
for targeting of the V-type ATPases to different organelles (29).
VMA11 and VMA16 genes can encode polypeptides of
17 and 23 kDa with 56 and 35% amino acid identity to Vma3p,
respectively (24, 25, 30, 31). Vma3p is a hydrophobic polypeptide
chemically characterized as a proteolipid (soluble in
chloroform/methanol) and is thought to constitute all or part of the
proton translocating pore in V0 (5, 24, 25). Homologous
subunits are found universally in V-type ATPase complexes characterized
from various membrane sources, and all amino acid sequences determined
for the subunits contain a conserved glutamic acid residue predicted to
be critical for proton transport activity (32). VMA11 was
cloned by complementation of the growth defect of a calcium sensitive
mutant, cls9 (30, 33). Unlike STV1,
VMA11 is required for the activity and assembly of the
vacuolar membrane V-ATPase complex (30, 33). VMA16 was
originally identified as PPA1, an open reading frame
adjacent to the MAS2 gene (31). Initial gene disruption
analysis demonstrated that Vma16p is important for cell growth (31),
but the physiological function of this protein remained unclear.
In this work, the function of Vma11p and Vma16p was studied by
examining the cellular localization of these proteins and by characterizing phenotypes of the cells carrying mutant forms of each
protein. Our results indicate that Vma11p and Vma16p are novel
V0 subunits of the V-ATPase complex essential for enzyme activity. We also report here that both proteins contain a glutamic acid residue important for their function as found for Vma3p (34), and
inactivating mutations of these residues influence the assembly status
of the enzyme complex.
EXPERIMENTAL PROCEDURES
Strains and Culture Conditions
Yeast strains used in this
study are listed in Table I. RHA374, LGY11, and LGY10 are
VMA3::HA,
VMA11:: HA, and
VMA16::HA derivatives, respectively, of
SF838-1D (35). YRH11a and RHP110 are isogenic to YPH499 (36) except
vma11:: TRP1 and
vma16::TRP1, respectively. RHA115
(VMA11::TRP1) was constructed by
inserting a TRP1 gene fragment in the upstream region of the
VMA11 in YPH499. RHA115 is Trp+ and
Vma+. RHA116 (E145D), RHA117 (E145L), and RHA118 (E145Q)
are vma11 mutant derivatives of RHA115. RHP1100-RHP1107 are
isogenic to RHP110, except that each carries a wild type or mutant
vma16 gene on a yeast low copy, centromere-based plasmid,
pRS316 (36). RHP1108 is RHP110 harboring pRS316.
Yeast cells were grown in YPD medium (1% yeast extract (Difco), 2%
Bactopeptone (Difco), and 2% glucose), YPG medium (1% yeast extract,
2% Bactopeptone, and 3% glycerol), or YNBD medium (0.67% yeast
nitrogen base (Difco) and 2% glucose). YPD medium was buffered at pH
5.0 or 7.5 with 50 mM phosphate/succinate buffer as
described previously (17). Calcium sensitivity of the cells was
examined on YPD medium supplemented with 100 mM
CaCl2 (33).
Disruption of the VMA11 Gene
Null vma11 mutants
were constructed as follows. A 1.8-kb EcoRV-SpeI
fragment containing the VMA11 gene was cloned into
pBluescript KS+ (Stratagene), creating pRHA150. pRHA150 was
digested with XhoI and HindIII, blunted with
Klenow, and religated to remove the ClaI and
HincII sites originating from the multicloning site of pBluescript KS+. The 0.6-kb
HincII-ClaI (blunt) fragment of pRHA151 was
replaced with a 0.85-kb EcoRI-BglII (blunt)
fragment of pJJ280 (TRP1) (37) to create
vma11::TRP1 (pRHA163). The
vma11 fragment in pRHA163 was isolated from the plasmid
by digestion with EcoRV and SpeI and used to
construct the disruption strain YRH11a by the method as described
previously (38).
Isolation and Disruption of the VMA16 (PPA1) Gene
Two
oligonucleotide primers, atcgaagttgttttcagtctc and
acatgtatctcagatatctca were synthesized based on the reported sequence of the VMA16 (PPA1) gene (31) and used to amplify
the gene fragment by polymerase chain reaction from yeast chromosomal
DNA in the presence of digoxigenin-11-dUTP. A yeast genomic DNA library
(18) was screened by hybridization with the digoxigenin-labeled
VMA16 fragment to isolate the full-length VMA16
gene. A 2.0-kb NcoI (blunt ended)-EcoRI fragment
containing the VMA16 gene was cloned into the
SmaI-EcoRI site of pUC119 (39) to yield pRHP152.
A 0.6-kb BamHI-EcoRV fragment within the
VMA16 gene was replaced with a 0.94-kb
BamHI-HincII TRP1 fragment from pJJ281
(37) to create pRHP165. The
vma16::TRP1 fragment was liberated
from the plasmid by HpaI-BglI digestion and used
to disrupt the chromosomal VMA16 gene by the method as
described in Ref. 38.
Epitope Tagging of Vma3p, Vma11p, and
Vma16p
VMA3::HA gene fragment was
constructed as follows. A 1.6-kb EcoRI fragment containing
the VMA3 open reading frame was cloned into pBluescript
KS+, and the resultant plasmid was mutagenized to introduce
AatII and NheI restriction sites near the 3 end
of the VMA3 open reading frame with a mutagenic primer,
ctagctagcagacgacgtcttgagtagccctggagttca (40). Then the
AatII-NheI fragment, encoding the last four amino acids of Vma3p, was replaced with a synthetic oligonucleotide duplex
coding for the last four amino acids followed by a nine amino acid HA
epitope (YPYDVPDYA) (41). A 1-kb AgeI-EcoRI
fragment containing a part of the
VMA3::HA gene fragment was cloned into a yeast integrating vector pRS306 (36), digested with
HindIII, and used to substitute for the chromosomal
VMA3 gene by two step gene replacement (38).
Site-directed mutagenesis following the method of Kunkel (42) was
performed to epitope tag VMA11 at the extreme C terminus. The primer
ttttaaacttttgactcacgcatagtcaggaacat ggtattcagagcctc was used to introduce the sequence encoding the HA epitope just prior
to the stop codon of VMA11. The generation of pLG36
(pRS316-VMA11::HA) was determined by the
introduction of a unique NdeI site within the
oligonucleotide sequence (underlined). A 2-kb
KpnI-SacI fragment from pLG36 containing
VMA11::HA was subcloned into pRS306 creating pLG40. The chromosomal copy of VMA11 was replaced by
VMA11::HA to generate the yeast strain LGY11 by
transformation of SF838-1D with linearized pLG40 (BglII)
and two-step gene replacement.
The sequence encoding the HA epitope was introduced into
VMA16 before the stop codon by site-directed mutagenesis
using the primer
tggtttgagcgcttacgcatagtcaggaacat ggtactgaaattcagaagc. The creation of pLG32 (pRS316-VMA16::HA) was
confirmed by the presence of a unique NdeI restriction
enzyme site (underlined). pLG34 was generated by subcloning a 1.9-kb
SacI-KpnI fragment from pLG32 containing
VMA16::HA into pRS306. The chromosomal copy of
VMA16 was replaced by VMA16::HA to
generate the yeast strain LGY10 by transformation with linearized pLG34
(BstUI) as described above.
Site-directed Mutagenesis of the VMA11
gene
vma11 genes with a mutation at the glutamic acid
at position 145 (Glu145) were constructed by site-directed
mutagenesis of pRHA150. Mutagenic primers used were,
accatataacccta cagagaaaattaga (E145D), tataaccctaaa gagaaaattagaat (E145L), and
taccatataaccct tgagagaaaattagaat (E145Q). Each
primer introduces a unique restriction site (underlined) to screen for
the introduced mutation. A 0.85-kb EcoRI-BglII
(blunt) fragment from pJJ280 (TRP1) (37) was inserted at the
SnaBI site of the resultant mutant plasmids as a marker for
mutant selection. The SnaBI site is located ~450 base
pairs 5 of the initiating ATG, and insertion of the TRP1
gene into the wild type VMA11 gene at this position did not
affect the cell growth or the V-ATPase activity (data not shown). The
mutant vma11 fragments were used to substitute for the
chromosomal VMA11 gene in YPH499 to yield RHA116-118.
vma11 mutants were selected by Trp+ phenotype,
and introduction of the mutations was confirmed by Southern blot
analysis of chromosomal DNA.
Site-directed Mutagenesis of the VMA16 Gene
A 3.4-kb
XbaI-EcoRI fragment containing the
VMA16 gene was cloned into pRS316 (36) to create pRHP111.
Site-directed mutagenesis of the VMA16 gene was done by two
sequential polymerase chain reaction reactions with pRHP111 and
overlapping forward and reverse mutagenic primers as described (40).
Nucleotide sequences of the mutant gene fragments were confirmed by DNA
sequence analysis. The wild type and mutant vma16
plasmids (listed in Table I) were introduced into RHP110
( vma16::TRP1) to yield RHP1100
(pRHP111, wild type), RHP1101 (pRHP131, E108D), RHP1102 (pRHP132,
E108V), RHP1103 (pRHP133, E188D), RHP1104 (pRHP134, E188V), RHP1105
(pRHP135, E108L), RHP1106 (pRHP136, E108Q), and RHP1107 (pRHP137,
E188Q).
Protein Preparation, SDS-PAGE, and Western Blot
Analysis
Preparation of vacuolar membrane fractions and
purification of the V-ATPase were previously described (3, 5). When
vacuolar membranes were prepared from strains (RHP1100-RHP1108)
expressing Vma16p from pRS316 (URA3+)-based
plasmids, cells were grown in YNBD ( uracil) supplemented with 0.5%
casamino acids (Difco). Each vacuolar membrane fraction was assayed for
the vacuolar membrane marker, dipeptidyl aminopeptidase B (DPAP-B)
(43), and a purification index, which was expressed as the ratio of the
specific DPAP-B activity in the vacuolar membrane to the activity in
spheroplast lysate, was determined. Vacuolar membrane fractions with a
purification index of >30 (5) were used throughout this study. Protein
extracts of whole cell and vacuolar membrane fractions were prepared as
described by Hill and Stevens (44). Proteolipid subunits were purified
by chloroform/methanol extraction of whole cell extracts or vacuolar
membranes (45). Crude membrane and cytosolic fractions were prepared as
follows. Yeast cells were spheroplasted and lysed with a Dounce
homogenizer in a buffer containing 50 mM Tris-HCl, pH 7.5, 0.2 M Sorbitol, 1 mM EDTA, 2 µg/ml each of
antipain, aprotinin, leupeptin, chymostatin, pepstatin, and 0.5 mM phenylmethanesulfonyl fluoride. The homogenate was
centrifuged at 500 × g for 5 min to remove unbroken
cells and then fractionated into membrane and cytosolic fractions by centrifugation at 100,000 × g for 1 h.
Proteins were solubilized and subjected to SDS-PAGE analysis as
described in Ref. 20. Immunoblots were prepared and probed as described
(46).
Antibodies
Monoclonal antibodies for the 100- (7B1), 69- (R70), and 42-kDa (7A2) subunits and polyclonal antisera for the 60-, 54-, 36-, and 27-kDa subunits were used under the conditions as
described (46). Affinity purified antibodies that recognize the 12CA5 epitope peptide (YPYDVPDYA) were prepared and used as described (22).
Other Methods
Recombinant DNA manipulations were performed
as described (38, 47). Fluorescence microscopy was done essentially as
described (44). Affinity purified anti-HA polyclonal serum was used at a 1:40 dilution. Vacuolar acidification in vivo was examined
by quinacrine staining of the cells (25). V-ATPase activity (ATPase activity sensitive to 0.1 µM bafilomycin A1)
of wild type and site-directed mutants was assayed at 30 °C as
described (5). The reaction mixture (100 µl) contained 25 mM Tris-Mes (pH 6.9), 5 mM MgCl2,
25 mM KCl, 5 mM ATP-2Na+, and
vacuolar membrane vesicles (10-20 µg of protein). Prior to the assay
of ATPase activity, the reaction mixture (without ATP) was incubated
with or without 0.1 µM bafilomycin A1 for 20 min on ice, and then the reaction was started by adding ATP.
Bafilomycin A1 was added as an ethanolic solution, and
control activities were determined in the presence of an equivalent
amount of ethanol. All samples contained 1% ethanol, and this
concentration of ethanol did not inhibit the enzyme activity. V-ATPase
activity of the membrane fractions from LGY11
(VMA11::HA), LGY10
(VMA16::HA), and SF838-1D was assayed
as described (3).
Materials
Enzymes for recombinant DNA methods were
purchased from Takara Shuzo Co., Ltd. (Kyoto, Japan) or New England
Biolabs, Inc. (Beverly, MA). Bafilomycin A1 was from Wako
Pure Chemical Industries, Ltd. (Osaka, Japan). Monoclonal antibodies
were obtained from Molecular Probes, Inc. (Eugene, OR). Other chemicals
were as described by Uchida et al. (5).
RESULTS
Construction of a ppa1 (vma16) Null Mutant
Vma3p and its
homologue, Vma11p, have been shown to be required for activity and
assembly of the V-ATPase complex (30). To determine whether another
Vma3p homologue, Ppa1p (Vma16p) (31), is also required for expression
of the V-ATPase activity, we constructed and characterized a
ppa1 null mutant. One of the two copies of the
PPA1 gene in a wild type diploid strain, YPH501 (36), was disrupted by a DNA fragment replacing ~80% of the PPA1
reading frame with the TRP1 gene (Fig.
1A). The resulting
PPA1/ ppa1::TRP1 diploid
cells were sporulated, tetrads were dissected, and spores were checked
for viability and segregation of the TRP1 marker. Spores
were grown on YPD medium buffered at pH 5.0. Spore viability for the
heterozygous diploid was almost identical to that of the wild type
parent cells, and no anomalous segregation pattern was observed (data
not shown). These results indicate that the ppa1 mutant
is viable.
Fig. 1.
Construction of recombinant Vma3p, Vma11p,
and Vma16p (Ppa1p). A, schematic diagrams of Vma3p, Vma11p,
and Vma16p (Ppa1p). Predicted transmembrane domains are represented by
hatched boxes. Glutamic acid residues found in the predicted
transmembrane domains are indicated by an E in an open
circle. The extent of the deletion in vma16
( ppa1) mutant (RHP110) is also shown. Sequence encoding the HA epitope (filled box; YPYDVPDYA) (41) was introduced
into the genes just before the stop codon. B, alignment of
the amino acid sequences of Vma3p, Vma11p, and Vma16p (given in
single-letter codes) around the conserved glutamic acid
residues (indicated by arrows). aa, amino
acids.
[View Larger Version of this Image (35K GIF file)]
PPA1 (VMA16) Is Required for the V-ATPase
Activity
ppa1 cells displayed growth phenotypes
characteristic of mutants disrupted for VMA3,
VMA11, or other genes required for the V-ATPase activity
(VMA genes) (4, 23) (Table II). These include inability to grow in YPD medium buffered at pH 7.5 (17, 48), YPD medium
containing 100 mM CaCl2 (33, 48), or medium
containing glycerol as a sole carbon source (YPG) (33). The
ppa1 cells also failed to accumulate quinacrine in their
vacuoles, which indicates that the mutant vacuole is not acidified
(Table II). In addition, vacuolar membrane fractions isolated from the
ppa1 cells lacked bafilomycin A1-sensitive
ATPase activity (Table II). These results suggest that the
PPA1 gene is required for V-ATPase activity. Thus, the
PPA1 gene is an additional member of the VMA genes. The name PPA (for proteolipid of
proton ATPase) seems to be confusing because the
name is used by another gene with unrelated function (PPA2;
inorganic pyrophosphatase). We propose
here to rename the gene VMA16.
VMA16 (PPA1) Is Required for the Assembly of the V-ATPase
Complex
vma3 and vma11 mutant cells
fail to assemble V-ATPase subunits onto the vacuolar membrane (25, 30,
49). In addition, steady state levels of two integral subunits (100- and 17-kDa V0 subunits) are substantially lowered in these
mutants as compared with wild type cells (30, 49). Fig.
2 shows the steady state levels and distribution of the
V-ATPase subunits in wild type and vma16 mutant cells. As
observed for vma3 and vma11 mutant cells,
none of the V-ATPase subunits were detected in the vma16 mutant vacuolar membrane fraction. In addition, the levels of the
integral subunits (100- and 17-kDa V0 subunits) were
decreased significantly in the vma16 cells. Loss of
Vma16p did not affect the cellular levels of the V-ATPase subunits that
are peripherally associated with the membrane (all the V1
and the 36-kDa V0 subunit).3
Pulse-chase experiments of the 100-kDa subunit in vma16
cells showed that the subunit was synthesized normally compared with wild type but degraded more quickly by nonvacuolar protease(s) in the
mutant cells (data not shown). An increased rate of degradation of the
100-kDa subunit was also observed in vma3 and
vma11 cells (data not shown).
Fig. 2.
Detection of V-ATPase subunits in whole cell
extracts and vacuolar membrane fractions from wild type and
vma16 ( ppa1) cells. Proteins in
whole cell extracts (~40 µg/lane) and vacuolar membrane fractions
(~10 µg/lane) from YPH499 (wild type) and RHP110 ( vma16::TRP1) cells were subjected
to SDS-PAGE, and the levels of V-ATPase subunits were determined by
Western blot analysis. The amount of the 17-kDa subunits was analyzed
by examining the chloroform/methanol extracts of whole cells and
vacuolar membrane fractions.
[View Larger Version of this Image (44K GIF file)]
Construction of Strains Expressing Functional Epitope-tagged Vma11p
and Vma16p
The observed phenotypes of vma3,
vma11, and vma16 mutant cells were
indistinguishable from one another. The simplest interpretation of
these results would be that Vma11p and Vma16p are second and third
proteolipid subunits of the V-ATPase. However, a possible function for
these proteins in the assembly and/or vacuolar targeting of the enzyme
complex could also account for the phenotypes of the mutant cells
(44-46). To further investigate the function of Vma11p and Vma16p, we
examined the cellular localization of these proteins. Vma11p and Vma16p
were tagged at the C terminus with a nine-amino acid epitope of the
influenza virus hemagglutinin (HA) (41) (Fig. 1A) to allow
detection of the proteins by anti-HA antibodies. Recombinant DNA
fragments coding for the tagged proteins (Vma11p-HA and Vma16p-HA) were
constructed, and the chromosomal copies of the respective genes were
replaced with the tagged alleles (VMA11::HA and
VMA16::HA). Resultant strains
expressing Vma11p-HA (LGY11) or Vma16p-HA (LGY10) grew as well as wild
type cells (SF838-1D) on YPD medium buffered to pH 7.5, YPD
supplemented with 100 mM CaCl2, and YPG.
Vacuolar acidification was normal in these strains as indicated by
quinacrine uptake into the organelles (data not shown), and the
V-ATPase specific activity in isolated vacuolar membrane fractions was
similar to that in the wild type membranes (1.83, 1.14, and 1.23 µmol
ATP hydrolyzed/min/mg protein for SF838-1D, LGY11, and LGY10,
respectively). We conclude that the tagged Vma11p and Vma16p were
functional.
HA-tagged Vma11p and Vma16p Are Localized on the Vacuolar
Membrane
Localization of Vma11p-HA and Vma16p-HA was
analyzed by indirect immunofluorescence microscopy. Anti-HA antibodies
bound to the outline of vacuoles in LGY11
(VMA11::HA) and LGY10
(VMA16::HA) cells (Fig.
3). The staining pattern is similar to that of RHA374 expressing a functional HA-tagged Vma3p (Vma3p-HA), and no nonspecific staining was observed for the wild type cells. The discrete punctate pattern around the vacuole observed for Vma11p and Vma16p is often seen
when probing for other vacuolar membrane proteins, including the 100- and 69-kDa V-ATPase subunits (19, 25). These results indicate that
Vma11p-HA and Vma16p-HA are localized in the vacuolar membrane.
Fig. 3.
Immunolocalization of Vma11p-HA and
Vma16p-HA. SF838-1D (wild type), RHA374
(VMA3::HA), LGY11
(VMA11::HA), and LGY10 (VMA16::HA) cells were fixed,
spheroplasted, and stained with anti-HA antibodies. Cells were viewed
by Nomarski optics to observe cell morphology (Nomarski) and
epifluorescence microscopy using a filter specific for fluorescein to
observe anti-HA stain (Fluorescence).
[View Larger Version of this Image (52K GIF file)]
Fig. 4 shows the detection of Vma3p-HA, Vma11p-HA, and
Vma16p-HA in vacuolar membrane fractions by Western blot analysis. Vacuolar membrane fractions were prepared from RHA374 (lane
2), LGY11 (lane 3), or LGY10 (lane 4) and
probed with anti-HA antibodies. Each fraction contained a single major
polypeptide with a size expected for the tagged protein (indicated by
arrowheads in Fig. 4). We conclude that these polypeptides
represent the tagged proteins because they were uniquely found in each
membrane fraction. Protein bands with higher molecular masses are
presumably aggregates of the tagged proteins, because no cross-reactive
polypeptide was detected in the blot of the wild type proteins (Fig. 4,
lane 1). Vma3p-HA migrated slower than Vma11p-HA although
the calculated mass of Vma3p (16.4 kDa) (24, 25) is smaller than that
of Vma11p (17.0 kDa) (30). The reason for the unexpected behavior of
these proteins in the gel is currently unknown.
Fig. 4.
Detection of HA-tagged proteolipids in
isolated vacuolar membrane fractions. Proteins in the vacuolar
membrane fractions from SF838-1D (wild type; lane 1, 20 µg of proteins), RHA374 (VMA3::HA; lane 2, 2.5 µg), LGY11
(VMA11::HA, lane 3, 20 µg), or LGY10 (VMA16::HA; lanes
4, 20 µg) cells were examined by Western blot analysis with anti-HA antibodies. The HA-tagged proteins are indicated by
arrows.
[View Larger Version of this Image (37K GIF file)]
The signal intensity of Vma16p-HA (Fig. 4, lane 4) was
similar to that of Vma11p-HA (lane 3) and was 5-10 times
lower than that of Vma3p-HA (lane 2; eight times less amount
of proteins was loaded in lane 2). Although we cannot
estimate the exact molar ratio of the three proteins by this method,
this result suggests that Vma16p and Vma11p exist at lower levels than
Vma3p in the vacuolar membrane. The tagged proteins gave only weak
signals in both immunofluorescence microscopy and Western blot analysis when expressed in cells containing normal vacuolar protease activities, though the cells still display Vma+ phenotypes (data not
shown). The C-terminal ends of these proteins may be facing inside the
lumen of the vacuole, and the tag might be removed by the vacuolar
proteases. However, other interpretations of the data cannot be ruled
out at this time.
HA-tagged Vma11p and Vma16p Are Components of the V-ATPase
Complex
We next examined whether Vma11p and Vma16p are included
in the V-ATPase complex. Vacuolar membrane proteins from LGY11 and LGY10 cells were solubilized with ZW3-14 and fractionated through a
20-50% glycerol density gradient. Fractions from the gradients were
assayed for V-ATPase activity and subjected to Western blot analysis
with anti-V-ATPase subunit antibodies. Fig. 5 shows the distribution of two V-ATPase subunits (100-kDa V0 and
69-kDa V1 subunits) and the tagged proteins in the
gradient. As reported previously (18, 20), V-ATPase subunits
fractionate into two peaks, one that cofractionates with the ATPase
activity and contains both the V0 and V1
subunits (V0V1) (LGY11, fractions 8-10; LGY10, fractions 7-9) and the other that migrates to lower density near the
dipeptidyl aminopeptidase B protein (DPAP-B; ~120-kDa vacuolar membrane protein (43)) and contains only the V0 subunits
(LGY11, fraction 12; LGY10, fraction 11). The second peak in the lower density fractions is predicted to represent the V0
subcomplex not assembled with V1 subunits (20, 27, 50). The
distribution patterns of Vma11p-HA and Vma16p-HA matched exactly with
those of the 100- (Fig. 5) and 36-kDa (Ref. 20 and data not shown) V0 subunits, indicating that the two proteins are
physically associated with both the active V0V1
complex and the V0 subcomplex in the vacuolar membrane.
Fig. 5.
Detection of Vma11p-HA and Vma16p-HA in
glycerol gradient fractions containing the detergent-solubilized
V-ATPase complex. 500 µg of vacuolar membranes prepared from
either LGY11 (VMA11::HA) or LGY10
(VMA16::HA) were solubilized in 1%
(w/v) ZW3-14 and fractionated by centrifugation for 20 h at
175,000 × g through a 12-ml 20-50% glycerol
gradient. 750-µl fractions were collected, and 100 µl was assayed
immediately for ATPase and DPAP-B activity. Proteins were precipitated
from each fraction by the addition of 5% trichloroacetic acid (final
concentration), separated by SDS-PAGE, and probed with antibodies
specific for the 100- and 69-kDa V-ATPase subunits and the HA
epitope.
[View Larger Version of this Image (49K GIF file)]
Vma11p Glu145and Vma16p Glu108 Are Important
for the V-ATPase Activity
The glutamic acid residue at position
137 (Glu137) in Vma3p lies in the center of the predicted
fourth transmembrane domain of the subunit (Fig. 1, A and
B) (24, 25, 34). Mutational analysis of this residue has
suggested that the carboxyl side chain at this position is critical for
proton translocating activity (34). We examined whether Vma11p and
Vma16p also contain an acidic residue functionally similar to Vma3p
Glu137. Vma11p Glu145, Vma16p
Glu108, and Vma16p Glu188 (Fig. 1, A
and B) were modified by site-directed mutagenesis. No other
acidic residues are found in the predicted transmembrane domains of the
two proteins. vma11 mutant strains (vma11
E145D,E145L,E145Q) were constructed by replacing the chromosomal copy
of the gene with the mutant alleles. vma16 mutants were
constructed by introducing mutant genes (vma16
E108D,E108L,E108Q,E108V and vma16 E188D,E188Q,E188V) into
RHP110 ( vma16) on a low copy, centromere-based plasmid, pRS316 (36). Tables II and III summarize the growth
phenotypes and V-ATPase activities of the mutant cells compared with
wild type cells. Of the three residues examined, mutants of the Vma11p Glu145 and Vma16p Glu108 displayed phenotypes
similar to cells expressing Vma3p Glu137. These
residues could be functionally substituted by an aspartic acid residue,
but other mutations altering these residues (vma3 E137Q,E137V,E137K (see Ref. 34), vma11 E145L,E145Q, and
vma16 E108L,E108Q,E108V) (Tables II and III) completely
eliminated the V-ATPase activity. On the other hand, all of the Vma16p
Glu188 mutants produced a functional Vma16p, which indicates
that this residue is not essential for the activity of this protein.
These results suggest that Vma11p Glu145 and Vma16p
Glu108 may be functionally equivalent to Vma3p
Glu137.
Inactivating Mutations of Vma11p Glu145 and Vma16p
Glu108 Promote Assembly of V1 Subunits onto the
V0 Subcomplex in the Membrane
The phenotypes of the
mutants of Vma11p Glu145 and Vma16p Glu108
could be interpreted as indicating that the carboxyl side chains of
these residues are important for their activity. However, the inactivating mutations of the residues might alter the secondary or
tertiary structure of these polypeptides, thus inhibiting the assembly
and/or targeting of the V-ATPase complex. We therefore examined whether
the V-ATPase complex was assembled onto the vacuolar membrane in the
vma11 Glu145 and vma16
Glu108 mutant cells. Neither of the mutations inhibited the
assembly of the V-ATPase subunits onto the vacuolar membrane (Fig.
6, A and B), although the amounts
of membrane-bound V1 subunits appear to be increased in the
inactive vma11 and vma16 mutant cells (Fig. 6,
A, lanes 3 and 4, and B,
lanes 3-5) and will be discussed in a later section.
Solubilization and density gradient fractionation of the
vma11 E145L mutant vacuolar membrane proteins showed that the V-ATPase subunits in the mutant membrane were assembled almost exclusively into a high molecular weight complex (Fig.
7, RHA117, fractions 4-6) containing all the known
V-ATPase subunits. We found that vma16 E108L mutant vacuolar
membrane also contained a fully assembled V0V1
complex (data not shown). These results indicate that the
vma11 Glu145 and vma16 Glu108
mutations do not inhibit the assembly and vacuolar targeting of the
V-ATPase subunits. The mutant complex appeared to migrate to
denser fractions than the wild type complex (Fig. 7, A and B). The reason for this difference in the behavior of these
complexes is currently unknown. Although sometimes one or two
additional polypeptides were observed by Coomassie staining of the peak
fraction of the mutant V-ATPase complex, these proteins were not
consistently present in the peak fractions. It is most likely that
these polypeptides are the breakdown products of the V-ATPase subunits.
However, we cannot exclude the possibility that these proteins are
specifically associated with the mutant complex and thus changing its
mobility in the density gradient.
Fig. 6.
Assembly of V-ATPase subunits in wild type,
vma11 Glu145 and vma16
Glu108 cells. A, detection of V-ATPase
subunits in wild type and vma11 mutant vacuolar membranes.
Proteins in vacuolar membrane fractions (~10 µg) isolated from
RHA115 (wild type, lane 1), RHA116 (vma11 E145D,
lane 2), RHA117 (E145L, lane 3), RHA118 (E145Q, lane 4), and YRH11a ( vma11, lane 5)
were subjected to Western blot analysis with anti-V-ATPase subunit
antibodies. The levels of the 17-kDa subunit were analyzed by examining
the amount of polypeptide in chloroform/methanol extracts of the
vacuolar membrane fractions. The anti-100-kDa subunit monoclonal
antibody recognized two polypeptides of 100 and 75 kDa. The 75-kDa
species (asterisk) is a proteolytic product of the 100-kDa
subunit (3). B, detection of V-ATPase subunits in wild type
and vma16 mutant vacuolar membranes. V-ATPase subunits were
detected as described above in vacuolar membrane fractions (~10
µg/lane) isolated from RHP1100 (wild type; lane 1),
RHP1101 (vma16 E108D; lane 2), RHP1102 (E108V;
lane 3), RHP1105 (E108L; lane 4), RHP1106 (E108Q;
lane 5), and RH1108 ( vma16; lane
6). C, distribution of the 60-kDa V1
subunit in wild type (RHA 115) and vma11
Glu145 mutant (RHA 116-118) cells. Cells were
spheroplasted, lysed, and fractionated into membrane (P) and
cytosol (S) fractions. Proteins in each fraction
(corresponding to ~1 A600 of cells) were
resolved by SDS-PAGE, and the distribution of the 60-kDa V1
subunit was analyzed by Western blot analysis.
[View Larger Version of this Image (49K GIF file)]
Fig. 7.
Detection of V0V1 and
V0 complexes in glycerol gradient fractions containing
solubilized vacuolar membrane proteins. 850 µg of vacuolar
membranes prepared from either RHA115 (A, wild type) or
RHA117 (B, vma11 E145L) were solubilized in 1%
ZW3-14 (w/v) and fractionated by centrifugation for 14 h at
177,000 × g through a 10-ml 20-50% (2.5% steps)
glycerol gradient. 750-µl fractions were collected, and aliquots (100 µl each) were assayed for activity of the V-ATPase and DPAP-B.
Proteins were precipitated from each fraction by the addition of 5%
trichloroacetic acid (final concentration), separated by SDS-PAGE and
detected by staining with Coomassie Blue (Coom.). The
numbers in italics under the lanes represent
V-ATPase and DPAP-B activities for the corresponding fraction. Lanes
without numbers on the bottom contained activity less than 1 nmol/min/ml fraction. Distribution of the V-ATPase subunits
through the fractions was examined by Western blot analysis with
antibodies specific for the 100-, 69-, and 36-kDa V-ATPase subunits.
Gradient fractions are identified with even numbers starting
at the bottom of the gradient.
[View Larger Version of this Image (47K GIF file)]
Surprisingly, the inactivating Vma11p Glu145 and Vma16p
Glu108 mutations resulted in a higher degree of assembly of
the V1 subunits to the V0 subcomplex in the
vacuolar membrane (Fig. 6, A, lanes 3 and
4, and B, lanes 3-5). The levels of
V0 subunits in vacuolar membranes were kept at relatively
unchanged levels (Fig. 6, A and B). These
mutations did not affect the steady state levels of the V-ATPase
subunits (data not shown) but appeared to change the distribution of
the 60-kDa V1 subunit (Fig. 6C) from cytosol to
the membrane fractions. Fig. 7 shows that the second peak of the
V0 subunits (RHA115, fractions 8-10) was not prominent in the mutant membrane (RHA117, fraction 8). Similar changes in the ratio
of V0V1 and V0 complexes resolved
in glycerol gradient were observed for the vma16 E108L
mutant vacuolar membranes (data not shown). The lighter gradient
fractions of the vma11 E145L mutant in Fig. 7B
appeared to contain fewer proteins than the wild type fractions. Some
of the proteins in the mutant membranes might not have been solubilized
efficiently under the conditions that we used for solubilization of the
V-ATPase complexes. However, densitometric analyses of the Coomassie
Blue-stained gels indicated that the ratio of the total amounts of
69-kDa V1 subunit to the 36-kDa V0 subunit in
the gradient fractions remained unchanged from that in the membrane
(data not shown), indicating that there was no specific loss of
V0 subunits during solubilization and fractionation on the
gradient. These results suggest that the assembly and/or retention of
V1 subunits to the V0 subcomplex on the
vacuolar membrane was promoted in the vma11 E145L and
vma16 E108L mutant cells.
To further investigate the assembly status we also compared the effects
of nitrate on the wild type and mutant V-ATPase complexes. Nitrate
(50-100 mM) causes the stripping of V1 from
V0 only in the presence of Mg2+ and ATP (3).
The dissociation of V1 by these reagents is thought to be
triggered by a conformational change induced by the binding of ATP to a
nucleotide binding site in V1 (20). V1 subunits in the vma11 E145L mutant complex were released from the
membrane by the treatment with nitrate and Mg-ATP (Fig.
8). Incubation in a buffer without Mg-ATP or nitrate was
not effective at stripping V1 from the membranes (data not
shown). Therefore, the mutant enzyme complex is likely to retain a
structure that can bind ATP and execute the conformational change
triggered by the nucleotide binding.
Fig. 8.
Subunit stripping by ATP and nitrate.
Wild type (RHA115) or vma11 E145L mutant (RHA117) vacuolar
membranes were suspended in a solution containing 50 mM
Tris-Mes, pH 6.9, 5 mM MgCl2, 25 mM
KCl, 100 mM KNO3, and 5 mM ATP.
After incubation at 4 °C for 30 min, the suspension was centrifuged
at 100,000 × g for 1 h to yield pellet
(P) and supernatant (S) fractions. Proteins in each fraction were subjected to SDS-PAGE analysis, and V-ATPase subunits were detected by Coomassie Blue staining (A) or by
Western blot analysis with anti-69-kDa subunit monoclonal antibody
(B).
[View Larger Version of this Image (46K GIF file)]
DISCUSSION
In this paper, we showed that Vma11p and Vma16p are novel
proteolipid subunits of the yeast V-ATPase. The major evidence that supports our conclusion is as follows: 1) Cells disrupted for either
VMA11 or VMA16 are defective in the activity and
assembly of the V-ATPase. 2) The functional HA-tagged Vma11p and Vma16p reside on the vacuolar membrane and cofractionate with the V-ATPase complex when the enzyme is solubilized and purified by glycerol density
gradient centrifugation. 3) Loss-of-function mutants (e.g. vma11 E145L) of the two proteolipid subunits contain an inactive but fully assembled V-ATPase complex in the vacuolar membrane, suggesting that the functions of the two proteins are required during
the catalytic reaction. Therefore, the yeast V-ATPase contains three
different proteolipid subunits in its complex. It is unlikely that
these subunits are isoforms of different V-ATPases, because mutations
affecting any of these proteins completely inhibit the V-ATPase
activity in the vacuolar membrane (25, 30, 34, 48).
No polypeptide corresponding to Vma11p (17 kDa) or Vma16p (23 kDa) has
yet been identified by previous purification studies (3, 5). This might
be due to poor staining of these subunits by Coomassie Blue as has been
observed for the proteolipid subunits of the V- and
F0F1-type ATPases (25, 51). The levels of the HA-tagged subunits suggest that Vma11p and Vma16p are present at lower
levels than Vma3p in the vacuolar membrane, although the exact molar
ratio of the three proteolipid subunits in the enzyme complex remains
to be determined. This might also be the reason that only Vma3p
has been identified by previous biochemical studies of the
V-ATPase.
In this work, we demonstrated that the three yeast V-ATPase proteolipid
subunits exhibit many common properties. The primary structures of
these proteins are similar to one another, and all three subunits are
essential for activity and assembly of the enzyme complex (24, 25, 30,
48). Furthermore, each contains a glutamic acid residue that lies in a
predicted transmembrane domain and is required for V-ATPase activity
(Glu137 in Vma3p, Glu145 in Vma11p, and
Glu108 in Vma16p) (Fig. 1) (34). These results indicate
that the three subunits share a common function, which is most likely
to be involved in the proton transport activity of the enzyme
complex.
The phenotypes of the mutants altering the conserved glutamic acid
residues in Vma3p, Vma11p, and Vma16p are similar but not identical.
Generally, mutations at Vma3p Glu137 appeared to be more
severe than those of the other two. For example, Vma3p E137D appears to
be only partially active (34), whereas Vma11p E145D and Vma16p E108D
are fully functional. Only vma3 E137Q, but not
vma11 E145Q and vma16 E108Q, inhibits cell growth in YNBD medium buffered to pH7.5 when each of the mutant genes is
introduced into wild type haploid cells on a low copy, centromere-based plasmid (pRS316).4 This dominant negative
phenotype produced by the vma3 E137Q mutation, together with
the relative abundance of Vma3p-HA in the vacuolar membrane, may
suggest that Vma3p is the major proteolipid subunit in the enzyme
complex. The coated vesicle proton pump is reported to contain six
copies of the 17-kDa proteolipid subunits (52), and binding of
N,N -dicyclohexylcarbodiimide to a single copy of
this subunit is sufficient to abolish the enzyme activity (53). Providing that both wild type and mutant subunits are expressed in the
same cells and incorporation of a single mutant 17-kDa subunit inhibits
the enzyme activity, the fraction of the active ATPase complex is
expected to increase as the copy number of the subunit decreases. In
this scenario, the defects resulting from mutations in Vma3p would be
more detrimental. Of course, the mutant phenotypes might reflect the
difference in the functions of the conserved glutamic acid
residues in the three proteins. It will be important in the future to
establish the function, subunit interaction, and stoichiometry of these
proteins individually.
Our present work raises many questions about the proteolipid subunit
content of V-type ATPases in other organelles and organisms. The
~20-kDa V0 subunits present in the V-type ATPases of
bovine chromaffin granules and coated vesicles have been reported to exhibit similar biochemical properties to those of the 17-kDa proteolipid subunits (52, 54) and thus are candidates for a
"second" proteolipid subunit in their enzyme complexes. It should be noted that cDNA fragments capable of encoding all or part of Vma16p homologues have been isolated from plant, mouse, human, and
nematode.5 Although yeast cells appear to
have two V-ATPase complexes, one containing Vph1p and the other
containing Stv1p (14, 29), it is highly likely that all three
proteolipid subunits function in both V-ATPase complexes, because
vma3, vma11, and vma16 mutants each display phenotypes identical to stv1 vph1
double mutants (25, 29, 30, 48).
The inactivating mutations of Vma11p Glu145 and Vma16p
Glu108 do not inhibit the assembly and targeting of the
V-ATPase subunits but instead promote the binding of the V1
subunits to the V0 subcomplex on the vacuolar membrane,
resulting in an increase in the population of inactive but fully
assembled V0V1 complex. These results suggest that the equilibrium of assembly/disassembly of the V1
subunits to the V0 subcomplex is altered in the mutant
cells. Reversible assembly of the V1 subunits to the
V0 domain in vivo has been found to be
responsive for physiological changes. Kane (27) has shown that
dissociation and reassembly of V1 and V0 can
occur rapidly in vivo in response to changes in nutrient
conditions. Sumner et al. (55) reported that the
inactivation of the Munduca sexta plasma membrane V-ATPase
during molting parallels the dissociation of V1 subunits
from V0 in the membrane. In this context, it will be
interesting to investigate whether the V-ATPase complex senses changes
in a proton motive force loaded across the vacuolar membrane or an ATP
potential in the cytosol under different nutritional conditions.
In summary, Vma11p and Vma16p are novel proteolipid subunits of the
yeast V-ATPase, which show properties similar to Vma3p. Despite the
structural and functional similarities of these polypeptides, our
results reveal that a single V-ATPase complex must contain at least one
copy of each of the three proteolipids. The three proteolipid subunits
must therefore participate cooperatively in proton transport through
the V0 sector and thus regulate vacuolar acidification. Our
future studies will address these issues.
FOOTNOTES
*
This work was supported by a Grant-in-Aid for Scientific
Research on Priority Areas of Cellular Energy from the Ministry of Education, Science, Sports and Culture of Japan (to Y. A.), a Grant-in-Aid for Encouragement of Young Scientists from the Ministry of
Education, Science, Sports and Culture of Japan (to R. H.), a grant
from the Human Frontier Science Program Organization (to Y. A. and T. H. S.), a grant for promotion of research from the Institute of
Physical and Chemical Research (to R. H.), a grant for Biodesign
Research Program from the Institute of Physical and Chemical Research
(to A. T.), and Grant GM38006 from the National Institutes of Health
(to T. H. S.). The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed. Tel.:
81-3-3812-2111 (ext. 4461); Fax: 81-3-3812-4929; E-mail:
anraku{at}uts2.s.u-tokyo.ac.jp.
1
The abbreviations used are: V-ATPase, S. cerevisiae vacuolar membrane ATPase; HA, influenza virus
hemagglutinin protein; Vma11p-HA; HA-tagged Vma11p, V-type
ATPase, vacuolar-type ATPase; PAGE, polyacrylamide gel electrophoresis;
DPAP-B, dipeptidyl aminopeptidase B; kb, kilobase(s); ZW3-14,
zwitterionic detergent,
N-tetradecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate.
2
In this paper, Vma3p and Vma11p are used to
indicate the protein products of the respective genes. The term "the
17 kDa subunit" is reserved mainly for referring to the polypeptide
biochemically identified in the V-ATPase complex.
3
Although we had previously reported a decrease
in the steady state level of the 36-kDa subunit in yeast cells lacking
Vma3p (20), more recent kinetic analyses indicate that the 36-kDa subunit is equally stable in wild type, vma3,
vma11, and vma16 cells (L. A. Graham and T. H. Stevens, unpublished results).
4
R. Hirata, unpublished results.
5
VMA16 homologues were identified in
the GenBankTM data base using the tfasta algorithm. Identification
numbers for the sequences are N38329[GenBank] (Alabidopsis thaliana),
HSIMBB190 (human), W17408[GenBank] (mouse), and CET01H3 (Caenorhabditis
elegans).
Acknowledgments
We thank the University of Oregon Animal Care
Facility for assistance in preparing polyclonal antibodies.
REFERENCES
-
Anraku, Y., Umemoto, N., Hirata, R., and Ohya, Y.
(1992)
J. Bioenerg. Biomembr.
24,
395-405
[CrossRef][Medline]
[Order article via Infotrieve]
-
Kakinuma, Y., Ohsumi, Y., and Anraku, Y.
(1981)
J. Biol. Chem.
256,
10859-10863
[Abstract/Free Full Text]
-
Kane, P. M., Yamashiro, C. T., and Stevens, T. H.
(1989)
J. Biol. Chem.
264,
19236-19244
[Abstract/Free Full Text]
-
Anraku, Y.
(1996)
in
Handbook of Biological Physics (Konings, W. N., Kaback, H. R., and Lolkema, J. S., eds), Vol. 2, pp. 93-109, Elsevier Science Publishing Co., Inc., New York
-
Uchida, E., Ohsumi, Y., and Anraku, Y.
(1985)
J. Biol. Chem.
260,
1090-1095
[Abstract/Free Full Text]
-
Anraku, Y., Hirata, R., Wada, Y., and Ohya, Y.
(1992)
J. Exp. Biol.
172,
67-81
[Abstract/Free Full Text]
-
Stevens, T. H.
(1992)
J. Exp. Biol.
172,
47-55
[Free Full Text]
-
Forgac, M.
(1989)
Physiol. Rev.
69,
765-796
[Free Full Text]
-
Gluck, S.
(1992)
J. Exp. Biol.
172,
29-37
[Abstract/Free Full Text]
-
Wada, Y., and Anraku, Y.
(1994)
J. Bioenerg. Biomembr.
26,
631-637
[CrossRef][Medline]
[Order article via Infotrieve]
-
Mellman, I.
(1992)
J. Exp. Biol.
172,
39-45
[Free Full Text]
-
Forgac, M.
(1992)
J. Exp. Biol.
172,
155-169
[Abstract/Free Full Text]
-
Uchida, E., Ohsumi, Y., and Anraku, Y.
(1988)
J. Biol. Chem.
263,
45-51
[Abstract/Free Full Text]
-
Manolson, M. F., Proteau, D., Preston, R. A., Stenbit, A., Roberts, B. T., Hoyt, M. A., Preuss, D., Mulholland, J., Botstein, D., and Jones, E. W.
(1992)
J. Biol. Chem.
267,
14294-14303
[Abstract/Free Full Text]
-
Hirata, R., Ohsumi, Y., Nakano, A., Kawasaki, H., Suzuki, K., and Anraku, Y.
(1990)
J. Biol. Chem.
265,
6726-6733
[Abstract/Free Full Text]
-
Nelson, H., Mandiyan, S., and Nelson, N.
(1989)
J. Biol. Chem.
264,
1775-1778
[Abstract/Free Full Text]
-
Yamashiro, C. T., Kane, P. M., Wolczyk, D. F., Preston, R. A., and Stevens, T. H.
(1990)
Mol. Cell. Biol.
10,
3737-3749
[Abstract/Free Full Text]
-
Ho, M. N., Hirata, R., Umemoto, N., Ohya, Y., Takatsuki, A., Stevens, T. H., and Anraku, Y.
(1993)
J. Biol. Chem.
268,
18286-18292
[Abstract/Free Full Text]
-
Ho, M. N., Hill, K. J., Lindorfer, M. A., and Stevens, T. H.
(1993)
J. Biol. Chem.
268,
221-227
[Abstract/Free Full Text]
-
Bauerle, C., Ho, M. N., Lindorfer, M. A., and Stevens, T. H.
(1993)
J. Biol. Chem.
268,
12749-12757
[Abstract/Free Full Text]
-
Foury, F.
(1990)
J. Biol. Chem.
265,
18554-18560
[Abstract/Free Full Text]
-
Graham, L. A., Hill, K. J., and Stevens, T. H.
(1994)
J. Biol. Chem.
269,
25974-25977
[Abstract/Free Full Text]
-
Graham, L. A., Hill, K. J., and Stevens, T. H.
(1995)
J. Biol. Chem.
270,
15037-15044
[Abstract/Free Full Text]
-
Nelson, H., and Nelson, N.
(1989)
FEBS Lett.
247,
147-153
[CrossRef][Medline]
[Order article via Infotrieve]
-
Umemoto, N., Yoshihisa, T., Hirata, R., and Anraku, Y.
(1990)
J. Biol. Chem.
265,
18447-18453
[Abstract/Free Full Text]
-
Beltrán, C., Kopecky, J., Pan, Y.-C. E., Nelson, H., and Nelson, N.
(1992)
J. Biol. Chem.
267,
774-779
[Abstract/Free Full Text]
-
Kane, P. M.
(1995)
J. Biol. Chem.
270,
17025-17032
[Abstract/Free Full Text]
-
Supekova, L., Supek, F., and Nelson, N.
(1995)
J. Biol. Chem.
270,
13726-13732
[Abstract/Free Full Text]
-
Manolson, M. F., Wu, B., Proteau, D., Taillon, B. E., Roberts, B. T., Hoyt, M. A., and Jones, E. W.
(1994)
J. Biol. Chem.
269,
14064-14074
[Abstract/Free Full Text]
-
Umemoto, N., Ohya, Y., and Anraku, Y.
(1991)
J. Biol. Chem.
266,
24526-24532
[Abstract/Free Full Text]
-
Apperson, M., Jensen, R. E., Suda, K., Witte, C., and Yaffe, M. P.
(1990)
Biochem. Biophys. Res. Commun.
168,
574-579
[CrossRef][Medline]
[Order article via Infotrieve]
-
Nelson, N.
(1992)
J. Bioenerg. Biomembr.
24,
407-414
[CrossRef][Medline]
[Order article via Infotrieve]
-
Ohya, Y., Umemoto, N., Tanida, I., Ohta, A., Iida, H., and Anraku, Y.
(1991)
J. Biol. Chem.
266,
13971-13977
[Abstract/Free Full Text]
-
Noumi, T., Beltrán, C., Nelson, H., and Nelson, N.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
1938-1942
[Abstract/Free Full Text]
-
Rothman, J. H., and Stevens, T. H.
(1986)
Cell
47,
1041-1051
[CrossRef][Medline]
[Order article via Infotrieve]
-
Sikorski, R. S., and Hieter, P.
(1989)
Genetics
122,
19-27
[Abstract/Free Full Text]
-
Jones, J. S., and Prakash, L.
(1990)
Yeast
6,
363-366
[CrossRef][Medline]
[Order article via Infotrieve]
-
Kaiser, C., Michaelis, S., and Mitchell, A.
(1994)
Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
-
Vieira, J., and Messing, J.
(1987)
Methods Enzymol.
153,
3-11
[Medline]
[Order article via Infotrieve]
-
Sayers, J. R., Schmidt, W., and Eckstein, F.
(1988)
Nucleic Acids Res.
16,
791-802
[Abstract/Free Full Text]
-
Kolodziej, P. A., and Young, R. A.
(1991)
Methods Enzymol.
194,
508-519
[Medline]
[Order article via Infotrieve]
-
Kunkel, T. A.
(1985)
Proc. Natl. Acad. Sci. U. S. A.
82,
488-492
[Abstract/Free Full Text]
-
Roberts, C. J., Pohlig, G., Rothman, J. H., and Stevens, T. H.
(1989)
J. Cell Biol.
108,
1363-1373
[Abstract/Free Full Text]
-
Hill, K. J., and Stevens, T. H.
(1994)
Mol. Biol. Cell
5,
1039-1050
[Abstract]
-
Hirata, R., Umemoto, N., Ho, M. N., Ohya, Y., Stevens, T. H., and Anraku, Y.
(1993)
J. Biol. Chem.
268,
961-967
[Abstract/Free Full Text]
-
Hill, K. J., and Stevens, T. H.
(1995)
J. Biol. Chem.
270,
22329-22336
[Abstract/Free Full Text]
-
Sambrook, J., Fritsch, E. F., and Maniatis, T.
(1989)
Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
-
Nelson, H., and Nelson, N.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
3503-3507
[Abstract/Free Full Text]
-
Kane, P. M., Kuehn, M. C., Howald-Stevenson, I., and Stevens, T. H.
(1992)
J. Biol. Chem.
267,
447-454
[Abstract/Free Full Text]
-
Doherty, R. D., and Kane, P. M.
(1993)
J. Biol. Chem.
268,
16845-16851
[Abstract/Free Full Text]
-
Hoppe, J., and Sebald, W.
(1984)
Biochim. Biophys. Acta
768,
164-200
[Medline]
[Order article via Infotrieve]
-
Arai, H., Terres, G., Pink, S., and Forgac, M.
(1988)
J. Biol. Chem.
263,
8796-8802
[Abstract/Free Full Text]
-
Arai, H., Berne, M., and Forgac, M.
(1987)
J. Biol. Chem.
262,
11006-11011
[Abstract/Free Full Text]
-
Moriyama, Y., and Nelson, N.
(1989)
Biochim. Biophys. Acta
980,
241-247
[Medline]
[Order article via Infotrieve]
-
Sumner, J.-P., Dow, J. A. T., Earley, F. G. P., Klein, U., Jager, D., and Wieczorek, H.
(1995)
J. Biol. Chem.
270,
5649-5653
[Abstract/Free Full Text]
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
S. Saroussi and N. Nelson
The little we know on the structure and machinery of V-ATPase
J. Exp. Biol.,
June 1, 2009;
212(11):
1604 - 1610.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Bond and M. Forgac
The Ras/cAMP/Protein Kinase A Pathway Regulates Glucose-dependent Assembly of the Vacuolar (H+)-ATPase in Yeast
J. Biol. Chem.,
December 26, 2008;
283(52):
36513 - 36521.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Wang, M. Toei, and M. Forgac
Analysis of the Membrane Topology of Transmembrane Segments in the C-terminal Hydrophobic Domain of the Yeast Vacuolar ATPase Subunit a (Vph1p) by Chemical Modification
J. Biol. Chem.,
July 25, 2008;
283(30):
20696 - 20702.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Wang, D. J. Cipriano, and M. Forgac
Arrangement of Subunits in the Proteolipid Ring of the V-ATPase
J. Biol. Chem.,
November 23, 2007;
282(47):
34058 - 34065.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. J. Bowman, M. E. McCall, R. Baertsch, and E. J. Bowman
A Model for the Proteolipid Ring and Bafilomycin/Concanamycin-binding Site in the Vacuolar ATPase of Neurospora crassa
J. Biol. Chem.,
October 20, 2006;
281(42):
31885 - 31893.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Owegi, D. L. Pappas, M. W. Finch Jr.,, S. A. Bilbo, C. A. Resendiz, L. J. Jacquemin, A. Warrier, J. D. Trombley, K. M. McCulloch, K. L. M. Margalef, et al.
Identification of a Domain in the Vo Subunit d That Is Critical for Coupling of the Yeast Vacuolar Proton-translocating ATPase
J. Biol. Chem.,
October 6, 2006;
281(40):
30001 - 30014.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Drory and N. Nelson
The emerging structure of vacuolar ATPases.
Physiology,
October 1, 2006;
21:
317 - 325.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Chavez, E. J. Bowman, J. C. Reidling, K. H. Haw, and B. J. Bowman
Analysis of Strains with Mutations in Six Genes Encoding Subunits of the V-ATPase: EUKARYOTES DIFFER IN THE COMPOSITION OF THE V0 SECTOR OF THE ENZYME
J. Biol. Chem.,
September 15, 2006;
281(37):
27052 - 27062.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Ochotny, A. Van Vliet, N. Chan, Y. Yao, M. Morel, N. Kartner, H. P. von Schroeder, J. N. M. Heersche, and M. F. Manolson
Effects of Human a3 and a4 Mutations That Result in Osteopetrosis and Distal Renal Tubular Acidosis on Yeast V-ATPase Expression and Activity
J. Biol. Chem.,
September 8, 2006;
281(36):
26102 - 26111.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Compton, L. A. Graham, and T. H. Stevens
Vma9p (Subunit e) Is an Integral Membrane V0 Subunit of the Yeast V-ATPase
J. Biol. Chem.,
June 2, 2006;
281(22):
15312 - 15319.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. M. Kane
The Where, When, and How of Organelle Acidification by the Yeast Vacuolar H+-ATPase
Microbiol. Mol. Biol. Rev.,
March 1, 2006;
70(1):
177 - 191.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Wang, T. Inoue, and M. Forgac
Subunit a of the Yeast V-ATPase Participates in Binding of Bafilomycin
J. Biol. Chem.,
December 9, 2005;
280(49):
40481 - 40488.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Inoue and M. Forgac
Cysteine-mediated Cross-linking Indicates That Subunit C of the V-ATPase Is in Close Proximity to Subunits E and G of the V1 Domain and Subunit a of the V0 Domain
J. Biol. Chem.,
July 29, 2005;
280(30):
27896 - 27903.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Wassmer, M. Froissard, H. Plattner, R. Kissmehl, and J. Cohen
The vacuolar proton-ATPase plays a major role in several membrane-bounded organelles in Paramecium
J. Cell Sci.,
July 1, 2005;
118(13):
2813 - 2825.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Owegi, A. L. Carenbauer, N. M. Wick, J. F. Brown, K. L. Terhune, S. A. Bilbo, R. S. Weaver, R. Shircliff, N. Newcomb, and K. J. Parra-Belky
Mutational Analysis of the Stator Subunit E of the Yeast V-ATPase
J. Biol. Chem.,
May 6, 2005;
280(18):
18393 - 18402.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Murata, I. Yamato, Y. Kakinuma, A. G. W. Leslie, and J. E. Walker
Structure of the Rotor of the V-Type Na+-ATPase from Enterococcus hirae
Science,
April 29, 2005;
308(5722):
654 - 659.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Malkus, L. A. Graham, T. H. Stevens, and R. Schekman
Role of Vma21p in Assembly and Transport of the Yeast Vacuolar ATPase
Mol. Biol. Cell,
November 1, 2004;
15(11):
5075 - 5091.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Wang, T. Inoue, and M. Forgac
TM2 but Not TM4 of Subunit c'' Interacts with TM7 of Subunit a of the Yeast V-ATPase as Defined by Disulfide-mediated Cross-linking
J. Biol. Chem.,
October 22, 2004;
279(43):
44628 - 44638.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. R. Flannery, L. A. Graham, and T. H. Stevens
Topological Characterization of the c, c', and c'' Subunits of the Vacuolar ATPase from the Yeast Saccharomyces cerevisiae
J. Biol. Chem.,
September 17, 2004;
279(38):
39856 - 39862.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. J. Bowman, L. A. Graham, T. H. Stevens, and B. J. Bowman
The Bafilomycin/Concanamycin Binding Site in Subunit c of the V-ATPases from Neurospora crassa and Saccharomyces cerevisiae
J. Biol. Chem.,
August 6, 2004;
279(32):
33131 - 33138.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Sambade and P. M. Kane
The Yeast Vacuolar Proton-translocating ATPase Contains a Subunit Homologous to the Manduca sexta and Bovine e Subunits That Is Essential for Function
J. Biol. Chem.,
April 23, 2004;
279(17):
17361 - 17365.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Lu, Y. Y. Sautin, L. S. Holliday, and S. L. Gluck
The Glycolytic Enzyme Aldolase Mediates Assembly, Expression, and Activity of Vacuolar H+-ATPase
J. Biol. Chem.,
March 5, 2004;
279(10):
8732 - 8739.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Nishi, S. Kawasaki-Nishi, and M. Forgac
Expression and Function of the Mouse V-ATPase d Subunit Isoforms
J. Biol. Chem.,
November 21, 2003;
278(47):
46396 - 46402.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Kawasaki-Nishi, T. Nishi, and M. Forgac
Interacting Helical Surfaces of the Transmembrane Segments of Subunits a and c' of the Yeast V-ATPase Defined by Disulfide-mediated Cross-linking
J. Biol. Chem.,
October 24, 2003;
278(43):
41908 - 41913.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Yokoyama, K. Nagata, H. Imamura, S. Ohkuma, M. Yoshida, and M. Tamakoshi
Subunit Arrangement in V-ATPase from Thermus thermophilus
J. Biol. Chem.,
October 24, 2003;
278(43):
42686 - 42691.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Aviezer-Hagai, V. Padler-Karavani, and N. Nelson
Biochemical support for the V-ATPase rotary mechanism: antibody against HA-tagged Vma7p or Vma16p but not Vma10p inhibits activity
J. Exp. Biol.,
September 15, 2003;
206(18):
3227 - 3237.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. Bayer, C. Reese, S. Buhler, C. Peters, and A. Mayer
Vacuole membrane fusion: V0 functions after trans-SNARE pairing and is coupled to the Ca2+-releasing channel
J. Cell Biol.,
July 21, 2003;
162(2):
211 - 222.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Hirata, A. Iwamoto-Kihara, G.-H. Sun-Wada, T. Okajima, Y. Wada, and M. Futai
Subunit Rotation of Vacuolar-type Proton Pumping ATPase: RELATIVE ROTATION OF THE G AND c SUBUNITS
J. Biol. Chem.,
June 20, 2003;
278(26):
23714 - 23719.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Toyomura, Y. Murata, A. Yamamoto, T. Oka, G.-H. Sun-Wada, Y. Wada, and M. Futai
From Lysosomes to the Plasma Membrane: LOCALIZATION OF VACUOLAR TYPE H+-ATPase WITH THE a3 ISOFORM DURING OSTEOCLAST DIFFERENTIATION
J. Biol. Chem.,
June 6, 2003;
278(24):
22023 - 22030.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Murata, I. Arechaga, I. M. Fearnley, Y. Kakinuma, I. Yamato, and J. E. Walker
The Membrane Domain of the Na+-motive V-ATPase from Enterococcus hirae Contains a Heptameric Rotor
J. Biol. Chem.,
May 30, 2003;
278(23):
21162 - 21167.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Nishi, S. Kawasaki-Nishi, and M. Forgac
The First Putative Transmembrane Segment of Subunit c" (Vma16p) of the Yeast V-ATPase Is Not Necessary for Function
J. Biol. Chem.,
February 14, 2003;
278(8):
5821 - 5827.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Namy, I. Hatin, G. Stahl, H. Liu, S. Barnay, L. Bidou, and J.-P. Rousset
Gene Overexpression as a Tool for Identifying New trans-Acting Factors Involved in Translation Termination in Saccharomyces cerevisiae
Genetics,
June 1, 2002;
161(2):
585 - 594.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G.-H. Sun-Wada, Y. Imai-Senga, A. Yamamoto, Y. Murata, T. Hirata, Y. Wada, and M. Futai
A Proton Pump ATPase with Testis-specific E1-Subunit Isoform Required for Acrosome Acidification
J. Biol. Chem.,
May 10, 2002;
277(20):
18098 - 18105.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Belgareh-Touze, S. Avaro, Y. Rouille, B. Hoflack, and R. Haguenauer-Tsapis
Yeast Vps55p, a Functional Homolog of Human Obesity Receptor Gene-related Protein, Is Involved in Late Endosome to Vacuole Trafficking
Mol. Biol. Cell,
May 1, 2002;
13(5):
1694 - 1708.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. M. Smardon, M. Tarsio, and P. M. Kane
The RAVE Complex Is Essential for Stable Assembly of the Yeast V-ATPase
J. Biol. Chem.,
April 12, 2002;
277(16):
13831 - 13839.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. J. Bowman and E. J. Bowman
Mutations in Subunit c of the Vacuolar ATPase Confer Resistance to Bafilomycin and Identify a Conserved Antibiotic Binding Site
J. Biol. Chem.,
February 1, 2002;
277(6):
3965 - 3972.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Kawasaki-Nishi, T. Nishi, and M. Forgac
Arg-735 of the 100-kDa subunit a of the yeast V-ATPase is essential for proton translocation
PNAS,
October 5, 2001;
(2001)
221291798.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. C. Jones
Introduction of a Carboxyl Group in the First Transmembrane Helix of Escherichia coli F1Fo ATPase Subunit c and Cytoplasmic pH Regulation
J. Bacteriol.,
March 1, 2001;
183(5):
1524 - 1530.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
K. Yokoyama, S. Ohkuma, H. Taguchi, T. Yasunaga, T. Wakabayashi, and M. Yoshida
V-Type H+-ATPase/Synthase from a Thermophilic Eubacterium, Thermus Thermophilus. SUBUNIT STRUCTURE AND OPERON
J. Biol. Chem.,
April 28, 2000;
275(18):
13955 - 13961.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Toyomura, T. Oka, C. Yamaguchi, Y. Wada, and M. Futai
Three Subunit a Isoforms of Mouse Vacuolar H+-ATPase. PREFERENTIAL EXPRESSION OF THE a3 ISOFORM DURING OSTEOCLAST DIFFERENTIATION
J. Biol. Chem.,
March 17, 2000;
275(12):
8760 - 8765.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Kawamura, K. Arakawa, M. Maeshima, and S. Yoshida
Tissue Specificity of E Subunit Isoforms of Plant Vacuolar H+-ATPase and Existence of Isotype Enzymes
J. Biol. Chem.,
February 25, 2000;
275(9):
6515 - 6522.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Graham, B Powell, and T. Stevens
Composition and assembly of the yeast vacuolar H(+)-ATPase complex
J. Exp. Biol.,
January 1, 2000;
203(1):
61 - 70.
[Abstract]
|
 |
|

|
 |

|
 |
 
M Forgac
Structure, mechanism and regulation of the clathrin-coated vesicle and yeast vacuolar H(+)-ATPases
J. Exp. Biol.,
January 1, 2000;
203(1):
71 - 80.
[Abstract]
|
 |
|

|
 |

|
 |
 
P. Kane and K. Parra
Assembly and regulation of the yeast vacuolar H(+)-ATPase
J. Exp. Biol.,
January 1, 2000;
203(1):
81 - 87.
[Abstract]
|
 |
|

|
 |

|
 |
 
N Nelson, N Perzov, A Cohen, K Hagai, V Padler, and H Nelson
The cellular biology of proton-motive force generation by V-ATPases
J. Exp. Biol.,
January 1, 2000;
203(1):
89 - 95.
[Abstract]
|
 |
|

|
 |

|
 |
 
M Futai, T Oka, G Sun-Wada, Y Moriyama, H Kanazawa, and Y Wada
Luminal acidification of diverse organelles by V-ATPase in animal cells
J. Exp. Biol.,
January 1, 2000;
203(1):
107 - 116.
[Abstract]
|
 |
|

|
 |

|
 |
 
S. Rahlfs, S. Aufurth, and V. Muller
The Na+-F1F0-ATPase Operon from Acetobacterium woodii. OPERON STRUCTURE AND PRESENCE OF MULTIPLE COPIES OF atpE WHICH ENCODE PROTEOLIPIDS OF 8- AND 18-kDa
J. Biol. Chem.,
November 26, 1999;
274(48):
33999 - 34004.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Xu, E. Vasilyeva, and M. Forgac
Subunit Interactions in the Clathrin-coated Vesicle Vacuolar (H+)-ATPase Complex
J. Biol. Chem.,
October 8, 1999;
274(41):
28909 - 28915.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Cohen, N. Perzov, H. Nelson, and N. Nelson
A Novel Family of Yeast Chaperons Involved in the Distribution of V-ATPase and Other Membrane Proteins
J. Biol. Chem.,
September 17, 1999;
274(38):
26885 - 26893.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Landolt-Marticorena, W. H. Kahr, P. Zawarinski, J. Correa, and M. F. Manolson
Substrate- and Inhibitor-induced Conformational Changes in the Yeast V-ATPase Provide Evidence for Communication between the Catalytic and Proton-translocating Sectors
J. Biol. Chem.,
September 10, 1999;
274(37):
26057 - 26064.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Harrison, J. Murray, B. Powell, Y.-I. Kim, M. E. Finbow, and J. B. C. Findlay
Helical Interactions and Membrane Disposition of the 16-kDa Proteolipid Subunit of the Vacuolar H+-ATPase Analyzed by Cysteine Replacement Mutagenesis
J. Biol. Chem.,
September 3, 1999;
274(36):
25461 - 25470.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. M. Kane, M. Tarsio, and J. Liu
Early Steps in Assembly of the Yeast Vacuolar H+-ATPase
J. Biol. Chem.,
June 11, 1999;
274(24):
17275 - 17283.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X.-H. Leng, T. Nishi, and M. Forgac
Transmembrane Topography of the 100-kDa a Subunit (Vph1p) of the Yeast Vacuolar Proton-translocating ATPase
J. Biol. Chem.,
May 21, 1999;
274(21):
14655 - 14661.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Forgac
Structure and Properties of the Vacuolar (H+)-ATPases
J. Biol. Chem.,
May 7, 1999;
274(19):
12951 - 12954.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Nelson and W. R. Harvey
Vacuolar and Plasma Membrane Proton-Adenosinetriphosphatases
Physiol Rev,
April 1, 1999;
79(2):
361 - 385.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Sze, X. Li, and M. G. Palmgren
Energization of Plant Cell Membranes by H+-Pumping ATPases: Regulation and Biosynthesis
PLANT CELL,
April 1, 1999;
11(4):
677 - 690.
[Full Text]
|
 |
|

|
 |

|
 |
 
S.-B. Peng, X. Li, B. P. Crider, Z. Zhou, P. Andersen, S. J. Tsai, X.-S. Xie, and D. K. Stone
Identification and Reconstitution of an Isoform of the 116-kDa Subunit of the Vacuolar Proton Translocating ATPase
J. Biol. Chem.,
January 22, 1999;
274(4):
2549 - 2555.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. J. Parra and P. M. Kane
Reversible Association between the V1 and V0 Domains of Yeast Vacuolar H+-ATPase Is an Unconventional Glucose-Induced Effect
Mol. Cell. Biol.,
December 1, 1998;
18(12):
7064 - 7074.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
Y. Kakinuma
Inorganic Cation Transport and Energy Transduction in Enterococcus hirae and Other Streptococci
Microbiol. Mol. Biol. Rev.,
December 1, 1998;
62(4):
1021 - 1045.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Oka, R. Yamamoto, and M. Futai
Multiple Genes for Vacuolar-type ATPase Proteolipids in Caenorhabditis elegans. A NEW GENE, vha-3, HAS A DISTINCT CELL-SPECIFIC DISTRIBUTION
J. Biol. Chem.,
August 28, 1998;
273(35):
22570 - 22576.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. A. Graham, K. J. Hill, and T. H. Stevens
Assembly of the Yeast Vacuolar H+-ATPase Occurs in the Endoplasmic Reticulum and Requires a Vma12p/Vma22p Assembly Complex
J. Cell Biol.,
July 13, 1998;
142(1):
39 - 49.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Kagiwada, K. Hosaka, M. Murata, J.-i. Nikawa, and A. Takatsuki
The Saccharomyces cerevisiae SCS2 Gene Product, a Homolog of a Synaptobrevin-Associated Protein, Is an Integral Membrane Protein of the Endoplasmic Reticulum and Is Required for Inositol Metabolism
J. Bacteriol.,
April 1, 1998;
180(7):
1700 - 1708.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
X. Li, R. T. C. Su, H.-t. Hsu, and H. Sze
The Molecular Chaperone Calnexin Associates with the Vacuolar H+-ATPase from Oat Seedlings
PLANT CELL,
January 1, 1998;
10(1):
119 - 130.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
Y. E. Oluwatosin and P. M. Kane
Mutations in the CYS4 Gene Provide Evidence for Regulation of the Yeast Vacuolar H+-ATPase by Oxidation and Reduction in Vivo
J. Biol. Chem.,
October 31, 1997;
272(44):
28149 - 28157.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. J. Tomashek, L. A. Graham, M. U. Hutchins, T. H. Stevens, and D. J. Klionsky
V1-situated Stalk Subunits of the Yeast Vacuolar Proton-translocating ATPase
J. Biol. Chem.,
October 17, 1997;
272(42):
26787 - 26793.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. D. Jackson and T. H. Stevens
VMA12 Encodes a Yeast Endoplasmic Reticulum Protein Required for Vacuolar H+-ATPase Assembly
J. Biol. Chem.,
October 10, 1997;
272(41):
25928 - 25934.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Murata, K. Takase, I. Yamato, K. Igarashi, and Y. Kakinuma
Purification and Reconstitution of Na+-translocating Vacuolar ATPase from Enterococcus hirae
J. Biol. Chem.,
October 3, 1997;
272(40):
24885 - 24890.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Oka, R. Yamamoto, and M. Futai
Three vha Genes Encode Proteolipids of Caenorhabditis elegans Vacuolar-type ATPase. GENE STRUCTURES AND PREFERENTIAL EXPRESSION IN AN H-SHAPED EXCRETORY CELL AND RECTAL CELLS
J. Biol. Chem.,
September 26, 1997;
272(39):
24387 - 24392.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. J. Tomashek, B. S. Garrison, and D. J. Klionsky
Reconstitution in Vitro of the V1 Complex from the Yeast Vacuolar Proton-translocating ATPase. ASSEMBLY RECAPITULATES MECHANISM
J. Biol. Chem.,
June 27, 1997;
272(26):
16618 - 16623.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Landolt-Marticorena, K. M. Williams, J. Correa, W. Chen, and M. F. Manolson
Evidence That the NH2 Terminus of Vph1p, an Integral Subunit of the V0 Sector of the Yeast V-ATPase, Interacts Directly with the Vma1p and Vma13p Subunits of the V1 Sector
J. Biol. Chem.,
May 12, 2000;
275(20):
15449 - 15457.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Powell, L. A. Graham, and T. H. Stevens
Molecular Characterization of the Yeast Vacuolar H+-ATPase Proton Pore
J. Biol. Chem.,
July 28, 2000;
275(31):
23654 - 23660.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Kawasaki-Nishi, T. Nishi, and M. Forgac
Yeast V-ATPase Complexes Containing Different Isoforms of the 100-kDa a-subunit Differ in Coupling Efficiency and in Vivo Dissociation
J. Biol. Chem.,
May 18, 2001;
276(21):
17941 - 17948.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Nishi, S. Kawasaki-Nishi, and M. Forgac
Expression and Localization of the Mouse Homologue of the Yeast V-ATPase 21-kDa Subunit c'' (Vma16p)
J. Biol. Chem.,
August 31, 2001;
276(36):
34122 - 34130.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Keenan Curtis and P. M. Kane
Novel Vacuolar H+-ATPase Complexes Resulting from Overproduction of Vma5p and Vma13p
J. Biol. Chem.,
January 18, 2002;
277(4):
2716 - 2724.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Arata, J. D. Baleja, and M. Forgac
Cysteine-directed Cross-linking to Subunit B Suggests That Subunit E Forms Part of the Peripheral Stalk of the Vacuolar H+-ATPase
J. Biol. Chem.,
January 25, 2002;
277(5):
3357 - 3363.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Kawasaki-Nishi, T. Nishi, and M. Forgac
Arg-735 of the 100-kDa subunit a of the yeast V-ATPase is essential for proton translocation
PNAS,
October 23, 2001;
98(22):
12397 - 12402.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1997 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|