Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hirata, R.
Right arrow Articles by Anraku, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hirata, R.
Right arrow Articles by Anraku, Y.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 8, Issue of February 21, 1997 pp. 4795-4803
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

VMA11 and VMA16 Encode Second and Third Proteolipid Subunits of the Saccharomyces cerevisiae Vacuolar Membrane H+-ATPase*

(Received for publication, July 23, 1996, and in revised form, November 5, 1996)

Ryogo Hirata Dagger , Laurie A. Graham §, Akira Takatsuki Dagger , Tom H. Stevens § and Yasuhiro Anraku par

From the Dagger  Institute of Physical and Chemical Research (RIKEN), Hirosawa, Wako-shi, Saitama 351-01, Japan, the § Institute of Molecular Biology, University of Oregon, Eugene, Oregon 97403-1229, and the  Department of Biological Sciences, Graduate School of Science, University of Tokyo, Hongo, Bunkyo-ku, Tokyo 113, Japan

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
Acknowledgments
REFERENCES


ABSTRACT

The vacuolar membrane H+-ATPase (V-ATPase) of the yeast Saccharomyces cerevisiae is composed of peripheral catalytic (V1) and integral membrane (V0) domains. The 17-kDa proteolipid subunit (VMA3 gene product; Vma3p) is predicted to constitute at least part of the proton translocating pore of V0. Recently, two VMA3 homologues, VMA11 and VMA16 (PPA1), have been identified in yeast, and VMA11 has been shown to be required for the V-ATPase activity. Cells disrupted for the VMA16 gene displayed the same phenotypes as those lacking either Vma3p or Vma11p; the mutant cells lost V-ATPase activity and failed to assemble V-ATPase subunits onto the vacuolar membrane. Epitope-tagged Vma11p and Vma16p were detected on the vacuolar membrane by immunofluorescence microscopy. Density gradient fractionation of the solubilized vacuolar proteins demonstrated that the tagged proteins copurified with the V-ATPase complex. We conclude that Vma11p and Vma16p are essential subunits of the V-ATPase. Vma3p contains a conserved glutamic acid residue (Glu137) whose carboxyl side chain is predicted to be important for proton transport activity. Mutational analysis of Vma11p and Vma16p revealed that both proteins contain a glutamic acid residue (Vma11p Glu145 and Vma16p Glu108) functionally similar to Vma3p Glu137. These residues could only be functionally substituted by an aspartic acid residue, because other mutations we examined inactivated the enzyme activity. Assembly and vacuolar targeting of the enzyme complex was not inhibited by these mutations. These results suggest that the three proteolipid subunits have similar but not redundant functions, each of which is most likely involved in proton transport activity of the enzyme complex. Yeast cells contain V0 and V1 subcomplexes in the vacuolar membrane and in the cytosol, respectively, that can be assembled into the active V0V1 complex in vivo. Surprisingly, loss-of-function mutations of either Vma11p Glu145 or Vma16p Glu108 resulted in a higher degree of assembly of the V1 subunits onto the V0 subcomplex in the vacuolar membrane.


INTRODUCTION

The vacuolar membrane ATPase (V-ATPase)1 of the yeast Saccharomyces cerevisiae belongs to the vacuolar-type (V-type) proton pump (1-7). The V-type ATPase acidifies various endomembrane organelles in eucaryotic cells, including the Golgi apparatus, lysosomes, coated vesicles, and chromaffin granules (8). This type of proton pump is also found in the plasma membrane of certain specialized cells (9). Organelle acidification and/or membrane energization by the V-type ATPase is important for such processes as receptor-mediated endocytosis, protein sorting, zymogen activation, and solute uptake into a specific organelle (8, 10, 11).

The V-type ATPase consists of two structural domains, V1 and V0, both of which are composed of several different subunits (4, 7, 12). The peripheral V1 domain possesses the nucleotide binding site(s) required for ATP hydrolysis (5, 7, 12, 13). The integral V0 domain translocates protons across the membrane and anchors the peripheral V1 domain to the membrane (4, 7, 12). The yeast V-ATPase is composed of at least seven V1 subunits (69, 60, 54, 42, 32, 27, and 14 kDa) and three V0 subunits (100, 36, and 17 kDa) (14-26). The 36-kDa subunit is not an integral membrane protein but stably associates with the V0 subcomplex and thus is considered to be a nonintegral component of the V0 domain (20, 27). Recently, another essential subunit of 13 kDa was identified (28). The membrane disposition of this subunit has not yet been unambiguously determined.

Yeast cells also express genes that encode proteins with sequence similarity to the 100-kDa (Vph1p) and the 17-kDa (Vma3p)2 V-ATPase subunits (29-31). STV1 encodes a polypeptide of 102 kDa with 54% amino acid identity to Vph1p (14, 29). Stv1p is localized to nonvacuolar membranes, possibly endosomal and/or Golgi membrane, and is not required for vacuolar membrane V-ATPase activity. Overexpression of Stv1p induces mislocalization of this protein to the vacuolar membrane and can partially complement the phenotypes associated with the loss of V-ATPase activity in Delta vph1 mutant cells (29). From these observations, it has been proposed that yeast cells possess another V-type ATPase acidifying organelles (containing Stv1p) other than vacuoles and that the 100-kDa subunit isoforms are responsible for targeting of the V-type ATPases to different organelles (29).

VMA11 and VMA16 genes can encode polypeptides of 17 and 23 kDa with 56 and 35% amino acid identity to Vma3p, respectively (24, 25, 30, 31). Vma3p is a hydrophobic polypeptide chemically characterized as a proteolipid (soluble in chloroform/methanol) and is thought to constitute all or part of the proton translocating pore in V0 (5, 24, 25). Homologous subunits are found universally in V-type ATPase complexes characterized from various membrane sources, and all amino acid sequences determined for the subunits contain a conserved glutamic acid residue predicted to be critical for proton transport activity (32). VMA11 was cloned by complementation of the growth defect of a calcium sensitive mutant, cls9 (30, 33). Unlike STV1, VMA11 is required for the activity and assembly of the vacuolar membrane V-ATPase complex (30, 33). VMA16 was originally identified as PPA1, an open reading frame adjacent to the MAS2 gene (31). Initial gene disruption analysis demonstrated that Vma16p is important for cell growth (31), but the physiological function of this protein remained unclear.

In this work, the function of Vma11p and Vma16p was studied by examining the cellular localization of these proteins and by characterizing phenotypes of the cells carrying mutant forms of each protein. Our results indicate that Vma11p and Vma16p are novel V0 subunits of the V-ATPase complex essential for enzyme activity. We also report here that both proteins contain a glutamic acid residue important for their function as found for Vma3p (34), and inactivating mutations of these residues influence the assembly status of the enzyme complex.


EXPERIMENTAL PROCEDURES

Strains and Culture Conditions

Yeast strains used in this study are listed in Table I. RHA374, LGY11, and LGY10 are VMA3::HA, VMA11:: HA, and VMA16::HA derivatives, respectively, of SF838-1D (35). YRH11a and RHP110 are isogenic to YPH499 (36) except Delta vma11:: TRP1 and Delta vma16::TRP1, respectively. RHA115 (VMA11::TRP1) was constructed by inserting a TRP1 gene fragment in the upstream region of the VMA11 in YPH499. RHA115 is Trp+ and Vma+. RHA116 (E145D), RHA117 (E145L), and RHA118 (E145Q) are vma11 mutant derivatives of RHA115. RHP1100-RHP1107 are isogenic to RHP110, except that each carries a wild type or mutant vma16 gene on a yeast low copy, centromere-based plasmid, pRS316 (36). RHP1108 is RHP110 harboring pRS316.

Table I.

Strains and plasmids used in this study


Strains Genotype References

SF838-1D MATalpha ura3-52 his4-519 ade6 leu2-3,112 pep4-3 gal2 35
YPH499 MATa ura3-52 lys2-801 ade2-101 trp1-Delta 63 his3-Delta 200 leu2-Delta 1 36
YPH501 MATa/MATalpha ura3-52/ura3-52 lys2-801/lys2-801 ade2-101/ade2-101 trp1-Delta 63/trp1-Delta 63 his3-Delta 200/his3-Delta 200 leu2-Delta 1/leu2-Delta 1 36
YRH11a MATa ura3-52 lys2-801 ade2-101 trp1-Delta 63 his3-Delta 200 leu2-Delta 1 Delta vma11::TRP1 This study
RHP110 MATa ura3-52 lys2-801 ade2-101 trp1-Delta 63 his3-Delta 200 leu2-Delta 1 Delta vma16::TRP1 This study
RHA374 MATalpha ura3-52 his4-519 ade6 leu2-3,112 pep4-3 gal2 VMA3::HA This study
LGY11 MATalpha ura3-52 his4-519 ade6 leu2-3,112 pep4-3 gal2 VMA11::HA This study
LGY10 MATalpha ura3-52 his4-519 ade6 leu2-3,112 pep4-3 gal2 VMA16::HA This study
RHA115 MATa ura3-52 lys2-801 ade2-101 trp1-Delta 63 his3-Delta 200 leu2-Delta 1 VMA11::TRP1 This study
RHA116 MATa ura3-52 lys2-801 ade2-101 trp1-Delta 63 his3-Delta 200 leu2-Delta 1 vma11(E145D)::TRP1 This study
RHA117 MATa ura3-52 lys2-801 ade2-101 trp1-Delta 63 his3-Delta 200 leu2-Delta 1 vma11(E145L)::TRP1 This study
RHA118 MATa ura3-52 lys2-801 ade2-101 trp1-Delta 63 his3-Delta 200 leu2-Delta 1 vma11(E145Q)::TRP1 This study
RHP1100 RHP110 carrying pRHP111 (VMA16) This study
RHP1101 RHP110 carrying pRHP131 (vma16 E108D) This study
RHP1102 RHP110 carrying pRHP132 (vma16 E108V) This study
RHP1103 RHP110 carrying pRHP133 (vma16 E188D) This study
RHP1104 RHP110 carrying pRHP134 (vma16 E188V) This study
RHP1105 RHP110 carrying pRHP135 (vma16 E108L) This study
RHP1106 RHP110 carrying pRHP136 (vma16 E108Q) This study
RHP1107 RHP110 carrying pRHP137 (vma16 E188Q) This study
RHP1108 RHP110 carrying pRS316 This study
Plasmids Description References

pRS316 centromere-based, low copy plasmid (pCEN-URA3) 36
pRHA150 1.8-kb EcoRV-SpeI VMA11 gene fragment cloned into pBluescript KS+ This study
pRHP111 3.4-kb XbaI-EcoRI VMA16 gene fragment cloned into pRS316 This study
pRHP131 same as pRHP111 except vma16 E108D This study
pRHP132 same as pRHP111 except vma16 E108V This study
pRHP133 same as pRHP111 except vma16 E188D This study
pRHP134 same as pRHP111 except vma16 E188V This study
pRHP135 same as pRHP111 except vma16 E108L This study
pRHP136 same as pRHP111 except vma16 E108Q This study
pRHP137 same as pRHP111 except vma16 E188Q This study

Yeast cells were grown in YPD medium (1% yeast extract (Difco), 2% Bactopeptone (Difco), and 2% glucose), YPG medium (1% yeast extract, 2% Bactopeptone, and 3% glycerol), or YNBD medium (0.67% yeast nitrogen base (Difco) and 2% glucose). YPD medium was buffered at pH 5.0 or 7.5 with 50 mM phosphate/succinate buffer as described previously (17). Calcium sensitivity of the cells was examined on YPD medium supplemented with 100 mM CaCl2 (33).

Disruption of the VMA11 Gene

Null vma11 mutants were constructed as follows. A 1.8-kb EcoRV-SpeI fragment containing the VMA11 gene was cloned into pBluescript KS+ (Stratagene), creating pRHA150. pRHA150 was digested with XhoI and HindIII, blunted with Klenow, and religated to remove the ClaI and HincII sites originating from the multicloning site of pBluescript KS+. The 0.6-kb HincII-ClaI (blunt) fragment of pRHA151 was replaced with a 0.85-kb EcoRI-BglII (blunt) fragment of pJJ280 (TRP1) (37) to create Delta vma11::TRP1 (pRHA163). The Delta vma11 fragment in pRHA163 was isolated from the plasmid by digestion with EcoRV and SpeI and used to construct the disruption strain YRH11a by the method as described previously (38).

Isolation and Disruption of the VMA16 (PPA1) Gene

Two oligonucleotide primers, atcgaagttgttttcagtctc and acatgtatctcagatatctca were synthesized based on the reported sequence of the VMA16 (PPA1) gene (31) and used to amplify the gene fragment by polymerase chain reaction from yeast chromosomal DNA in the presence of digoxigenin-11-dUTP. A yeast genomic DNA library (18) was screened by hybridization with the digoxigenin-labeled VMA16 fragment to isolate the full-length VMA16 gene. A 2.0-kb NcoI (blunt ended)-EcoRI fragment containing the VMA16 gene was cloned into the SmaI-EcoRI site of pUC119 (39) to yield pRHP152. A 0.6-kb BamHI-EcoRV fragment within the VMA16 gene was replaced with a 0.94-kb BamHI-HincII TRP1 fragment from pJJ281 (37) to create pRHP165. The Delta vma16::TRP1 fragment was liberated from the plasmid by HpaI-BglI digestion and used to disrupt the chromosomal VMA16 gene by the method as described in Ref. 38.

Epitope Tagging of Vma3p, Vma11p, and Vma16p

VMA3::HA gene fragment was constructed as follows. A 1.6-kb EcoRI fragment containing the VMA3 open reading frame was cloned into pBluescript KS+, and the resultant plasmid was mutagenized to introduce AatII and NheI restriction sites near the 3' end of the VMA3 open reading frame with a mutagenic primer, ctagctagcagacgacgtcttgagtagccctggagttca (40). Then the AatII-NheI fragment, encoding the last four amino acids of Vma3p, was replaced with a synthetic oligonucleotide duplex coding for the last four amino acids followed by a nine amino acid HA epitope (YPYDVPDYA) (41). A 1-kb AgeI-EcoRI fragment containing a part of the VMA3::HA gene fragment was cloned into a yeast integrating vector pRS306 (36), digested with HindIII, and used to substitute for the chromosomal VMA3 gene by two step gene replacement (38).

Site-directed mutagenesis following the method of Kunkel (42) was performed to epitope tag VMA11 at the extreme C terminus. The primer ttttaaacttttgactcacgcatagtcaggaacat<UNL>catatg</UNL>ggtattcagagcctc was used to introduce the sequence encoding the HA epitope just prior to the stop codon of VMA11. The generation of pLG36 (pRS316-VMA11::HA) was determined by the introduction of a unique NdeI site within the oligonucleotide sequence (underlined). A 2-kb KpnI-SacI fragment from pLG36 containing VMA11::HA was subcloned into pRS306 creating pLG40. The chromosomal copy of VMA11 was replaced by VMA11::HA to generate the yeast strain LGY11 by transformation of SF838-1D with linearized pLG40 (BglII) and two-step gene replacement.

The sequence encoding the HA epitope was introduced into VMA16 before the stop codon by site-directed mutagenesis using the primer tggtttgagcgcttacgcatagtcaggaacat<UNL>catatg</UNL>ggtactgaaattcagaagc. The creation of pLG32 (pRS316-VMA16::HA) was confirmed by the presence of a unique NdeI restriction enzyme site (underlined). pLG34 was generated by subcloning a 1.9-kb SacI-KpnI fragment from pLG32 containing VMA16::HA into pRS306. The chromosomal copy of VMA16 was replaced by VMA16::HA to generate the yeast strain LGY10 by transformation with linearized pLG34 (BstUI) as described above.

Site-directed Mutagenesis of the VMA11 gene

vma11 genes with a mutation at the glutamic acid at position 145 (Glu145) were constructed by site-directed mutagenesis of pRHA150. Mutagenic primers used were, accatataacccta<UNL>acacgt</UNL>cagagaaaattaga (E145D), tataaccctaaa<UNL>actagt</UNL>gagaaaattagaat (E145L), and taccatataaccct<UNL>agtact</UNL>tgagagaaaattagaat (E145Q). Each primer introduces a unique restriction site (underlined) to screen for the introduced mutation. A 0.85-kb EcoRI-BglII (blunt) fragment from pJJ280 (TRP1) (37) was inserted at the SnaBI site of the resultant mutant plasmids as a marker for mutant selection. The SnaBI site is located ~450 base pairs 5' of the initiating ATG, and insertion of the TRP1 gene into the wild type VMA11 gene at this position did not affect the cell growth or the V-ATPase activity (data not shown). The mutant vma11 fragments were used to substitute for the chromosomal VMA11 gene in YPH499 to yield RHA116-118. vma11 mutants were selected by Trp+ phenotype, and introduction of the mutations was confirmed by Southern blot analysis of chromosomal DNA.

Site-directed Mutagenesis of the VMA16 Gene

A 3.4-kb XbaI-EcoRI fragment containing the VMA16 gene was cloned into pRS316 (36) to create pRHP111. Site-directed mutagenesis of the VMA16 gene was done by two sequential polymerase chain reaction reactions with pRHP111 and overlapping forward and reverse mutagenic primers as described (40). Nucleotide sequences of the mutant gene fragments were confirmed by DNA sequence analysis. The wild type and mutant vma16 plasmids (listed in Table I) were introduced into RHP110 (Delta vma16::TRP1) to yield RHP1100 (pRHP111, wild type), RHP1101 (pRHP131, E108D), RHP1102 (pRHP132, E108V), RHP1103 (pRHP133, E188D), RHP1104 (pRHP134, E188V), RHP1105 (pRHP135, E108L), RHP1106 (pRHP136, E108Q), and RHP1107 (pRHP137, E188Q).

Protein Preparation, SDS-PAGE, and Western Blot Analysis

Preparation of vacuolar membrane fractions and purification of the V-ATPase were previously described (3, 5). When vacuolar membranes were prepared from strains (RHP1100-RHP1108) expressing Vma16p from pRS316 (URA3+)-based plasmids, cells were grown in YNBD (-uracil) supplemented with 0.5% casamino acids (Difco). Each vacuolar membrane fraction was assayed for the vacuolar membrane marker, dipeptidyl aminopeptidase B (DPAP-B) (43), and a purification index, which was expressed as the ratio of the specific DPAP-B activity in the vacuolar membrane to the activity in spheroplast lysate, was determined. Vacuolar membrane fractions with a purification index of >30 (5) were used throughout this study. Protein extracts of whole cell and vacuolar membrane fractions were prepared as described by Hill and Stevens (44). Proteolipid subunits were purified by chloroform/methanol extraction of whole cell extracts or vacuolar membranes (45). Crude membrane and cytosolic fractions were prepared as follows. Yeast cells were spheroplasted and lysed with a Dounce homogenizer in a buffer containing 50 mM Tris-HCl, pH 7.5, 0.2 M Sorbitol, 1 mM EDTA, 2 µg/ml each of antipain, aprotinin, leupeptin, chymostatin, pepstatin, and 0.5 mM phenylmethanesulfonyl fluoride. The homogenate was centrifuged at 500 × g for 5 min to remove unbroken cells and then fractionated into membrane and cytosolic fractions by centrifugation at 100,000 × g for 1 h. Proteins were solubilized and subjected to SDS-PAGE analysis as described in Ref. 20. Immunoblots were prepared and probed as described (46).

Antibodies

Monoclonal antibodies for the 100- (7B1), 69- (R70), and 42-kDa (7A2) subunits and polyclonal antisera for the 60-, 54-, 36-, and 27-kDa subunits were used under the conditions as described (46). Affinity purified antibodies that recognize the 12CA5 epitope peptide (YPYDVPDYA) were prepared and used as described (22).

Other Methods

Recombinant DNA manipulations were performed as described (38, 47). Fluorescence microscopy was done essentially as described (44). Affinity purified anti-HA polyclonal serum was used at a 1:40 dilution. Vacuolar acidification in vivo was examined by quinacrine staining of the cells (25). V-ATPase activity (ATPase activity sensitive to 0.1 µM bafilomycin A1) of wild type and site-directed mutants was assayed at 30 °C as described (5). The reaction mixture (100 µl) contained 25 mM Tris-Mes (pH 6.9), 5 mM MgCl2, 25 mM KCl, 5 mM ATP-2Na+, and vacuolar membrane vesicles (10-20 µg of protein). Prior to the assay of ATPase activity, the reaction mixture (without ATP) was incubated with or without 0.1 µM bafilomycin A1 for 20 min on ice, and then the reaction was started by adding ATP. Bafilomycin A1 was added as an ethanolic solution, and control activities were determined in the presence of an equivalent amount of ethanol. All samples contained 1% ethanol, and this concentration of ethanol did not inhibit the enzyme activity. V-ATPase activity of the membrane fractions from LGY11 (VMA11::HA), LGY10 (VMA16::HA), and SF838-1D was assayed as described (3).

Materials

Enzymes for recombinant DNA methods were purchased from Takara Shuzo Co., Ltd. (Kyoto, Japan) or New England Biolabs, Inc. (Beverly, MA). Bafilomycin A1 was from Wako Pure Chemical Industries, Ltd. (Osaka, Japan). Monoclonal antibodies were obtained from Molecular Probes, Inc. (Eugene, OR). Other chemicals were as described by Uchida et al. (5).


RESULTS

Construction of a ppa1 (vma16) Null Mutant

Vma3p and its homologue, Vma11p, have been shown to be required for activity and assembly of the V-ATPase complex (30). To determine whether another Vma3p homologue, Ppa1p (Vma16p) (31), is also required for expression of the V-ATPase activity, we constructed and characterized a ppa1 null mutant. One of the two copies of the PPA1 gene in a wild type diploid strain, YPH501 (36), was disrupted by a DNA fragment replacing ~80% of the PPA1 reading frame with the TRP1 gene (Fig. 1A). The resulting PPA1/Delta ppa1::TRP1 diploid cells were sporulated, tetrads were dissected, and spores were checked for viability and segregation of the TRP1 marker. Spores were grown on YPD medium buffered at pH 5.0. Spore viability for the heterozygous diploid was almost identical to that of the wild type parent cells, and no anomalous segregation pattern was observed (data not shown). These results indicate that the Delta ppa1 mutant is viable.


Fig. 1. Construction of recombinant Vma3p, Vma11p, and Vma16p (Ppa1p). A, schematic diagrams of Vma3p, Vma11p, and Vma16p (Ppa1p). Predicted transmembrane domains are represented by hatched boxes. Glutamic acid residues found in the predicted transmembrane domains are indicated by an E in an open circle. The extent of the deletion in Delta vma16 (Delta ppa1) mutant (RHP110) is also shown. Sequence encoding the HA epitope (filled box; YPYDVPDYA) (41) was introduced into the genes just before the stop codon. B, alignment of the amino acid sequences of Vma3p, Vma11p, and Vma16p (given in single-letter codes) around the conserved glutamic acid residues (indicated by arrows). aa, amino acids.
[View Larger Version of this Image (35K GIF file)]


PPA1 (VMA16) Is Required for the V-ATPase Activity

Delta ppa1 cells displayed growth phenotypes characteristic of mutants disrupted for VMA3, VMA11, or other genes required for the V-ATPase activity (VMA genes) (4, 23) (Table II). These include inability to grow in YPD medium buffered at pH 7.5 (17, 48), YPD medium containing 100 mM CaCl2 (33, 48), or medium containing glycerol as a sole carbon source (YPG) (33). The Delta ppa1 cells also failed to accumulate quinacrine in their vacuoles, which indicates that the mutant vacuole is not acidified (Table II). In addition, vacuolar membrane fractions isolated from the Delta ppa1 cells lacked bafilomycin A1-sensitive ATPase activity (Table II). These results suggest that the PPA1 gene is required for V-ATPase activity. Thus, the PPA1 gene is an additional member of the VMA genes. The name PPA (for proteolipid of proton ATPase) seems to be confusing because the name is used by another gene with unrelated function (PPA2; inorganic pyrophosphatase). We propose here to rename the gene VMA16.

Table II.

Phenotypes of vma16 mutant cells


Strains Growtha
Vacuolar acidificationb V-ATPase activityc
pH 5 pH 7.5 CaCl2 YPG

Wild type ++ ++ ++ ++ + 177
 Delta vma16 +  -  -  -  - 0
E108D ++ ++ ++ ++ + 163
E108V +  -  -  -  - 0
E108Q +  -  -  -  - 2
E108L +  -  -  -  - 0
E188D ++ ++ ++ ++ + NDd
E188V ++ ++ ++ ++ + ND
E188Q ++ ++ ++ ++ + ND

a  pH 5, YPD buffered to pH 5; pH 7.5, YPD buffered to pH 7.5; CaCl2 YPD supplemented with 100 mM CaCl2; YPG, YP containing glycerol as a sole carbon source. ++, grows as well as wild type cells; +, grows well but slower than wild-type cells; -, no growth.
b  Vacuolar acidification was monitored by quinacrine staining in vivo.
c  Bafilomycin A1-sensitive ATPase activity in vacuolar membrane fractions (nmol ATP hydrolyzed/min/mg protein). The ATPase activity was assayed at 30 °C as described under "Experimental Procedures." The vacuolar membrane fractions were isolated from cells grown in YNBD medium to minimize plasmid loss during cell growth. This presumably is the reason for the low V-ATPase activity measured in this series of experiments as compared with that in other experiments (cultured in rich medium (YPD), Table III). The purity of the fractions was not affected by growing the cells in YNBD medium.
d  ND, not determined.

VMA16 (PPA1) Is Required for the Assembly of the V-ATPase Complex

Delta vma3 and Delta vma11 mutant cells fail to assemble V-ATPase subunits onto the vacuolar membrane (25, 30, 49). In addition, steady state levels of two integral subunits (100- and 17-kDa V0 subunits) are substantially lowered in these mutants as compared with wild type cells (30, 49). Fig. 2 shows the steady state levels and distribution of the V-ATPase subunits in wild type and Delta vma16 mutant cells. As observed for Delta vma3 and Delta vma11 mutant cells, none of the V-ATPase subunits were detected in the Delta vma16 mutant vacuolar membrane fraction. In addition, the levels of the integral subunits (100- and 17-kDa V0 subunits) were decreased significantly in the Delta vma16 cells. Loss of Vma16p did not affect the cellular levels of the V-ATPase subunits that are peripherally associated with the membrane (all the V1 and the 36-kDa V0 subunit).3 Pulse-chase experiments of the 100-kDa subunit in Delta vma16 cells showed that the subunit was synthesized normally compared with wild type but degraded more quickly by nonvacuolar protease(s) in the mutant cells (data not shown). An increased rate of degradation of the 100-kDa subunit was also observed in Delta vma3 and Delta vma11 cells (data not shown).


Fig. 2. Detection of V-ATPase subunits in whole cell extracts and vacuolar membrane fractions from wild type and Delta vma16 (Delta ppa1) cells. Proteins in whole cell extracts (~40 µg/lane) and vacuolar membrane fractions (~10 µg/lane) from YPH499 (wild type) and RHP110 (Delta vma16::TRP1) cells were subjected to SDS-PAGE, and the levels of V-ATPase subunits were determined by Western blot analysis. The amount of the 17-kDa subunits was analyzed by examining the chloroform/methanol extracts of whole cells and vacuolar membrane fractions.
[View Larger Version of this Image (44K GIF file)]


Construction of Strains Expressing Functional Epitope-tagged Vma11p and Vma16p

The observed phenotypes of Delta vma3, Delta vma11, and Delta vma16 mutant cells were indistinguishable from one another. The simplest interpretation of these results would be that Vma11p and Vma16p are second and third proteolipid subunits of the V-ATPase. However, a possible function for these proteins in the assembly and/or vacuolar targeting of the enzyme complex could also account for the phenotypes of the mutant cells (44-46). To further investigate the function of Vma11p and Vma16p, we examined the cellular localization of these proteins. Vma11p and Vma16p were tagged at the C terminus with a nine-amino acid epitope of the influenza virus hemagglutinin (HA) (41) (Fig. 1A) to allow detection of the proteins by anti-HA antibodies. Recombinant DNA fragments coding for the tagged proteins (Vma11p-HA and Vma16p-HA) were constructed, and the chromosomal copies of the respective genes were replaced with the tagged alleles (VMA11::HA and VMA16::HA). Resultant strains expressing Vma11p-HA (LGY11) or Vma16p-HA (LGY10) grew as well as wild type cells (SF838-1D) on YPD medium buffered to pH 7.5, YPD supplemented with 100 mM CaCl2, and YPG. Vacuolar acidification was normal in these strains as indicated by quinacrine uptake into the organelles (data not shown), and the V-ATPase specific activity in isolated vacuolar membrane fractions was similar to that in the wild type membranes (1.83, 1.14, and 1.23 µmol ATP hydrolyzed/min/mg protein for SF838-1D, LGY11, and LGY10, respectively). We conclude that the tagged Vma11p and Vma16p were functional.

HA-tagged Vma11p and Vma16p Are Localized on the Vacuolar Membrane

Localization of Vma11p-HA and Vma16p-HA was analyzed by indirect immunofluorescence microscopy. Anti-HA antibodies bound to the outline of vacuoles in LGY11 (VMA11::HA) and LGY10 (VMA16::HA) cells (Fig. 3). The staining pattern is similar to that of RHA374 expressing a functional HA-tagged Vma3p (Vma3p-HA), and no nonspecific staining was observed for the wild type cells. The discrete punctate pattern around the vacuole observed for Vma11p and Vma16p is often seen when probing for other vacuolar membrane proteins, including the 100- and 69-kDa V-ATPase subunits (19, 25). These results indicate that Vma11p-HA and Vma16p-HA are localized in the vacuolar membrane.


Fig. 3. Immunolocalization of Vma11p-HA and Vma16p-HA. SF838-1D (wild type), RHA374 (VMA3::HA), LGY11 (VMA11::HA), and LGY10 (VMA16::HA) cells were fixed, spheroplasted, and stained with anti-HA antibodies. Cells were viewed by Nomarski optics to observe cell morphology (Nomarski) and epifluorescence microscopy using a filter specific for fluorescein to observe anti-HA stain (Fluorescence).
[View Larger Version of this Image (52K GIF file)]


Fig. 4 shows the detection of Vma3p-HA, Vma11p-HA, and Vma16p-HA in vacuolar membrane fractions by Western blot analysis. Vacuolar membrane fractions were prepared from RHA374 (lane 2), LGY11 (lane 3), or LGY10 (lane 4) and probed with anti-HA antibodies. Each fraction contained a single major polypeptide with a size expected for the tagged protein (indicated by arrowheads in Fig. 4). We conclude that these polypeptides represent the tagged proteins because they were uniquely found in each membrane fraction. Protein bands with higher molecular masses are presumably aggregates of the tagged proteins, because no cross-reactive polypeptide was detected in the blot of the wild type proteins (Fig. 4, lane 1). Vma3p-HA migrated slower than Vma11p-HA although the calculated mass of Vma3p (16.4 kDa) (24, 25) is smaller than that of Vma11p (17.0 kDa) (30). The reason for the unexpected behavior of these proteins in the gel is currently unknown.


Fig. 4. Detection of HA-tagged proteolipids in isolated vacuolar membrane fractions. Proteins in the vacuolar membrane fractions from SF838-1D (wild type; lane 1, 20 µg of proteins), RHA374 (VMA3::HA; lane 2, 2.5 µg), LGY11 (VMA11::HA, lane 3, 20 µg), or LGY10 (VMA16::HA; lanes 4, 20 µg) cells were examined by Western blot analysis with anti-HA antibodies. The HA-tagged proteins are indicated by arrows.
[View Larger Version of this Image (37K GIF file)]


The signal intensity of Vma16p-HA (Fig. 4, lane 4) was similar to that of Vma11p-HA (lane 3) and was 5-10 times lower than that of Vma3p-HA (lane 2; eight times less amount of proteins was loaded in lane 2). Although we cannot estimate the exact molar ratio of the three proteins by this method, this result suggests that Vma16p and Vma11p exist at lower levels than Vma3p in the vacuolar membrane. The tagged proteins gave only weak signals in both immunofluorescence microscopy and Western blot analysis when expressed in cells containing normal vacuolar protease activities, though the cells still display Vma+ phenotypes (data not shown). The C-terminal ends of these proteins may be facing inside the lumen of the vacuole, and the tag might be removed by the vacuolar proteases. However, other interpretations of the data cannot be ruled out at this time.

HA-tagged Vma11p and Vma16p Are Components of the V-ATPase Complex

We next examined whether Vma11p and Vma16p are included in the V-ATPase complex. Vacuolar membrane proteins from LGY11 and LGY10 cells were solubilized with ZW3-14 and fractionated through a 20-50% glycerol density gradient. Fractions from the gradients were assayed for V-ATPase activity and subjected to Western blot analysis with anti-V-ATPase subunit antibodies. Fig. 5 shows the distribution of two V-ATPase subunits (100-kDa V0 and 69-kDa V1 subunits) and the tagged proteins in the gradient. As reported previously (18, 20), V-ATPase subunits fractionate into two peaks, one that cofractionates with the ATPase activity and contains both the V0 and V1 subunits (V0V1) (LGY11, fractions 8-10; LGY10, fractions 7-9) and the other that migrates to lower density near the dipeptidyl aminopeptidase B protein (DPAP-B; ~120-kDa vacuolar membrane protein (43)) and contains only the V0 subunits (LGY11, fraction 12; LGY10, fraction 11). The second peak in the lower density fractions is predicted to represent the V0 subcomplex not assembled with V1 subunits (20, 27, 50). The distribution patterns of Vma11p-HA and Vma16p-HA matched exactly with those of the 100- (Fig. 5) and 36-kDa (Ref. 20 and data not shown) V0 subunits, indicating that the two proteins are physically associated with both the active V0V1 complex and the V0 subcomplex in the vacuolar membrane.


Fig. 5. Detection of Vma11p-HA and Vma16p-HA in glycerol gradient fractions containing the detergent-solubilized V-ATPase complex. 500 µg of vacuolar membranes prepared from either LGY11 (VMA11::HA) or LGY10 (VMA16::HA) were solubilized in 1% (w/v) ZW3-14 and fractionated by centrifugation for 20 h at 175,000 × g through a 12-ml 20-50% glycerol gradient. 750-µl fractions were collected, and 100 µl was assayed immediately for ATPase and DPAP-B activity. Proteins were precipitated from each fraction by the addition of 5% trichloroacetic acid (final concentration), separated by SDS-PAGE, and probed with antibodies specific for the 100- and 69-kDa V-ATPase subunits and the HA epitope.
[View Larger Version of this Image (49K GIF file)]


Vma11p Glu145and Vma16p Glu108 Are Important for the V-ATPase Activity

The glutamic acid residue at position 137 (Glu137) in Vma3p lies in the center of the predicted fourth transmembrane domain of the subunit (Fig. 1, A and B) (24, 25, 34). Mutational analysis of this residue has suggested that the carboxyl side chain at this position is critical for proton translocating activity (34). We examined whether Vma11p and Vma16p also contain an acidic residue functionally similar to Vma3p Glu137. Vma11p Glu145, Vma16p Glu108, and Vma16p Glu188 (Fig. 1, A and B) were modified by site-directed mutagenesis. No other acidic residues are found in the predicted transmembrane domains of the two proteins. vma11 mutant strains (vma11 E145D,E145L,E145Q) were constructed by replacing the chromosomal copy of the gene with the mutant alleles. vma16 mutants were constructed by introducing mutant genes (vma16 E108D,E108L,E108Q,E108V and vma16 E188D,E188Q,E188V) into RHP110 (Delta vma16) on a low copy, centromere-based plasmid, pRS316 (36). Tables II and III summarize the growth phenotypes and V-ATPase activities of the mutant cells compared with wild type cells. Of the three residues examined, mutants of the Vma11p Glu145 and Vma16p Glu108 displayed phenotypes similar to cells expressing Vma3p Glu137. These residues could be functionally substituted by an aspartic acid residue, but other mutations altering these residues (vma3 E137Q,E137V,E137K (see Ref. 34), vma11 E145L,E145Q, and vma16 E108L,E108Q,E108V) (Tables II and III) completely eliminated the V-ATPase activity. On the other hand, all of the Vma16p Glu188 mutants produced a functional Vma16p, which indicates that this residue is not essential for the activity of this protein. These results suggest that Vma11p Glu145 and Vma16p Glu108 may be functionally equivalent to Vma3p Glu137.

Table III.

Phenotypes of vma11 mutant cells


Strains Growth phenotypea Vacuolar acidificationb V-ATPase activityc

RHA115 (VMA11+) Vma+ + 790
RHA116 (vma11 E145D) Vma+ + 1260
RHA117 (vma11 E145L) Vma-  - 30
RHA118 (vma11 E145Q) Vma-  - 30
YRH11a (Delta vma11) Vma-  - 40

a  Mutant cells were grown on the medium as in Table II. RHA116 grew as well as RHA115 on the selective media, whereas RHA117 and RHA118 displayed growth phenotypes similar to YRH11a.
b  Vacuolar acidification was monitored by quinacrine staining in vivo.
c  Bafilomycin A1-sensitive ATPase activity in vacuolar membrane fractions (nmol ATP hydrolyzed/min/mg protein). The ATPase activity was assayed at 30 °C as described under "Experimental Procedures."

Inactivating Mutations of Vma11p Glu145 and Vma16p Glu108 Promote Assembly of V1 Subunits onto the V0 Subcomplex in the Membrane

The phenotypes of the mutants of Vma11p Glu145 and Vma16p Glu108 could be interpreted as indicating that the carboxyl side chains of these residues are important for their activity. However, the inactivating mutations of the residues might alter the secondary or tertiary structure of these polypeptides, thus inhibiting the assembly and/or targeting of the V-ATPase complex. We therefore examined whether the V-ATPase complex was assembled onto the vacuolar membrane in the vma11 Glu145 and vma16 Glu108 mutant cells. Neither of the mutations inhibited the assembly of the V-ATPase subunits onto the vacuolar membrane (Fig. 6, A and B), although the amounts of membrane-bound V1 subunits appear to be increased in the inactive vma11 and vma16 mutant cells (Fig. 6, A, lanes 3 and 4, and B, lanes 3-5) and will be discussed in a later section. Solubilization and density gradient fractionation of the vma11 E145L mutant vacuolar membrane proteins showed that the V-ATPase subunits in the mutant membrane were assembled almost exclusively into a high molecular weight complex (Fig. 7, RHA117, fractions 4-6) containing all the known V-ATPase subunits. We found that vma16 E108L mutant vacuolar membrane also contained a fully assembled V0V1 complex (data not shown). These results indicate that the vma11 Glu145 and vma16 Glu108 mutations do not inhibit the assembly and vacuolar targeting of the V-ATPase subunits. The mutant complex appeared to migrate to denser fractions than the wild type complex (Fig. 7, A and B). The reason for this difference in the behavior of these complexes is currently unknown. Although sometimes one or two additional polypeptides were observed by Coomassie staining of the peak fraction of the mutant V-ATPase complex, these proteins were not consistently present in the peak fractions. It is most likely that these polypeptides are the breakdown products of the V-ATPase subunits. However, we cannot exclude the possibility that these proteins are specifically associated with the mutant complex and thus changing its mobility in the density gradient.


Fig. 6. Assembly of V-ATPase subunits in wild type, vma11 Glu145 and vma16 Glu108 cells. A, detection of V-ATPase subunits in wild type and vma11 mutant vacuolar membranes. Proteins in vacuolar membrane fractions (~10 µg) isolated from RHA115 (wild type, lane 1), RHA116 (vma11 E145D, lane 2), RHA117 (E145L, lane 3), RHA118 (E145Q, lane 4), and YRH11a (Delta vma11, lane 5) were subjected to Western blot analysis with anti-V-ATPase subunit antibodies. The levels of the 17-kDa subunit were analyzed by examining the amount of polypeptide in chloroform/methanol extracts of the vacuolar membrane fractions. The anti-100-kDa subunit monoclonal antibody recognized two polypeptides of 100 and 75 kDa. The 75-kDa species (asterisk) is a proteolytic product of the 100-kDa subunit (3). B, detection of V-ATPase subunits in wild type and vma16 mutant vacuolar membranes. V-ATPase subunits were detected as described above in vacuolar membrane fractions (~10 µg/lane) isolated from RHP1100 (wild type; lane 1), RHP1101 (vma16 E108D; lane 2), RHP1102 (E108V; lane 3), RHP1105 (E108L; lane 4), RHP1106 (E108Q; lane 5), and RH1108 (Delta vma16; lane 6). C, distribution of the 60-kDa V1 subunit in wild type (RHA 115) and vma11 Glu145 mutant (RHA 116-118) cells. Cells were spheroplasted, lysed, and fractionated into membrane (P) and cytosol (S) fractions. Proteins in each fraction (corresponding to ~1 A600 of cells) were resolved by SDS-PAGE, and the distribution of the 60-kDa V1 subunit was analyzed by Western blot analysis.
[View Larger Version of this Image (49K GIF file)]



Fig. 7. Detection of V0V1 and V0 complexes in glycerol gradient fractions containing solubilized vacuolar membrane proteins. 850 µg of vacuolar membranes prepared from either RHA115 (A, wild type) or RHA117 (B, vma11 E145L) were solubilized in 1% ZW3-14 (w/v) and fractionated by centrifugation for 14 h at 177,000 × g through a 10-ml 20-50% (2.5% steps) glycerol gradient. 750-µl fractions were collected, and aliquots (100 µl each) were assayed for activity of the V-ATPase and DPAP-B. Proteins were precipitated from each fraction by the addition of 5% trichloroacetic acid (final concentration), separated by SDS-PAGE and detected by staining with Coomassie Blue (Coom.). The numbers in italics under the lanes represent V-ATPase and DPAP-B activities for the corresponding fraction. Lanes without numbers on the bottom contained activity less than 1 nmol/min/ml fraction. Distribution of the V-ATPase subunits through the fractions was examined by Western blot analysis with antibodies specific for the 100-, 69-, and 36-kDa V-ATPase subunits. Gradient fractions are identified with even numbers starting at the bottom of the gradient.
[View Larger Version of this Image (47K GIF file)]


Surprisingly, the inactivating Vma11p Glu145 and Vma16p Glu108 mutations resulted in a higher degree of assembly of the V1 subunits to the V0 subcomplex in the vacuolar membrane (Fig. 6, A, lanes 3 and 4, and B, lanes 3-5). The levels of V0 subunits in vacuolar membranes were kept at relatively unchanged levels (Fig. 6, A and B). These mutations did not affect the steady state levels of the V-ATPase subunits (data not shown) but appeared to change the distribution of the 60-kDa V1 subunit (Fig. 6C) from cytosol to the membrane fractions. Fig. 7 shows that the second peak of the V0 subunits (RHA115, fractions 8-10) was not prominent in the mutant membrane (RHA117, fraction 8). Similar changes in the ratio of V0V1 and V0 complexes resolved in glycerol gradient were observed for the vma16 E108L mutant vacuolar membranes (data not shown). The lighter gradient fractions of the vma11 E145L mutant in Fig. 7B appeared to contain fewer proteins than the wild type fractions. Some of the proteins in the mutant membranes might not have been solubilized efficiently under the conditions that we used for solubilization of the V-ATPase complexes. However, densitometric analyses of the Coomassie Blue-stained gels indicated that the ratio of the total amounts of 69-kDa V1 subunit to the 36-kDa V0 subunit in the gradient fractions remained unchanged from that in the membrane (data not shown), indicating that there was no specific loss of V0 subunits during solubilization and fractionation on the gradient. These results suggest that the assembly and/or retention of V1 subunits to the V0 subcomplex on the vacuolar membrane was promoted in the vma11 E145L and vma16 E108L mutant cells.

To further investigate the assembly status we also compared the effects of nitrate on the wild type and mutant V-ATPase complexes. Nitrate (50-100 mM) causes the stripping of V1 from V0 only in the presence of Mg2+ and ATP (3). The dissociation of V1 by these reagents is thought to be triggered by a conformational change induced by the binding of ATP to a nucleotide binding site in V1 (20). V1 subunits in the vma11 E145L mutant complex were released from the membrane by the treatment with nitrate and Mg-ATP (Fig. 8). Incubation in a buffer without Mg-ATP or nitrate was not effective at stripping V1 from the membranes (data not shown). Therefore, the mutant enzyme complex is likely to retain a structure that can bind ATP and execute the conformational change triggered by the nucleotide binding.


Fig. 8. Subunit stripping by ATP and nitrate. Wild type (RHA115) or vma11 E145L mutant (RHA117) vacuolar membranes were suspended in a solution containing 50 mM Tris-Mes, pH 6.9, 5 mM MgCl2, 25 mM KCl, 100 mM KNO3, and 5 mM ATP. After incubation at 4 °C for 30 min, the suspension was centrifuged at 100,000 × g for 1 h to yield pellet (P) and supernatant (S) fractions. Proteins in each fraction were subjected to SDS-PAGE analysis, and V-ATPase subunits were detected by Coomassie Blue staining (A) or by Western blot analysis with anti-69-kDa subunit monoclonal antibody (B).
[View Larger Version of this Image (46K GIF file)]



DISCUSSION

In this paper, we showed that Vma11p and Vma16p are novel proteolipid subunits of the yeast V-ATPase. The major evidence that supports our conclusion is as follows: 1) Cells disrupted for either VMA11 or VMA16 are defective in the activity and assembly of the V-ATPase. 2) The functional HA-tagged Vma11p and Vma16p reside on the vacuolar membrane and cofractionate with the V-ATPase complex when the enzyme is solubilized and purified by glycerol density gradient centrifugation. 3) Loss-of-function mutants (e.g. vma11 E145L) of the two proteolipid subunits contain an inactive but fully assembled V-ATPase complex in the vacuolar membrane, suggesting that the functions of the two proteins are required during the catalytic reaction. Therefore, the yeast V-ATPase contains three different proteolipid subunits in its complex. It is unlikely that these subunits are isoforms of different V-ATPases, because mutations affecting any of these proteins completely inhibit the V-ATPase activity in the vacuolar membrane (25, 30, 34, 48).

No polypeptide corresponding to Vma11p (17 kDa) or Vma16p (23 kDa) has yet been identified by previous purification studies (3, 5). This might be due to poor staining of these subunits by Coomassie Blue as has been observed for the proteolipid subunits of the V- and F0F1-type ATPases (25, 51). The levels of the HA-tagged subunits suggest that Vma11p and Vma16p are present at lower levels than Vma3p in the vacuolar membrane, although the exact molar ratio of the three proteolipid subunits in the enzyme complex remains to be determined. This might also be the reason that only Vma3p has been identified by previous biochemical studies of the V-ATPase.

In this work, we demonstrated that the three yeast V-ATPase proteolipid subunits exhibit many common properties. The primary structures of these proteins are similar to one another, and all three subunits are essential for activity and assembly of the enzyme complex (24, 25, 30, 48). Furthermore, each contains a glutamic acid residue that lies in a predicted transmembrane domain and is required for V-ATPase activity (Glu137 in Vma3p, Glu145 in Vma11p, and Glu108 in Vma16p) (Fig. 1) (34). These results indicate that the three subunits share a common function, which is most likely to be involved in the proton transport activity of the enzyme complex.

The phenotypes of the mutants altering the conserved glutamic acid residues in Vma3p, Vma11p, and Vma16p are similar but not identical. Generally, mutations at Vma3p Glu137 appeared to be more severe than those of the other two. For example, Vma3p E137D appears to be only partially active (34), whereas Vma11p E145D and Vma16p E108D are fully functional. Only vma3 E137Q, but not vma11 E145Q and vma16 E108Q, inhibits cell growth in YNBD medium buffered to pH7.5 when each of the mutant genes is introduced into wild type haploid cells on a low copy, centromere-based plasmid (pRS316).4 This dominant negative phenotype produced by the vma3 E137Q mutation, together with the relative abundance of Vma3p-HA in the vacuolar membrane, may suggest that Vma3p is the major proteolipid subunit in the enzyme complex. The coated vesicle proton pump is reported to contain six copies of the 17-kDa proteolipid subunits (52), and binding of N,N'-dicyclohexylcarbodiimide to a single copy of this subunit is sufficient to abolish the enzyme activity (53). Providing that both wild type and mutant subunits are expressed in the same cells and incorporation of a single mutant 17-kDa subunit inhibits the enzyme activity, the fraction of the active ATPase complex is expected to increase as the copy number of the subunit decreases. In this scenario, the defects resulting from mutations in Vma3p would be more detrimental. Of course, the mutant phenotypes might reflect the difference in the functions of the conserved glutamic acid residues in the three proteins. It will be important in the future to establish the function, subunit interaction, and stoichiometry of these proteins individually.

Our present work raises many questions about the proteolipid subunit content of V-type ATPases in other organelles and organisms. The ~20-kDa V0 subunits present in the V-type ATPases of bovine chromaffin granules and coated vesicles have been reported to exhibit similar biochemical properties to those of the 17-kDa proteolipid subunits (52, 54) and thus are candidates for a "second" proteolipid subunit in their enzyme complexes. It should be noted that cDNA fragments capable of encoding all or part of Vma16p homologues have been isolated from plant, mouse, human, and nematode.5 Although yeast cells appear to have two V-ATPase complexes, one containing Vph1p and the other containing Stv1p (14, 29), it is highly likely that all three proteolipid subunits function in both V-ATPase complexes, because Delta vma3, Delta vma11, and Delta vma16 mutants each display phenotypes identical to Delta stv1Delta vph1 double mutants (25, 29, 30, 48).

The inactivating mutations of Vma11p Glu145 and Vma16p Glu108 do not inhibit the assembly and targeting of the V-ATPase subunits but instead promote the binding of the V1 subunits to the V0 subcomplex on the vacuolar membrane, resulting in an increase in the population of inactive but fully assembled V0V1 complex. These results suggest that the equilibrium of assembly/disassembly of the V1 subunits to the V0 subcomplex is altered in the mutant cells. Reversible assembly of the V1 subunits to the V0 domain in vivo has been found to be responsive for physiological changes. Kane (27) has shown that dissociation and reassembly of V1 and V0 can occur rapidly in vivo in response to changes in nutrient conditions. Sumner et al. (55) reported that the inactivation of the Munduca sexta plasma membrane V-ATPase during molting parallels the dissociation of V1 subunits from V0 in the membrane. In this context, it will be interesting to investigate whether the V-ATPase complex senses changes in a proton motive force loaded across the vacuolar membrane or an ATP potential in the cytosol under different nutritional conditions.

In summary, Vma11p and Vma16p are novel proteolipid subunits of the yeast V-ATPase, which show properties similar to Vma3p. Despite the structural and functional similarities of these polypeptides, our results reveal that a single V-ATPase complex must contain at least one copy of each of the three proteolipids. The three proteolipid subunits must therefore participate cooperatively in proton transport through the V0 sector and thus regulate vacuolar acidification. Our future studies will address these issues.


FOOTNOTES

*   This work was supported by a Grant-in-Aid for Scientific Research on Priority Areas of Cellular Energy from the Ministry of Education, Science, Sports and Culture of Japan (to Y. A.), a Grant-in-Aid for Encouragement of Young Scientists from the Ministry of Education, Science, Sports and Culture of Japan (to R. H.), a grant from the Human Frontier Science Program Organization (to Y. A. and T. H. S.), a grant for promotion of research from the Institute of Physical and Chemical Research (to R. H.), a grant for Biodesign Research Program from the Institute of Physical and Chemical Research (to A. T.), and Grant GM38006 from the National Institutes of Health (to T. H. S.). The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
par    To whom correspondence should be addressed. Tel.: 81-3-3812-2111 (ext. 4461); Fax: 81-3-3812-4929; E-mail: anraku{at}uts2.s.u-tokyo.ac.jp.
1    The abbreviations used are: V-ATPase, S. cerevisiae vacuolar membrane ATPase; HA, influenza virus hemagglutinin protein; Vma11p-HA; HA-tagged Vma11p, V-type ATPase, vacuolar-type ATPase; PAGE, polyacrylamide gel electrophoresis; DPAP-B, dipeptidyl aminopeptidase B; kb, kilobase(s); ZW3-14, zwitterionic detergent, N-tetradecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate.
2    In this paper, Vma3p and Vma11p are used to indicate the protein products of the respective genes. The term "the 17 kDa subunit" is reserved mainly for referring to the polypeptide biochemically identified in the V-ATPase complex.
3    Although we had previously reported a decrease in the steady state level of the 36-kDa subunit in yeast cells lacking Vma3p (20), more recent kinetic analyses indicate that the 36-kDa subunit is equally stable in wild type, Delta vma3, Delta vma11, and Delta vma16 cells (L. A. Graham and T. H. Stevens, unpublished results).
4    R. Hirata, unpublished results.
5    VMA16 homologues were identified in the GenBankTM data base using the tfasta algorithm. Identification numbers for the sequences are N38329[GenBank] (Alabidopsis thaliana), HSIMBB190 (human), W17408[GenBank] (mouse), and CET01H3 (Caenorhabditis elegans).

Acknowledgments

We thank the University of Oregon Animal Care Facility for assistance in preparing polyclonal antibodies.


REFERENCES

  1. Anraku, Y., Umemoto, N., Hirata, R., and Ohya, Y. (1992) J. Bioenerg. Biomembr. 24, 395-405 [CrossRef][Medline] [Order article via Infotrieve]
  2. Kakinuma, Y., Ohsumi, Y., and Anraku, Y. (1981) J. Biol. Chem. 256, 10859-10863 [Abstract/Free Full Text]
  3. Kane, P. M., Yamashiro, C. T., and Stevens, T. H. (1989) J. Biol. Chem. 264, 19236-19244 [Abstract/Free Full Text]
  4. Anraku, Y. (1996) in Handbook of Biological Physics (Konings, W. N., Kaback, H. R., and Lolkema, J. S., eds), Vol. 2, pp. 93-109, Elsevier Science Publishing Co., Inc., New York
  5. Uchida, E., Ohsumi, Y., and Anraku, Y. (1985) J. Biol. Chem. 260, 1090-1095 [Abstract/Free Full Text]
  6. Anraku, Y., Hirata, R., Wada, Y., and Ohya, Y. (1992) J. Exp. Biol. 172, 67-81 [Abstract/Free Full Text]
  7. Stevens, T. H. (1992) J. Exp. Biol. 172, 47-55 [Free Full Text]
  8. Forgac, M. (1989) Physiol. Rev. 69, 765-796 [Free Full Text]
  9. Gluck, S. (1992) J. Exp. Biol. 172, 29-37 [Abstract/Free Full Text]
  10. Wada, Y., and Anraku, Y. (1994) J. Bioenerg. Biomembr. 26, 631-637 [CrossRef][Medline] [Order article via Infotrieve]
  11. Mellman, I. (1992) J. Exp. Biol. 172, 39-45 [Free Full Text]
  12. Forgac, M. (1992) J. Exp. Biol. 172, 155-169 [Abstract/Free Full Text]
  13. Uchida, E., Ohsumi, Y., and Anraku, Y. (1988) J. Biol. Chem. 263, 45-51 [Abstract/Free Full Text]
  14. Manolson, M. F., Proteau, D., Preston, R. A., Stenbit, A., Roberts, B. T., Hoyt, M. A., Preuss, D., Mulholland, J., Botstein, D., and Jones, E. W. (1992) J. Biol. Chem. 267, 14294-14303 [Abstract/Free Full Text]
  15. Hirata, R., Ohsumi, Y., Nakano, A., Kawasaki, H., Suzuki, K., and Anraku, Y. (1990) J. Biol. Chem. 265, 6726-6733 [Abstract/Free Full Text]
  16. Nelson, H., Mandiyan, S., and Nelson, N. (1989) J. Biol. Chem. 264, 1775-1778 [Abstract/Free Full Text]
  17. Yamashiro, C. T., Kane, P. M., Wolczyk, D. F., Preston, R. A., and Stevens, T. H. (1990) Mol. Cell. Biol. 10, 3737-3749 [Abstract/Free Full Text]
  18. Ho, M. N., Hirata, R., Umemoto, N., Ohya, Y., Takatsuki, A., Stevens, T. H., and Anraku, Y. (1993) J. Biol. Chem. 268, 18286-18292 [Abstract/Free Full Text]
  19. Ho, M. N., Hill, K. J., Lindorfer, M. A., and Stevens, T. H. (1993) J. Biol. Chem. 268, 221-227 [Abstract/Free Full Text]
  20. Bauerle, C., Ho, M. N., Lindorfer, M. A., and Stevens, T. H. (1993) J. Biol. Chem. 268, 12749-12757 [Abstract/Free Full Text]
  21. Foury, F. (1990) J. Biol. Chem. 265, 18554-18560 [Abstract/Free Full Text]
  22. Graham, L. A., Hill, K. J., and Stevens, T. H. (1994) J. Biol. Chem. 269, 25974-25977 [Abstract/Free Full Text]
  23. Graham, L. A., Hill, K. J., and Stevens, T. H. (1995) J. Biol. Chem. 270, 15037-15044 [Abstract/Free Full Text]
  24. Nelson, H., and Nelson, N. (1989) FEBS Lett. 247, 147-153 [CrossRef][Medline] [Order article via Infotrieve]
  25. Umemoto, N., Yoshihisa, T., Hirata, R., and Anraku, Y. (1990) J. Biol. Chem. 265, 18447-18453 [Abstract/Free Full Text]
  26. Beltrán, C., Kopecky, J., Pan, Y.-C. E., Nelson, H., and Nelson, N. (1992) J. Biol. Chem. 267, 774-779 [Abstract/Free Full Text]
  27. Kane, P. M. (1995) J. Biol. Chem. 270, 17025-17032 [Abstract/Free Full Text]
  28. Supekova, L., Supek, F., and Nelson, N. (1995) J. Biol. Chem. 270, 13726-13732 [Abstract/Free Full Text]
  29. Manolson, M. F., Wu, B., Proteau, D., Taillon, B. E., Roberts, B. T., Hoyt, M. A., and Jones, E. W. (1994) J. Biol. Chem. 269, 14064-14074 [Abstract/Free Full Text]
  30. Umemoto, N., Ohya, Y., and Anraku, Y. (1991) J. Biol. Chem. 266, 24526-24532 [Abstract/Free Full Text]
  31. Apperson, M., Jensen, R. E., Suda, K., Witte, C., and Yaffe, M. P. (1990) Biochem. Biophys. Res. Commun. 168, 574-579 [CrossRef][Medline] [Order article via Infotrieve]
  32. Nelson, N. (1992) J. Bioenerg. Biomembr. 24, 407-414 [CrossRef][Medline] [Order article via Infotrieve]
  33. Ohya, Y., Umemoto, N., Tanida, I., Ohta, A., Iida, H., and Anraku, Y. (1991) J. Biol. Chem. 266, 13971-13977 [Abstract/Free Full Text]
  34. Noumi, T., Beltrán, C., Nelson, H., and Nelson, N. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 1938-1942 [Abstract/Free Full Text]
  35. Rothman, J. H., and Stevens, T. H. (1986) Cell 47, 1041-1051 [CrossRef][Medline] [Order article via Infotrieve]
  36. Sikorski, R. S., and Hieter, P. (1989) Genetics 122, 19-27 [Abstract/Free Full Text]
  37. Jones, J. S., and Prakash, L. (1990) Yeast 6, 363-366 [CrossRef][Medline] [Order article via Infotrieve]
  38. Kaiser, C., Michaelis, S., and Mitchell, A. (1994) Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  39. Vieira, J., and Messing, J. (1987) Methods Enzymol. 153, 3-11 [Medline] [Order article via Infotrieve]
  40. Sayers, J. R., Schmidt, W., and Eckstein, F. (1988) Nucleic Acids Res. 16, 791-802 [Abstract/Free Full Text]
  41. Kolodziej, P. A., and Young, R. A. (1991) Methods Enzymol. 194, 508-519 [Medline] [Order article via Infotrieve]
  42. Kunkel, T. A. (1985) Proc. Natl. Acad. Sci. U. S. A. 82, 488-492 [Abstract/Free Full Text]
  43. Roberts, C. J., Pohlig, G., Rothman, J. H., and Stevens, T. H. (1989) J. Cell Biol. 108, 1363-1373 [Abstract/Free Full Text]
  44. Hill, K. J., and Stevens, T. H. (1994) Mol. Biol. Cell 5, 1039-1050 [Abstract]
  45. Hirata, R., Umemoto, N., Ho, M. N., Ohya, Y., Stevens, T. H., and Anraku, Y. (1993) J. Biol. Chem. 268, 961-967 [Abstract/Free Full Text]
  46. Hill, K. J., and Stevens, T. H. (1995) J. Biol. Chem. 270, 22329-22336 [Abstract/Free Full Text]
  47. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  48. Nelson, H., and Nelson, N. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 3503-3507 [Abstract/Free Full Text]
  49. Kane, P. M., Kuehn, M. C., Howald-Stevenson, I., and Stevens, T. H. (1992) J. Biol. Chem. 267, 447-454 [Abstract/Free Full Text]
  50. Doherty, R. D., and Kane, P. M. (1993) J. Biol. Chem. 268, 16845-16851 [Abstract/Free Full Text]
  51. Hoppe, J., and Sebald, W. (1984) Biochim. Biophys. Acta 768, 164-200 [Medline] [Order article via Infotrieve]
  52. Arai, H., Terres, G., Pink, S., and Forgac, M. (1988) J. Biol. Chem. 263, 8796-8802 [Abstract/Free Full Text]
  53. Arai, H., Berne, M., and Forgac, M. (1987) J. Biol. Chem. 262, 11006-11011 [Abstract/Free Full Text]
  54. Moriyama, Y., and Nelson, N. (1989) Biochim. Biophys. Acta 980, 241-247 [Medline] [Order article via Infotrieve]
  55. Sumner, J.-P., Dow, J. A. T., Earley, F. G. P., Klein, U., Jager, D., and Wieczorek, H. (1995) J. Biol. Chem. 270, 5649-5653 [Abstract/Free Full Text]

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Exp. Biol.Home page
S. Saroussi and N. Nelson
The little we know on the structure and machinery of V-ATPase
J. Exp. Biol., June 1, 2009; 212(11): 1604 - 1610.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Bond and M. Forgac
The Ras/cAMP/Protein Kinase A Pathway Regulates Glucose-dependent Assembly of the Vacuolar (H+)-ATPase in Yeast
J. Biol. Chem., December 26, 2008; 283(52): 36513 - 36521.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Wang, M. Toei, and M. Forgac
Analysis of the Membrane Topology of Transmembrane Segments in the C-terminal Hydrophobic Domain of the Yeast Vacuolar ATPase Subunit a (Vph1p) by Chemical Modification
J. Biol. Chem., July 25, 2008; 283(30): 20696 - 20702.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Wang, D. J. Cipriano, and M. Forgac
Arrangement of Subunits in the Proteolipid Ring of the V-ATPase
J. Biol. Chem., November 23, 2007; 282(47): 34058 - 34065.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. J. Bowman, M. E. McCall, R. Baertsch, and E. J. Bowman
A Model for the Proteolipid Ring and Bafilomycin/Concanamycin-binding Site in the Vacuolar ATPase of Neurospora crassa
J. Biol. Chem., October 20, 2006; 281(42): 31885 - 31893.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. A. Owegi, D. L. Pappas, M. W. Finch Jr.,, S. A. Bilbo, C. A. Resendiz, L. J. Jacquemin, A. Warrier, J. D. Trombley, K. M. McCulloch, K. L. M. Margalef, et al.
Identification of a Domain in the Vo Subunit d That Is Critical for Coupling of the Yeast Vacuolar Proton-translocating ATPase
J. Biol. Chem., October 6, 2006; 281(40): 30001 - 30014.
[Abstract] [Full Text] [PDF]


Home page
PhysiologyHome page
O. Drory and N. Nelson
The emerging structure of vacuolar ATPases.
Physiology, October 1, 2006; 21: 317 - 325.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Chavez, E. J. Bowman, J. C. Reidling, K. H. Haw, and B. J. Bowman
Analysis of Strains with Mutations in Six Genes Encoding Subunits of the V-ATPase: EUKARYOTES DIFFER IN THE COMPOSITION OF THE V0 SECTOR OF THE ENZYME
J. Biol. Chem., September 15, 2006; 281(37): 27052 - 27062.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Ochotny, A. Van Vliet, N. Chan, Y. Yao, M. Morel, N. Kartner, H. P. von Schroeder, J. N. M. Heersche, and M. F. Manolson
Effects of Human a3 and a4 Mutations That Result in Osteopetrosis and Distal Renal Tubular Acidosis on Yeast V-ATPase Expression and Activity
J. Biol. Chem., September 8, 2006; 281(36): 26102 - 26111.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. A. Compton, L. A. Graham, and T. H. Stevens
Vma9p (Subunit e) Is an Integral Membrane V0 Subunit of the Yeast V-ATPase
J. Biol. Chem., June 2, 2006; 281(22): 15312 - 15319.
[Abstract] [Full Text] [PDF]


Home page
Microbiol. Mol. Biol. Rev.Home page
P. M. Kane
The Where, When, and How of Organelle Acidification by the Yeast Vacuolar H+-ATPase
Microbiol. Mol. Biol. Rev., March 1, 2006; 70(1): 177 - 191.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Wang, T. Inoue, and M. Forgac
Subunit a of the Yeast V-ATPase Participates in Binding of Bafilomycin
J. Biol. Chem., December 9, 2005; 280(49): 40481 - 40488.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Inoue and M. Forgac
Cysteine-mediated Cross-linking Indicates That Subunit C of the V-ATPase Is in Close Proximity to Subunits E and G of the V1 Domain and Subunit a of the V0 Domain
J. Biol. Chem., July 29, 2005; 280(30): 27896 - 27903.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
T. Wassmer, M. Froissard, H. Plattner, R. Kissmehl, and J. Cohen
The vacuolar proton-ATPase plays a major role in several membrane-bounded organelles in Paramecium
J. Cell Sci., July 1, 2005; 118(13): 2813 - 2825.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. A. Owegi, A. L. Carenbauer, N. M. Wick, J. F. Brown, K. L. Terhune, S. A. Bilbo, R. S. Weaver, R. Shircliff, N. Newcomb, and K. J. Parra-Belky
Mutational Analysis of the Stator Subunit E of the Yeast V-ATPase
J. Biol. Chem., May 6, 2005; 280(18): 18393 - 18402.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
T. Murata, I. Yamato, Y. Kakinuma, A. G. W. Leslie, and J. E. Walker
Structure of the Rotor of the V-Type Na+-ATPase from Enterococcus hirae
Science, April 29, 2005; 308(5722): 654 - 659.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
P. Malkus, L. A. Graham, T. H. Stevens, and R. Schekman
Role of Vma21p in Assembly and Transport of the Yeast Vacuolar ATPase
Mol. Biol. Cell, November 1, 2004; 15(11): 5075 - 5091.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Wang, T. Inoue, and M. Forgac
TM2 but Not TM4 of Subunit c'' Interacts with TM7 of Subunit a of the Yeast V-ATPase as Defined by Disulfide-mediated Cross-linking
J. Biol. Chem., October 22, 2004; 279(43): 44628 - 44638.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. R. Flannery, L. A. Graham, and T. H. Stevens
Topological Characterization of the c, c', and c'' Subunits of the Vacuolar ATPase from the Yeast Saccharomyces cerevisiae
J. Biol. Chem., September 17, 2004; 279(38): 39856 - 39862.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. J. Bowman, L. A. Graham, T. H. Stevens, and B. J. Bowman
The Bafilomycin/Concanamycin Binding Site in Subunit c of the V-ATPases from Neurospora crassa and Saccharomyces cerevisiae
J. Biol. Chem., August 6, 2004; 279(32): 33131 - 33138.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Sambade and P. M. Kane
The Yeast Vacuolar Proton-translocating ATPase Contains a Subunit Homologous to the Manduca sexta and Bovine e Subunits That Is Essential for Function
J. Biol. Chem., April 23, 2004; 279(17): 17361 - 17365.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Lu, Y. Y. Sautin, L. S. Holliday, and S. L. Gluck
The Glycolytic Enzyme Aldolase Mediates Assembly, Expression, and Activity of Vacuolar H+-ATPase
J. Biol. Chem., March 5, 2004; 279(10): 8732 - 8739.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Nishi, S. Kawasaki-Nishi, and M. Forgac
Expression and Function of the Mouse V-ATPase d Subunit Isoforms
J. Biol. Chem., November 21, 2003; 278(47): 46396 - 46402.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Kawasaki-Nishi, T. Nishi, and M. Forgac
Interacting Helical Surfaces of the Transmembrane Segments of Subunits a and c' of the Yeast V-ATPase Defined by Disulfide-mediated Cross-linking
J. Biol. Chem., October 24, 2003; 278(43): 41908 - 41913.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Yokoyama, K. Nagata, H. Imamura, S. Ohkuma, M. Yoshida, and M. Tamakoshi
Subunit Arrangement in V-ATPase from Thermus thermophilus
J. Biol. Chem., October 24, 2003; 278(43): 42686 - 42691.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
K. Aviezer-Hagai, V. Padler-Karavani, and N. Nelson
Biochemical support for the V-ATPase rotary mechanism: antibody against HA-tagged Vma7p or Vma16p but not Vma10p inhibits activity
J. Exp. Biol., September 15, 2003; 206(18): 3227 - 3237.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
M. J. Bayer, C. Reese, S. Buhler, C. Peters, and A. Mayer
Vacuole membrane fusion: V0 functions after trans-SNARE pairing and is coupled to the Ca2+-releasing channel
J. Cell Biol., July 21, 2003; 162(2): 211 - 222.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Hirata, A. Iwamoto-Kihara, G.-H. Sun-Wada, T. Okajima, Y. Wada, and M. Futai
Subunit Rotation of Vacuolar-type Proton Pumping ATPase: RELATIVE ROTATION OF THE G AND c SUBUNITS
J. Biol. Chem., June 20, 2003; 278(26): 23714 - 23719.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Toyomura, Y. Murata, A. Yamamoto, T. Oka, G.-H. Sun-Wada, Y. Wada, and M. Futai
From Lysosomes to the Plasma Membrane: LOCALIZATION OF VACUOLAR TYPE H+-ATPase WITH THE a3 ISOFORM DURING OSTEOCLAST DIFFERENTIATION
J. Biol. Chem., June 6, 2003; 278(24): 22023 - 22030.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Murata, I. Arechaga, I. M. Fearnley, Y. Kakinuma, I. Yamato, and J. E. Walker
The Membrane Domain of the Na+-motive V-ATPase from Enterococcus hirae Contains a Heptameric Rotor
J. Biol. Chem., May 30, 2003; 278(23): 21162 - 21167.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Nishi, S. Kawasaki-Nishi, and M. Forgac
The First Putative Transmembrane Segment of Subunit c" (Vma16p) of the Yeast V-ATPase Is Not Necessary for Function
J. Biol. Chem., February 14, 2003; 278(8): 5821 - 5827.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
O. Namy, I. Hatin, G. Stahl, H. Liu, S. Barnay, L. Bidou, and J.-P. Rousset
Gene Overexpression as a Tool for Identifying New trans-Acting Factors Involved in Translation Termination in Saccharomyces cerevisiae
Genetics, June 1, 2002; 161(2): 585 - 594.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G.-H. Sun-Wada, Y. Imai-Senga, A. Yamamoto, Y. Murata, T. Hirata, Y. Wada, and M. Futai
A Proton Pump ATPase with Testis-specific E1-Subunit Isoform Required for Acrosome Acidification
J. Biol. Chem., May 10, 2002; 277(20): 18098 - 18105.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
N. Belgareh-Touze, S. Avaro, Y. Rouille, B. Hoflack, and R. Haguenauer-Tsapis
Yeast Vps55p, a Functional Homolog of Human Obesity Receptor Gene-related Protein, Is Involved in Late Endosome to Vacuole Trafficking
Mol. Biol. Cell, May 1, 2002; 13(5): 1694 - 1708.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. M. Smardon, M. Tarsio, and P. M. Kane
The RAVE Complex Is Essential for Stable Assembly of the Yeast V-ATPase
J. Biol. Chem., April 12, 2002; 277(16): 13831 - 13839.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. J. Bowman and E. J. Bowman
Mutations in Subunit c of the Vacuolar ATPase Confer Resistance to Bafilomycin and Identify a Conserved Antibiotic Binding Site
J. Biol. Chem., February 1, 2002; 277(6): 3965 - 3972.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Kawasaki-Nishi, T. Nishi, and M. Forgac
Arg-735 of the 100-kDa subunit a of the yeast V-ATPase is essential for proton translocation
PNAS, October 5, 2001; (2001) 221291798.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
P. C. Jones
Introduction of a Carboxyl Group in the First Transmembrane Helix of Escherichia coli F1Fo ATPase Subunit c and Cytoplasmic pH Regulation
J. Bacteriol., March 1, 2001; 183(5): 1524 - 1530.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
K. Yokoyama, S. Ohkuma, H. Taguchi, T. Yasunaga, T. Wakabayashi, and M. Yoshida
V-Type H+-ATPase/Synthase from a Thermophilic Eubacterium, Thermus Thermophilus. SUBUNIT STRUCTURE AND OPERON
J. Biol. Chem., April 28, 2000; 275(18): 13955 - 13961.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Toyomura, T. Oka, C. Yamaguchi, Y. Wada, and M. Futai
Three Subunit a Isoforms of Mouse Vacuolar H+-ATPase. PREFERENTIAL EXPRESSION OF THE a3 ISOFORM DURING OSTEOCLAST DIFFERENTIATION
J. Biol. Chem., March 17, 2000; 275(12): 8760 - 8765.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Kawamura, K. Arakawa, M. Maeshima, and S. Yoshida
Tissue Specificity of E Subunit Isoforms of Plant Vacuolar H+-ATPase and Existence of Isotype Enzymes
J. Biol. Chem., February 25, 2000; 275(9): 6515 - 6522.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
L. Graham, B Powell, and T. Stevens
Composition and assembly of the yeast vacuolar H(+)-ATPase complex
J. Exp. Biol., January 1, 2000; 203(1): 61 - 70.
[Abstract]


Home page
J. Exp. Biol.Home page
M Forgac
Structure, mechanism and regulation of the clathrin-coated vesicle and yeast vacuolar H(+)-ATPases
J. Exp. Biol., January 1, 2000; 203(1): 71 - 80.
[Abstract]


Home page
J. Exp. Biol.Home page
P. Kane and K. Parra
Assembly and regulation of the yeast vacuolar H(+)-ATPase
J. Exp. Biol., January 1, 2000; 203(1): 81 - 87.
[Abstract]


Home page
J. Exp. Biol.Home page
N Nelson, N Perzov, A Cohen, K Hagai, V Padler, and H Nelson
The cellular biology of proton-motive force generation by V-ATPases
J. Exp. Biol., January 1, 2000; 203(1): 89 - 95.
[Abstract]


Home page
J. Exp. Biol.Home page
M Futai, T Oka, G Sun-Wada, Y Moriyama, H Kanazawa, and Y Wada
Luminal acidification of diverse organelles by V-ATPase in animal cells
J. Exp. Biol., January 1, 2000; 203(1): 107 - 116.
[Abstract]


Home page
J. Biol. Chem.Home page
S. Rahlfs, S. Aufurth, and V. Muller
The Na+-F1F0-ATPase Operon from Acetobacterium woodii. OPERON STRUCTURE AND PRESENCE OF MULTIPLE COPIES OF atpE WHICH ENCODE PROTEOLIPIDS OF 8- AND 18-kDa
J. Biol. Chem., November 26, 1999; 274(48): 33999 - 34004.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Xu, E. Vasilyeva, and M. Forgac
Subunit Interactions in the Clathrin-coated Vesicle Vacuolar (H+)-ATPase Complex
J. Biol. Chem., October 8, 1999; 274(41): 28909 - 28915.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Cohen, N. Perzov, H. Nelson, and N. Nelson
A Novel Family of Yeast Chaperons Involved in the Distribution of V-ATPase and Other Membrane Proteins
J. Biol. Chem., September 17, 1999; 274(38): 26885 - 26893.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Landolt-Marticorena, W. H. Kahr, P. Zawarinski, J. Correa, and M. F. Manolson
Substrate- and Inhibitor-induced Conformational Changes in the Yeast V-ATPase Provide Evidence for Communication between the Catalytic and Proton-translocating Sectors
J. Biol. Chem., September 10, 1999; 274(37): 26057 - 26064.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. A. Harrison, J. Murray, B. Powell, Y.-I. Kim, M. E. Finbow, and J. B. C. Findlay
Helical Interactions and Membrane Disposition of the 16-kDa Proteolipid Subunit of the Vacuolar H+-ATPase Analyzed by Cysteine Replacement Mutagenesis
J. Biol. Chem., September 3, 1999; 274(36): 25461 - 25470.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. M. Kane, M. Tarsio, and J. Liu
Early Steps in Assembly of the Yeast Vacuolar H+-ATPase
J. Biol. Chem., June 11, 1999; 274(24): 17275 - 17283.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X.-H. Leng, T. Nishi, and M. Forgac
Transmembrane Topography of the 100-kDa a Subunit (Vph1p) of the Yeast Vacuolar Proton-translocating ATPase
J. Biol. Chem., May 21, 1999; 274(21): 14655 - 14661.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Forgac
Structure and Properties of the Vacuolar (H+)-ATPases
J. Biol. Chem., May 7, 1999; 274(19): 12951 - 12954.
[Full Text] [PDF]


Home page
Physiol. Rev.Home page
N. Nelson and W. R. Harvey
Vacuolar and Plasma Membrane Proton-Adenosinetriphosphatases
Physiol Rev, April 1, 1999; 79(2): 361 - 385.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
H. Sze, X. Li, and M. G. Palmgren
Energization of Plant Cell Membranes by H+-Pumping ATPases: Regulation and Biosynthesis
PLANT CELL, April 1, 1999; 11(4): 677 - 690.
[Full Text]


Home page
J. Biol. Chem.Home page
S.-B. Peng, X. Li, B. P. Crider, Z. Zhou, P. Andersen, S. J. Tsai, X.-S. Xie, and D. K. Stone
Identification and Reconstitution of an Isoform of the 116-kDa Subunit of the Vacuolar Proton Translocating ATPase
J. Biol. Chem., January 22, 1999; 274(4): 2549 - 2555.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K. J. Parra and P. M. Kane
Reversible Association between the V1 and V0 Domains of Yeast Vacuolar H+-ATPase Is an Unconventional Glucose-Induced Effect
Mol. Cell. Biol., December 1, 1998; 18(12): 7064 - 7074.
[Abstract] [Full Text]


Home page
Microbiol. Mol. Biol. Rev.Home page
Y. Kakinuma
Inorganic Cation Transport and Energy Transduction in Enterococcus hirae and Other Streptococci
Microbiol. Mol. Biol. Rev., December 1, 1998; 62(4): 1021 - 1045.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Oka, R. Yamamoto, and M. Futai
Multiple Genes for Vacuolar-type ATPase Proteolipids in Caenorhabditis elegans. A NEW GENE, vha-3, HAS A DISTINCT CELL-SPECIFIC DISTRIBUTION
J. Biol. Chem., August 28, 1998; 273(35): 22570 - 22576.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
L. A. Graham, K. J. Hill, and T. H. Stevens
Assembly of the Yeast Vacuolar H+-ATPase Occurs in the Endoplasmic Reticulum and Requires a Vma12p/Vma22p Assembly Complex
J. Cell Biol., July 13, 1998; 142(1): 39 - 49.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
S. Kagiwada, K. Hosaka, M. Murata, J.-i. Nikawa, and A. Takatsuki
The Saccharomyces cerevisiae SCS2 Gene Product, a Homolog of a Synaptobrevin-Associated Protein, Is an Integral Membrane Protein of the Endoplasmic Reticulum and Is Required for Inositol Metabolism
J. Bacteriol., April 1, 1998; 180(7): 1700 - 1708.
[Abstract] [Full Text]


Home page
Plant CellHome page
X. Li, R. T. C. Su, H.-t. Hsu, and H. Sze
The Molecular Chaperone Calnexin Associates with the Vacuolar H+-ATPase from Oat Seedlings
PLANT CELL, January 1, 1998; 10(1): 119 - 130.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
Y. E. Oluwatosin and P. M. Kane
Mutations in the CYS4 Gene Provide Evidence for Regulation of the Yeast Vacuolar H+-ATPase by Oxidation and Reduction in Vivo
J. Biol. Chem., October 31, 1997; 272(44): 28149 - 28157.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. J. Tomashek, L. A. Graham, M. U. Hutchins, T. H. Stevens, and D. J. Klionsky
V1-situated Stalk Subunits of the Yeast Vacuolar Proton-translocating ATPase
J. Biol. Chem., October 17, 1997; 272(42): 26787 - 26793.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. D. Jackson and T. H. Stevens
VMA12 Encodes a Yeast Endoplasmic Reticulum Protein Required for Vacuolar H+-ATPase Assembly
J. Biol. Chem., October 10, 1997; 272(41): 25928 - 25934.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Murata, K. Takase, I. Yamato, K. Igarashi, and Y. Kakinuma
Purification and Reconstitution of Na+-translocating Vacuolar ATPase from Enterococcus hirae
J. Biol. Chem., October 3, 1997; 272(40): 24885 - 24890.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Oka, R. Yamamoto, and M. Futai
Three vha Genes Encode Proteolipids of Caenorhabditis elegans Vacuolar-type ATPase. GENE STRUCTURES AND PREFERENTIAL EXPRESSION IN AN H-SHAPED EXCRETORY CELL AND RECTAL CELLS
J. Biol. Chem., September 26, 1997; 272(39): 24387 - 24392.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. J. Tomashek, B. S. Garrison, and D. J. Klionsky
Reconstitution in Vitro of the V1 Complex from the Yeast Vacuolar Proton-translocating ATPase. ASSEMBLY RECAPITULATES MECHANISM
J. Biol. Chem., June 27, 1997; 272(26): 16618 - 16623.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Landolt-Marticorena, K. M. Williams, J. Correa, W. Chen, and M. F. Manolson
Evidence That the NH2 Terminus of Vph1p, an Integral Subunit of the V0 Sector of the Yeast V-ATPase, Interacts Directly with the Vma1p and Vma13p Subunits of the V1 Sector
J. Biol. Chem., May 12, 2000; 275(20): 15449 - 15457.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Powell, L. A. Graham, and T. H. Stevens
Molecular Characterization of the Yeast Vacuolar H+-ATPase Proton Pore
J. Biol. Chem., July 28, 2000; 275(31): 23654 - 23660.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Kawasaki-Nishi, T. Nishi, and M. Forgac
Yeast V-ATPase Complexes Containing Different Isoforms of the 100-kDa a-subunit Differ in Coupling Efficiency and in Vivo Dissociation
J. Biol. Chem., May 18, 2001; 276(21): 17941 - 17948.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Nishi, S. Kawasaki-Nishi, and M. Forgac
Expression and Localization of the Mouse Homologue of the Yeast V-ATPase 21-kDa Subunit c'' (Vma16p)
J. Biol. Chem., August 31, 2001; 276(36): 34122 - 34130.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Keenan Curtis and P. M. Kane
Novel Vacuolar H+-ATPase Complexes Resulting from Overproduction of Vma5p and Vma13p
J. Biol. Chem., January 18, 2002; 277(4): 2716 - 2724.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Arata, J. D. Baleja, and M. Forgac
Cysteine-directed Cross-linking to Subunit B Suggests That Subunit E Forms Part of the Peripheral Stalk of the Vacuolar H+-ATPase
J. Biol. Chem., January 25, 2002; 277(5): 3357 - 3363.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Kawasaki-Nishi, T. Nishi, and M. Forgac
Arg-735 of the 100-kDa subunit a of the yeast V-ATPase is essential for proton translocation
PNAS, October 23, 2001; 98(22): 12397 - 12402.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hirata, R.
Right arrow Articles by Anraku, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hirata, R.
Right arrow Articles by Anraku, Y.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1997 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement