Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tulchinsky, E.
Right arrow Articles by Lukanidin, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tulchinsky, E.
Right arrow Articles by Lukanidin, E.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 272, Number 8, Issue of February 21, 1997 pp. 4828-4835
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

A kappa B-related Binding Site Is an Integral Part of the mts1 Gene Composite Enhancer Element Located in the First Intron of the Gene*

(Received for publication, July 30, 1996, and in revised form, November 20, 1996)

Eugene Tulchinsky Dagger , Egor Prokhortchouk §, Georgii Georgiev and Eugene Lukanidin

From the Danish Cancer Society, Department of Molecular Cancer Biology, Strandboulevarden 49, DK-2100 Copenhagen, Denmark and the  Institute for Gene Biology, Russian Academy of Sciences, Vavilov Str. 34, Moscow, Russia

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
Acknowledgments
REFERENCES


ABSTRACT

The transcription of the mts1 gene correlates with the metastatic potential of mouse adenocarcinomas. Here we describe strong enhancer whose location coincides with the DNase I hypersensitivity area in the first intron of the mts1 gene. The investigation of the transcriptional activity of a series of plasmids bearing deletions in the first intron sequences revealed that the observed enhancer has a composite structure. The enhancer activity is partially formed by the kappa B-related element: GGGGTTTTTCCAC. This sequence element was able to form several sequence-specific complexes with nuclear proteins extracted from both Mts1-expressing CSML100 and Mts1-non-expressing CSML0 adenocarcinoma cells. Two of these complexes were identified as NF-kappa B/Rel-specific p50·p50 homo- and p50·p65 heterodimers. The third complex was formed by the 200-kDa protein. Even though the synthetic kappa B-responsible promoter was active in mouse adenocarcinoma cells, a mutation preventing NF-kappa B binding had no effect on the mts1 natural enhancer activity. On the contrary, the mutation in the kappa B-related element, which abolished the binding of the 200-kDa protein, led to the functional inactivation of this site in the mts1 first intron. The mts1 kappa B-like element activated transcription from its own mts1 gene promoter, as well as from the heterologous promoter in both CSML0 and CSML100 cells. However, in vivo occupancy of this site was observed only in Mts1-expressing CSML100 cells, suggesting the involvement of the described element in positive control of mts1 transcription.


INTRODUCTION

The mts1 gene encodes a Ca2+-binding protein belonging to the S100 subfamily (1-4). Even though several molecular targets of Mts1 protein, including the heavy chain of non-muscle myosin (5), tropomyosin (6), and some unidentified proteins (7), have been characterized, the precise biological function of the Mts1 protein remains unknown. The possible involvement of this protein in cell motility and signal transduction is under discussion (5, 8, 9). mts1-specific mRNA was detected in some types of normal mouse cells such as lymphocytes, macrophages, neutrophils (10), and immortalized fibroblasts (2, 3). mts1 transcription was shown to be inducible in several cell systems (3, 4, 10).1

It was shown in direct transfection experiments that constitutive overexpression of the Mts1 protein in a benign rat epithelial cell line (11) and in src-transformed rat fibroblasts (9) influenced in vitro cell invasion and promoted tumor progression. In addition, the expression of the mts1 gene correlated with the metastatic phenotype of mouse and human carcinoma cells (12, 13). Therefore, the study of the regulation of mts1 transcription can give knowledge leading to a better understanding of the changes that occur in transcription controlling mechanisms in carcinoma cells during tumor progression.

Transcriptional regulation of the mts1 gene has been studied in the mouse metastatic adenocarcinoma cell line CSML100, where this gene is highly expressed. It was demonstrated that the 5'-flanking area of the mts1 gene up to -1890 bp2 did not contain any sequences that positively regulate mts1 gene expression in these cells (14). On the other hand, a positive regulatory element was identified in the first intron of the mts1 gene between positions +294 and +309 (15).

The constructs that contained the CAT gene, under the control of the mts1 regulatory sequences, revealed some level of transcriptional activity when they were transiently transfected into mouse adenocarcinoma cells CSML0, even though the endogenous mts1 transcription was not detectable in those cells (14). Furthermore, mts1 gene transcription can be induced by azadeoxycytidine in two human lymphoma cell lines (16). Thus it was speculated that DNA methylation is involved in transcriptional control of the mts1 gene (14, 16).

Strutz et al. (17) have described a cell-specific enhancer that was present in the 1800-bp upstream region of the mts1 gene. The -1800 to +65 mts1 upstream region placed in front of luciferase reporter gene revealed transcriptional activity in 3T3 and DBF fibroblasts. This activity composed 14-21% of the strength of SV40 early enhancer. On the other hand, the mts1 upstream region was not active in mouse epithelial MCT, embryonic PYS-2, and mesangial MHC cells.

In our research we have continued to study the transcriptional control of the mts1 gene. We show that the enhancer activity is associated with the mts1 first intron sequences in mouse adenocarcinoma cells. We report that the previously described regulatory element located between bp +294 and +309 does not exhaust the positive regulatory system which controls mts1 gene expression in CSML100 cells. The deletion of the SacI-PstI fragment (positions +258 and +646) of the mts1 first intron sequence decreased but did not abolish the transcriptional activity of reporter-containing plasmids transiently transfected in CSML100 cells. Another enhancer was found to be located in the DNase I hypersensitive area in the first intron of the mts1 gene between positions +750 and +950 bp. Two regions of DNA-protein interactions were identified in this area. One of these regions represents a kappa B-related site that binds p50, p65, and another protein with molecular mass of 200 kDa in vitro. The occupancy of this site in vivo was observed only in Mts1-expressing cells. The mutagenesis analysis of the kappa B-related site allowed us to conclude that the interaction with 200-kDa protein was functional in the nucleotide context of the mts1 enhancer. The second type of proteins that are likely to be involved in formation of DHSs in both CSML0 and CSML100 cells apparently represent Msbps (minisatellite binding proteins) (18, 19). These proteins protect intron DNA between +811 and +841 bp and are not involved in the control of mts1 transcription.


MATERIALS AND METHODS

DNase I Hypersensitivity Analysis

Nuclei were isolated as described in Ref. 16 and incubated at 37 °C for 5 min in 200-µl aliquots with different concentrations of DNase I (0.1, 0.3, 1, 3, and 6 units per aliquot). DNA was purified, digested with EcoRI or HindIII, and analyzed by Southern blot hybridization.

The Hybridization Probes

To map the DHSs we used two probes. The ExIII probe corresponded to the sequence 1-145 bp from the beginning of the mts1 third exon; the mi-probe corresponded to the +294 to +442 bp from the mts1 gene transcription start. The highly radioactive probes were synthesized in 11 PCR cycles. P-41CATInt plasmid was used as a template.

Plasmids

P-41CATInt and p-41CATIntDelta plasmids have been described previously under the names p-41CAT and p-41CATDelta (15). The structure of the p-41CATInt plasmid contained the -41 to +1254 mts1 sequences and was as follows: 41 bp of mts1 gene 5'-flanking area, first exon, first intron sequences, 14 bp of the second exon linked to the bacterial CAT gene. p-41CATIntDelta corresponded to the p-41CATInt with the exception of the deleted SacI-PstI restriction fragment. p-41LUCInt, p-1890LUC, and p-41LUC were made by cloning of the -41 to +1254, -1890 to +65, and -41 to +65 sequences of the mts1 gene, upstream of the Photinius pyralis luciferase gene obtained from pfLUC plasmid (20) kindly provided by Dr. M. Jäättelä. Promoterless pLUC plasmid was made by the excision of the c-fos minimal promoter from pfLUC. CAT-containing deletion mutants were obtained as described below. Pdel1 and pdel4 constructs were as follows: p-41CATInt DNA was digested with PstI and, after Bal31 nuclease treatment, self-ligated. Plasmids pdel5 to pdel8 were constructed as follows: after PstI and Bal31 nuclease treatment, p-41CATInt DNA was digested with EcoRI. The obtained fragments were subcloned into PstI/EcoRI-treated p-41CATInt plasmid. Pdel9 plasmid DNA was synthesized on p-41CATInt template DNA in 12 cycles PCR according to Ref. 21. As primers we used oligonucleotides AGCAGCCGCGCCCAACGCTGGGAG (coding strand; positions +831, +854) and GTGGAAAAACCCCAGCTGCCTAATAGGAG (noncoding strand; positions +800, +772). This amplification generated deletion of 30 bp between +800 and +831. To generate the plasmids pmut1LUC and pmut2LUC, we introduced the mutations into p-41LUCInt plasmid DNA by amplifying the whole plasmid using non-mutated 5'-end and mutated 3'-end primers: 5'-end, AGTAAGATGAAGTGGCAGAGG; 3'-end, CCTATTAGGCTGCCTGGTTTTTTCCAC (pmut1LUC) or CCTATTAGGCAGCTGCTATTTTTACAC (pmut2LUC). The borders of all deletions as well as point mutations were verified by DNA sequence analysis. PGL2 control plasmid that contained the luciferase gene driven by SV40 promoter/enhancer elements was purchased from Promega Inc. To create pM5+ and pM5- plasmids, we cloned five copies of the Sb sequence, GCAGCTGGGGTTTTTCCACTT, in direct (pM5+) and reverse (pM5-) orientations, downstream of the CAT gene in the pCAT plasmid (Promega), where the CAT gene was driven by minimal SV40 promoter. The plasmid pN5 contained five copies of kappa B oligonucleotide, AGTTGAGGGGACTTTCCCAGGC, from the mouse Igkappa enhancer (22), downstream of the CAT gene in the pCAT plasmid.

Cell Lines and Transfection

Mouse non-metastatic adenocarcinoma CSML0 and mouse metastatic adenocarcinoma CSML100 cell lines (12) were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum and 50 µg/ml each of streptomycin and penicillin. 2 × 106 CSML0 or CSML100 cells in 100 µl of phosphate-buffered saline were transfected by electroporation with a single pulse of 250 V, 250 microfarads using the Bio-Rad electroporation system "Gene Pulser" and seeded on 10-cm dishes. The efficiency of each transfection was monitored by a cotransfected beta -galactosidase expression vector pSVbeta -gal. Two days post-transfection the cells were lysed, and luciferase activity was measured by a luminometer (Promega luciferase assay system). The obtained lysates were also tested for their beta -galactosidase activity by using o-nitrophenyl beta -D-galactopyranoside (Sigma) as a chromogenic substrate. In some experiments the transfected cells were subjected to RNA isolation.

RNA Analysis

RNA from transfected cells was isolated as described (23), treated with DNase I, extracted by phenol/chloroform, and analyzed in RNase protection assay or by primer extension technique. Commercial plasmids pTRIB and pTRIC (Ambion) were used for riboprobes preparation. The intensity of CAT- and beta -gal-specific signals was determined using an UltraScan apparatus (LKB). For primer extension analysis CAT-specific primer CAACGGTGGTATATCCAGTG was annealed to the RNA and extended using avian myeloblastosis virus reverse transcriptase (Promega) according to the manufacturer's recommendations.

Nuclear extract preparation, EMSA, in vitro DNase I footprinting analysis, and methylation interference assay were performed as described (24, 25). The +691 to +891 fragment of the mts1 first intron sequence studied in EMSA was amplified in 15 cycles PCR using one end-labeled and one non-labeled primer: GAACATATAGCACCTAGG and TCAACCACAAGCACAGG. The sequences of end-labeled double-stranded Sb-containing and kappa B consensus-containing oligonucleotides (22) analyzed in EMSA are given under "Plasmids." Oct-1 was detected with the double-stranded oligonucleotide TGTCGAATGCAAATCACTAGAA (26). All anti-NF-kappa B/Rel antibodies were purchased from Santa Cruz Biotechnology.

UV Cross-linking

CSML100 nuclear proteins were UV cross-linked in situ to the Sb containing oligonucleotide, where all Ts were substituted on 5-bromodeoxyuridine, and analyzed as described (27).

In Vivo Genomic Footprinting

The dimethyl sulfate treatment of cell cultures, DNA preparation, and ligation-mediated PCR were performed as described (28). The chain-specific primers were as follows: primer 1, CTGAAACCTGCAAAG; primer 2, CTACCCCTCAAACTCTGGAGATC; primer 3, CTGGAGATCCATGCCAGCACCTTTC.


RESULTS

The First Intron of the mts1 Gene Contains a Strong Enhancer

Previously, we have searched in the mts1 5'-flanking area for cis-elements controlling mts1 transcription in CSML100 mouse adenocarcinoma cells. No such elements were found (14). All plasmids studied contained the mts1 first intron sequence and differed by the length of upstream regions. However, the enhancer activity of the first intron of the mts1 gene could mask the function of some regulatory elements located upstream of the gene. Therefore, at the initial step of the search for cis-elements regulating mts1 transcription, we compared the abilities of the mts1 first intron and 5'-flanking sequences to enhance transcription in mouse adenocarcinoma CSML0 and CSML100 cells. The cells were transiently transfected by the constructs whose structure is presented in Fig. 1. p-1890LUC and p-41LUC contained 1890 and 41 bp upstream from the mts1 first exon, the whole sequence of the first exon (38 bp), and 27 nucleotides of the first intron placed in front of luciferase reporter gene. p-41LUCInt construct was generated from the previously described p-41CAT and contained the whole mts1 first intron. The activity of these plasmids was studied in CSML100 and CSML0 adenocarcinoma cells compared with the activity of SV40 promoter/enhancer (pGL2 control construct), taken as 100%. The results of these experiments showed that there were no sequences that significantly influenced mts1 promoter activity between -1890 and -41 bp, neither in CSML100 nor in CSML0 cells (compare p-41LUC and p-1890LUC). The comparison of p-41LUC and p-1890LUC plasmids with the promoterless pLUC revealed that these plasmids were weakly expressed in CSML100 and inert when transfected in CSML0 cells (Fig. 1, A and B). On the other hand, the presence of the mts1 first intron sequence considerably increased the activity of the reporter plasmid in CSML100 (Fig. 1A) and to the lesser extent in CSML0 cells (Fig. 1B).


Fig. 1. mts1 first intron sequence up-regulates transcription in CSML100 and CSML0 cells. CSML100 (A) and CSML0 (B) cells were transiently transfected with indicated luciferase constructs along with the beta -galactosidase expression vector, pSVbeta -gal, as a transfection standard. Normalized luciferase activity is expressed as a percentage of the activity of the control, pGL2. The results are the average of four independent transfections. C, indicated CAT-containing constructs were transiently expressed along with pSVbeta -gal in CSML100 cells. The efficiency of the transfections was determined in RNase protection assay using beta -gal-specific riboprobe. The appropriate amounts of RNA were annealed with CAT-specific primer and extended using avian myeloblastosis virus reverse transcriptase. The products were separated in the denaturing 6% PAGE. Lane 1, RNA from cells transfected with p-41CATInt; lane 2, P-41CATIntDelta ; lane 3, pdel4; lanes 4-7, sequencing reactions used as molecular weight markers. The bands corresponding to the full-size CAT cDNA product are indicated.
[View Larger Version of this Image (23K GIF file)]


1226 bp of the mts1 first intron contain several potential TATA boxes, which can work as artificial promoters in transient transfection assay and thereby determine the enhanced level of activity of p-41LUCInt. To exclude this possibility, as well as to check if the first intron enhancer activity can be exclusively addressed to the previously described +294 to +309 positive element (15), we transfected CSML100 cells by p-41CATInt, p-41CATIntDelta , and pdel4 plasmids (Fig. 1C). RNA was isolated and normalized to the transfection standard, and the 5'-ends of CAT-containing RNA were mapped by the extension of the CAT-specific primer. The main bands obtained in lanes 1 and 2 corresponded to the 138-nucleotide cDNA and coincided with the predicted size of RNA synthesized from the mts1 gene natural promoter. The deletion of the previously described +294 to +309 element led to the 40% reduction of the mts1 natural promoter activity (Fig. 1C, lane 2). The deletion of the +43 to +1134 sequence in pdel4 plasmid abolished the transcription directed by the mts1 promoter (Fig. 1C, lane 3). The obtained data allowed us to make two conclusions. First, several potential TATA boxes located in the mts1 first intron were inactive in transient transfection experiments in CSML100 cells. Therefore, the constructed plasmids created an adequate model to study transcription from the natural mts1 promoter. Second, in addition to the described +294 to +309 functional sequence, a novel positive element(s) was present in the first intron of the mts1 gene.

DNase I Hypersensitivity Analysis of the mts1 Gene in CSML0 and CSML100 Cells

The presence of DHSs correlates with the binding of transcription factors to nearby DNA sequences in many tissue-specific genes (for review see Ref. 29). Therefore, we have searched for DHSs in and around the mts1 gene as potential indicators for regions involved in the transcriptional control.

Nuclei were isolated from CSML0 and CSML100 cells and treated with DNase I in different concentrations. After DNA purification and digestion with EcoRI, the samples were blot-hybridized to the ExIII probe, which corresponded to the third exon sequence of the mts1 gene, close to the EcoRI site (Fig. 2A). The 2.1-kb fragment was detected in DNA isolated from DNase I-treated CSML100 nuclei. The appearance of this fragment identified a DHS 2.1 kb upstream from the EcoRI site, hence in the vicinity of the transcription start. Another DNase I-hypersensitive area, located 1.2-1.4 kb upstream from the EcoRI site of the third exon, was revealed in DNA isolated from both CSML0 and CSML100 nuclei. This area, which contained at least two DHSs located next to each other, corresponded to the first intron sequences (Fig. 2A).


Fig. 2. DHS mapping of the mts1 gene region from -2.5 to +5 kb. A, the nuclei isolated from CSML0 (lanes 1-6) and CSML100 cells (lanes 7-12) were treated with increasing amounts of DNase I. Lanes 1 and 7, DNase I was not added; lanes 2 and 8, 0.1 units of DNase I; lanes 3 and 9, 0.3 units of DNase I; lanes 4 and 10, 1 unit of DNase I; lanes 5 and 11, 3 units of DNase I; lanes 6 and 12, 6 units of DNase I. DNA was purified and after EcoRI digestion blot-hybridized to the ExIII probe. B, DNA from CSML100 (lane 2) and CSML0 (lane 3) nuclei treated with 0.3 units DNase I was digested with HindIII and blot-hybridized to the mi probe. Lanes 1 and 4, DNA from CSML0 nuclei, no DNase I; lane 1, DNA was digested with HindIII; lane 4, DNA was double-digested with HindIII and PstI. P, DHS located near mts1 transcription start; I, DHSs located in the mts1 first intron area.
[View Larger Version of this Image (69K GIF file)]


In order to map the first intron DHSs more precisely, DNA from DNase I-treated CSML0 and CSML100 nuclei was digested with HindIII and hybridized to the mi probe. This hybridization revealed a cell-specific location of DHSs in the first intron of the mts1 gene mapped 100-300 bp downstream from PstI site between + 750 and +950 (Fig. 2B). The different positions of DHSs in the chromatin of mts1-expressing and mts1-non-expressing cells might indicate both quantitative and qualitative differences in the composition of proteins (possibly including transcription factors) involved in their formation.

Functional Analysis of the mts1 Gene First Intron Sequences

To determine whether a transcription enhancer element was present within the mts1 first intron DNase I-hypersensitive area, two series of deletion-bearing constructs were obtained and examined by transient transfection of CSML0 and CSML100 cells (Fig. 3). To obtain more reliable statistical data, we have used two different genes as reporters in deletion constructs: CAT (analyzed by RNase protection) and luciferase (analyzed by detection of enzymatic activity in cell extracts). The deletion of the sequence between positions +470 and +780 (plasmid pdel1) did not influence CAT transcription in CSML100 or CSML0 cells (Fig. 3). On the other hand, the +646 to +789 deletion in the composition of the pdel5 construct caused a 2.5-fold reduction of transcriptional activity in CSML100 cells (Fig. 3). Beside that, the +646 to +789 deletion apparently affected activity of CAT-containing constructs transfected in CSML0 cells (Fig. 3A). However, in these cells where the activity of the p-41Int plasmid was relatively low, the sensitivity of the RNase protection method was insufficient to measure the influence of the +646 to +789 deletion (Fig. 3A). The application of luciferase as a reporter gene allowed us to conclude that this deletion caused approximately equal effects on activities of plasmids transfected in both CSML0 and CSML100 cells (Fig. 3B).


Fig. 3. The activity of plasmids bearing deletions in the area of the mts1 first intron. CSML100 and CSML0 cells were transiently transfected with indicated constructs along with the pSVbeta -gal. CAT (A) and luciferase (B) genes were used as reporters. A, the transcriptional activities were analyzed by RNase protection technique using CAT- and beta -gal-specific riboprobes. B, luciferase and beta -galactosidase activities were determined in cell extracts. The values shown in B are normalized to the beta -galactosidase activities. The activities of all CAT-containing plasmids depicted on the scheme were analyzed at least twice. Transfection assays with LUC-containing plasmids were repeated at least four times. Results obtained from single representative experiments are shown.
[View Larger Version of this Image (31K GIF file)]


The expansion of the deleted region to +850 at the 3'-end (construct pdel6) did not change the level of the reporter's expression. However, in CSML100 cells the next deletion mutant, pdel7, with the 3'-end border of the deletion mapped at the position +880, revealed further reduction of the enhancer activity from 35 to 16% compared with the p-41CATInt and p-41LUCInt plasmids (Fig. 3). Pdel7 had approximately the same level of transcriptional activity as the pdel8 construct (3'-end border at +1031). Therefore, two elements located in the DNase I-hypersensitive area in the mts1 first intron composed enhancer activity in CSML100 cells. One element is mapped in the vicinity of +789, and the other is located between +850 and +880 (Fig. 3, compare the transcriptional activities of pdel1 with pdel5 and pdel6 with pdel7). The +850 to +880 region seemed to be not active in mts1-non-expressing CSML0 cells (Fig. 3B). Functional analysis of the mts1 first intron sequences showed that in CSML100 cells the enhancer located in the vicinity of DHSs has stronger activity than the previously described +294 to +309 positive regulatory element (15) (Fig. 3B, compare the activities of pdel8 with p-41IntDelta ).

To further characterize the mts1 first intron enhancer we searched for proteins interacting with the mts1 first intron sequence in the area of DHSs.

In Vitro Study of DNA-Protein Interactions within the +691 to +891-bp Region

Gel retardation analysis of the +691 to +891-bp DNA fragment revealed two types of sequence-specific complexes in both CSML100 (Fig. 4A) and CSML0 (data not shown) nuclear extracts: rapidly migrating group of complexes, Cr, and the slowly migrating Cs. Using the DNase I footprinting technique, as well as methylation interference analysis, we found that Cr complexes were formed by the extensive sequence +811 to +841 bp (designated as Sa) which contains the minisatellite "core" element, CTGGGCAGGCAG (data not shown). The minisatellite core sequence was shown to be able to interact with the ubiquitously expressed minisatellite-binding proteins, Msbps (18, 19), which form rapidly migrating complexes that appear to be similar to Cr complexes. Cr complexes were not functional in transient transfection; the deletion of the +801 to +830 as well as the +789 to +850 intron sequences did not influence mts1 enhancer activity neither in CSML100 nor in CSML0 cells (compare p-41CATInt and p-41LUCInt to pdel9, and pdel5 to pdel6, Fig. 3, A and B). On the other hand, Msbps strongly interacting with the +811 to +841-bp sequence in vitro could be involved in the formation of DHSs in vivo in both CSML0 and CSML100 cells.


Fig. 4. Determination of sequences in the +691 to +891 mts1 gene first intron fragment, which interact with CSML100 and CSML0 nuclear proteins in vitro. A, the nuclear extract prepared from CSML100 cells was incubated with end-labeled +691 to +891 fragment and analyzed in EMSA. Competitors: lane 1, no competitor; lane 2, 10-fold excess of specific competitor; lane 3, 10-fold excess of nonspecific competitor; lane 4, 50-fold excess of specific competitor; lane 5, 50-fold excess of nonspecific competitor. The specific complexes are indicated. B, methylation interference analysis of the Cs complex. G residues involved in binding are marked by asterisks. F, free DNA. Below: +775 to +845 sequence of the mts1 first intron. Sa and Sb sequences are marked. Sequences homologous to the kappa B consensus site and minisatellite core element are underlined. The 3'-borders of the deletions in pdel1 and pdel5 are shown. +789 and +790 guanine residues (sense strand) and +797, +798, and +800 guanine residues (antisense strand) that interfere with the formation of Cs complex are indicated by asterisks.
[View Larger Version of this Image (39K GIF file)]


The methylation interference analysis of Cs revealed two guanines with the coordinates +789 and +790 (sense strand) and three guanines with the coordinates +797, +798, and +800 (antisense strand) which were directly involved in the formation of this complex (Fig. 4B). The positions of these guanines directly coincided with the location of kappa B-related sequence. Moreover, +788 and +789 guanines were deleted in pdel5 construct which revealed the decreased expression in both CSML100 and CSML0 cells, but they remained intact in the structure of pdel1 plasmid with a wild-type level of enhancer activity (Fig. 3).

The kappa B-related sequence was designated as Sb. A more detailed study of proteins interacting with the Sb sequence was performed.

The Identification of Proteins Binding to the kappa B-like Sequence Element

The end-labeled 21-mer oligonucleotide that contained Sb sequence was mixed with 15 µg of CSML0 (Fig. 5, lanes 1-3) or 15 µg of CSML100 nuclear extracts (lanes 6-8) and analyzed in EMSA. We observed three sequence-specific complexes in both extracts used. In addition, another complex designated as C2 was observed in some CSML0 and CSML100 nuclear extracts. This complex was poorly reproducible, and its appearance could result from C1 degradation. Slowly migrating C1 seemed to be identical with Cs formed by the Sb sequence in the composition of the +691 to +891 fragment (Fig. 4); two more rapidly migrating complexes were NF-kappa B-specific; their formation was abolished when 100-fold excess of the nonlabeled kappa B consensus oligonucleotide was added (Fig. 5A, lanes 3 and 8). To determine the composition of these complexes, we used specific antibodies to all known members of the NF-kappa B/Rel family. Gel supershift analysis revealed that rapidly migrating complexes represent p50·p50 homo- and p50·p65 heterodimers in both CSML0 and CSML100 cells (data not shown). C1 and C2 complexes were not influenced by any of the anti-NF-kappa B antibodies. In order to determine the number and molecular weights of the proteins comprising the C1 complex, we UV irradiated the C1 complex in situ (27), followed by SDS-PAGE. The C1 complex was found to be formed by the single protein, whose molecular mass was determined as 200 kDa (Fig. 5B).


Fig. 5. The identification of proteins binding Sb in CSML0 and CSML100 nuclear extracts. A, CSML0 (lanes 1-5) and CSML100 (lanes 6-10) nuclear extracts (15 µg of protein) were analyzed for complex formation with an Sb-containing oligonucleotide probe (lanes 1-3 and 6-8) or an Oct-1 binding oligonucleotide probe (lanes 4, 5, 9, and 10). The NF-kappa B and Oct-1 specificity of the complexes were demonstrated by the addition of 100-fold excess of the competitor oligonucleotide, Ig kappa B (lanes 2 and 7), or Oct-1 binding oligonucleotide (lanes 3, 5, 8, and 10). To quantify the intensities of the bands the gel was scanned by the use of a Molecular Dynamics computing densitometer with Image Quant software. The table at the bottom represents the ratio of C1, p50·p65, and p50·p50 complexes in CSML0 and CSML100 cells. The data were normalized to the protein concentration (column 1) or to the Oct-1 binding activity (column 2). B, the C1 complex was UV cross-linked, and the cross-linked proteins were then resolved by SDS-PAGE. The molecular mass markers are shown. F, free probe.
[View Larger Version of this Image (44K GIF file)]


The qualitative composition of NF-kappa B proteins interacting with Sb in CSML0 cells was identical with that observed in CSML100 nuclear extracts. But there were significant quantitative differences in the abundance of p50·p50, p50·p65, and C1 complexes between CSML0 and CSML100 cells (Fig. 5A). When normalized to the expression level of the Oct-1 binding factor, the differences varied from 10.8 times for C1 to 2.5 times for p50·p65 complex. The ubiquitous Oct-1 binding factor was previously shown to be equally expressed in normal and in different types of malignant mammary epithelium (30).

kappa B-like Sequence Element Cooperates with Heterologous Promoter

Five copies of the 21-mer that contained Sb sequence were subcloned in both orientations downstream of the CAT gene in the composition of the pCAT plasmid, which contained minimal SV40 promoter (pM5+ and pM5- constructs). The oligomerized Sb sequence could activate transcription driven by this promoter 11-13-fold in CSML100 cells and 8-10-fold in CSML0 cells (Fig. 6). The activation occurred in an orientation-independent manner. The enhancer activity of the oligomerized five copies of the Ig kappa B (pN5 construct) was even greater in both cell lines, about 28-fold enhancement in SV40 promoter activity in CSML100 and 15-fold activation in CSML0 cells (Fig. 6A, lane 2; B, lane 2).


Fig. 6. The Sb sequence activates transcription from the SV40 minimal promoter. pCAT (lane 1), pN5 (lane 2), pM5+ (lane 3), and pM5- (lane 4) plasmids were introduced in CSML100 (A) and CSML100 (B) cells along with the pSVbeta -gal expression vector as a transfection standard. RNA was isolated and CAT and beta -gal RNAs were detected by RNase protection method. Densitometer signals for the CAT RNA were normalized to the beta -gal signal of each lane. The relative activity of CAT-containing constructs was normalized to the relative activity of pCAT plasmid taken as 1.0. The mean levels of the normalized CAT transcription in three independent experiments are shown.
[View Larger Version of this Image (35K GIF file)]


The Binding of the 200-kDa Protein Is Sufficient for Maximal Functional Activity of the Sb Sequence in the Nucleotide Context of the mts1 Enhancer

NF-kappa B was shown to be functionally active in both CSML100 and CSML0 mouse adenocarcinoma cells (Fig. 6A, lane 2; B, lane 2). Sb interacts in vivo with NF-kappa B as well as with the 200-kDa protein (Fig. 5A) and activates transcription from the heterologous promoter (Fig. 6A, lanes 3-4; B, lanes 3-4). In order to examine the functional activity of Sb in the nucleotide context of the mts1 enhancer and to address this activity to the specific protein, we designed two mutated oligonucleotides. mut1 bound 200 kDa but failed to interact with p50·p50 and p50·p65 (Fig. 7A, lanes 3-4). The mutations in mut2 abolished the binding of all proteins (Fig. 7A, lanes 5-6). The replacement of wild-type Sb by the mut1 sequence in the p-41LUCInt construct revealed no changes in enhancer activity of resulting plasmid pmut1LUC. On the contrary, the second type of mutation (pmut2LUC plasmid) decreased the enhancer activity to 32-37% of the wild-type enhancer activity in both CSML100 and CSML0 cells (Fig. 7, B and C). Therefore, the formation of the C1 complex mediates the function of Sb in the context of the mts1 first intron sequences.


Fig. 7. Effect of the mutagenesis of the Sb sequence on mts1 enhancer activity. A, 32P-labeled oligonucleotides that contained wild-type Sb (lanes 1 and 2), mut1 (lanes 3 and 4), and mut2 (lanes 5 and 6) were mixed with CSML100 nuclear extracts and analyzed by EMSA. 100-fold excess of nonlabeled Ig kappa B-containing oligonucleotide was added as indicated. B and C, CSML100 (B) and CSML0 (C) cells were transfected by the p-41mut1LUC and p-41mut2LUC, where wild-type Sb was substituted by mut1 and mut2. Normalized luciferase activity is expressed as a percentage of the activity of the p-41LUCInt plasmid that contained the wild-type Sb. The results are the averages of four independent transfections.
[View Larger Version of this Image (24K GIF file)]


In Vivo DNA-Protein Interaction at the Sb Site in CSML0 and CSML100 Cells

In transient transfection experiments, 200-kDa protein mediates activation of reporter constructs via the interaction with the Sb sequence in both CSML100 and CSML0 cell lines, even though this factor is 5.6-10.8 times more abundant in CSML100 compared with CSML0 cells. However, using in vivo genomic footprinting, we found the Sb sequence to be occupied only in CSML100 cells where the mts1 gene is highly expressed (Fig. 8). Three guanine residues with coordinates +797, +798, and +800 (antisense strand) were contacted by proteins in CSML100 cells. Noteworthily, the same Gs were involved in the formation of the Cs complex in vitro (compare Fig. 4C and 8). Since Cs had the same motility in EMSA as C1 complex (data not shown), it was likely formed by the 200-kDa protein. Therefore, Sb sequence seems to be occupied by 200-kDa factor in CSML100 cells in vivo.


Fig. 8. In vivo dimethyl sulfate footprint of the Sb element with the surrounding sequences in CSML0 (lane 1) and CSML100 cells (lane 2). The figure represents the lower strand interactions. G residues involved in binding in CSML100 cells are marked by asterisks.
[View Larger Version of this Image (16K GIF file)]



DISCUSSION

In our present work we have continued the study of the positive control of mts1 gene transcription. We describe the composite enhancer located in the first intron of the gene. Transient transfection experiments revealed that the activity of this enhancer composed 180 and 12% of SV40 early enhancer activity in mts1-expressing CSML100 and mts1-non-expressing CSML0 cells correspondingly. We found two DHSs located in the first intron of the mts1 gene between +750 and +950 bp. The location of these DHSs was quite different in CSML0 and CSML100 cells and coincided with the main enhancer activity revealed by deletion analysis of the mts1 first intron sequences (Fig. 3).

The DNA-protein interactions in the vicinity of the mts1 first intron DHSs were studied in both cell lines. Two sequences designated as Sa (+811 to +841) and Sb (+788 to +800) were found to bind nuclear proteins extracted from both CSML0 and CSML100 cells. Sa includes minisatellite core sequence CTGGGCAGGCAG (+817 to +828) which was shown previously to interact with the 40-kDa murine protein Msbp-1 ubiquitously expressed in mouse tissues (18). We suppose that the proteins involved in the interaction with Sa in CSML0 and CSML100 cells were identical with Msbps (18, 19), because of 1) their sequence specificity and 2) the distinctive pattern of their motility in EMSA (Cr complexes, Fig. 4A). The deletion of the Sa sequence did not influence the transcriptional activity of the pdel9 construct transiently transfected in CSML100 or CSML0 (Fig. 3) cells.

Sb represented the sequence GGGGTTTTTCCAC, which differed from the kappa B consensus site GGGRNNYYCC (22) by R (purine) to T substitution at the fourth position (where Y indicates pyrimidine). This sequence was able to form complexes in vitro with the bacterially expressed p65, c-Rel, and p50 proteins (31). However, to our knowledge this sequence has never been described as a functional kappa B site before. The functional kappa B sites most similar to the Sb sequence have been found in the gamma -interferon intronic enhancer (GAATTTTCC) (32) and in the promoter of the major histocompatibility complex class II associated invariant chain gene (GGGTATTTCC) (33).

Apart from p50·p50 homo- and p50·p65 heterodimers Sb formed stable complex C1 with the 200-kDa protein. This complex was 5.6-10.8 times more abundant in CSML100 then in CSML0 nuclear extracts (Fig. 5A).

The functional importance of the Sb sequence was shown. Five copies of Sb sequence cloned downstream from the CAT gene created an artificial enhancer that was active in CSML0 and CSML100 cells (Fig. 6). Furthermore, we have studied the effect of mutagenesis of the Sb site on the mts1 natural enhancer activity. The mutation (mut1) which abolished the interaction with the p50·p50 and p50·p65 dimers but did not influenced the 200-kDa protein binding had no significant effect on the mts1 enhancer activity. On the other hand, the second type of mutation (mut2) that made the Sb site completely inactive with respect to any protein binding resulted in a 63-68% loss of enhancer activity.

We performed in vivo dimethyl sulfate footprinting analysis of the occupancy of the antisense strand of the Sb sequence in mts1-expressing CSML100 and mts1-non-expressing CSML0 cells. In CSML100 cells, the decreased intensity of the bands corresponding to the +797, +798 and +800 guanine residues indicated their direct involvement in DNA-protein interaction (Fig. 8). However, +800 guanine is located outside of the region homologous to the kappa B consensus sequence. On the other hand, this residue was contacted by the protein in the composition of the Cs complex (Fig. 4B). Since the Cs complex had the same motility in EMSA as the C1 complex (data not shown), and the only one protein component of this complex was the 200-kDa protein, it is highly likely that the protein bound by Sb in CSML100 cells in vivo was identical with the 200-kDa factor. Taken together, the mutagenesis and in vivo footprinting data allowed us to conclude that the interaction of the 200-kDa protein with Sb was important for the functioning of the mts1 natural enhancer. This was supported by the study of the human mts1 first intron sequence homologous to the mouse Sb. In the human genome this sequence contains the thymidine stretch which is one nucleotide longer than that in the mouse Sb, CTGGTTTTTTCCAC. This difference led to the inability of the human Sb to interact with NF-kappa B in vitro. On the other hand, the human Sb formed the stable C1 complex with the 200-kDa protein.1

The nature of the 200-kDa transcription factor remains obscure. To our knowledge, three high molecular weight proteins that exhibited a sequence specificity similar to or identical with that of NF-kappa B have been described earlier. All of them belong to the family of metal-finger transcription factors that activate transcription of the number of tissue-specific genes and viruses and have overlapping but distinctive functional properties. MBP1/PRDII-BF1 (34, 35) and MBP2/AGIE-BP1/AT-BP1/MIBP1 (36-39) have molecular masses of 298 and 275 kDa, respectively, and are therefore different from the protein that activates transcription of the mts1 gene. The molecular mass of the third known protein from this group HIV-EBP2 (40) roughly coincides with 200 kDa. On the other hand, in vitro translated HIV-EBP2, as well as all other members of this family, had affinity to the Ig kappa B site (40), whereas C1 complex was unaffected even by a 100-fold excess of the unlabeled Ig kappa B sequence (Figs. 5 and 7). Thus, the 200-kDa protein may perhaps represent a new member of this family.

P-41CATInt, P-41LUCInt, pM5+, and pM5- constructs were functional when transfected in CSML0 cells. Why the Sb sequence neither interacts with the 200-kDa protein in vivo (Fig. 8) nor activates transcription of the endogenous mts1 in CSML0 cells is not clear. The different occupancies of the Sb site in CSML0 and CSML100 cells in vivo might due to the different concentrations of the 200-kDa protein in these cell lines (Fig. 5A). The repression of the mts1 gene in CSML0 cells might be caused by DNA hypermethylation (13, 14, 16) or/and by some other negative regulatory systems which remain obscure.

The mts1 gene was shown to be inducible in mouse macrophages by lipopolysaccharide treatment (10) and in mouse fibroblasts in response to phorbol 12-myristate 13-acetate1 and serum (2, 3). In many cases the cellular response to these stimuli is achieved through the activation of the NF-kappa B (as reviews see Refs. 41-46). The kappa B-like sequence element found in the first intron of the mts1 gene could provide the transcriptional response of this gene to phorbol 12-myristate 13-acetate and lipopolysaccharide.


FOOTNOTES

*   This work was supported by grants from the Danish Cancer Society, Russian Fund for Basic Research, Russian State Program "Frontiers in Genetics," INTAS, and ICGEB. The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Dagger    To whom correspondence should be addressed: Dept. of Molecular Cancer Biology, Danish Cancer Society, Strandboulevarden 49, Bldg. 4.3, DK-2100 Copenhagen, Denmark. Tel.: +45 35 25 73 15; Fax: +45 35 25 77 21.
§   Present address: Institute for Gene Biology, Russian Academy of Sciences, Vavilov Str. 34, Moscow, Russia.
1    E. Tulchinsky, E. Prokhortchouk, G. Georgiev, and E. Lukanidin, unpublished data.
2    The abbreviations used are: bp, base pair(s); kb, kilobase pairs(s); NF-kappa B, nuclear factor kappa B; CAT, chloramphenicol acetyltransferase; DHS, DNase I hypersensitivity site; EMSA, electrphoretic mobility shift assay; Msbps, minisatellite binding proteins; PAGE, polyacrylamide gel electrophoresis; PCR, polymerase chain reaction; beta -gal, beta -galactosidase.

Acknowledgments

We thank Dr. Kriajevska and Dr. Ambartsumian for a critical reading of the manuscript, Dr. Jäättelä for the pfLUC plasmid, and M. Wieser for help with the manuscript preparation.


REFERENCES

  1. Barraclough, R., Savin, J., Dube, S. K., and Rudland, P. S. (1987) J. Mol. Biol. 198, 13-20 [CrossRef][Medline] [Order article via Infotrieve]
  2. Jackson-Grusby, L. L., Swiergiel, J., and Linzer, I. D. (1987) Nucleic Acids Res. 15, 6677-6690 [Abstract/Free Full Text]
  3. Goto, K., Endo, H., and Fujiyoshi, T. (1988) J. Biochem. (Tokyo) 103, 48-53 [Abstract/Free Full Text]
  4. Masiakowski, P., and Shooter, E. M. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 1277-1281 [Abstract/Free Full Text]
  5. Kriajevska, M. V., Cardenas, M. N., Grigorian, M. S., Ambartsumian, N. S., Georgiev, G. P., and Lukanidin, E. M. (1994) J. Biol. Chem. 269, 19679-19682 [Abstract/Free Full Text]
  6. Takenaga, K., Nakamura, Y., Sakiyama, S., Hasegawa, Y., Sato, K., and Endo, H. (1994) J. Cell Biol. 124, 757-768 [Abstract/Free Full Text]
  7. Gibbs, F. E. M., Wilkinson, M. C., Rudland, P. S., and Barraclough, R. (1994) J. Biol. Chem. 269, 18992-18999 [Abstract/Free Full Text]
  8. Ford, H. L., and Zain, S. (1995) Oncogene 10, 1597-1605 [Medline] [Order article via Infotrieve]
  9. Takenaga, K., Nakamura, Y., Endo, H., and Sakiyama, S. (1994) Jpn. J. Cancer Res. 85, 831-839 [CrossRef][Medline] [Order article via Infotrieve]
  10. Grigorian, M., Tulchinsky, E., Burrone, O., Tarabykina, S., Georgiev, G., and Lukanidin, E. (1994) Electrophoresis 15, 463-468 [CrossRef][Medline] [Order article via Infotrieve]
  11. Davies, B. R., Davies, M. P., Gibbs, F. E., Barraclough, R., and Rudland, P. S. (1993) Oncogene 8, 999-1008 [Medline] [Order article via Infotrieve]
  12. Ebralidze, A., Tulchinsky, E., Grigorian, M., Afanasyeva, A., Senin, V., Revazova, E., and Lukanidin, E. (1989) Genes Dev. 3, 1086-1093 [Abstract/Free Full Text]
  13. Pedrocchi, M., Schafer, B. W., Mueller, H., Eppenberger, U., and Heizmann, C. W. (1994) Int. J. Cancer 57, 684-690 [Medline] [Order article via Infotrieve]
  14. Tulchinsky, E., Ford, H., Kramerov, D., Reshetnyak, E., Grigorian, M., Zain, S., and Lukanidin, E. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 9146-9150 [Abstract/Free Full Text]
  15. Tulchinsky, E., Kramerov, D., Ford, H., Reshetnyak, E., Lukanidin, E., and Zain, S. (1993) Oncogene 8, 79-86 [Medline] [Order article via Infotrieve]
  16. Tulchinsky, E., Grigorian, M., Tkatch, T., Georgiev, G., and Lukanidin, E. (1995) Biochim. Biophys. Acta 1261, 243-248 [Medline] [Order article via Infotrieve]
  17. Strutz, F., Okada, H., Lo, C. W., Danoff, T., Carone, R. L., Tomaszewski, J. E., and Neilson, E. G. (1995) J. Cell Biol. 130, 393-405 [Abstract/Free Full Text]
  18. Collick, A., and Jeffreys, A. J. (1990) Nucleic Acids Res. 18, 625-628 [Abstract/Free Full Text]
  19. Wahls, W. P., Swenson, G., and Moore, D. (1991) Nucleic Acids Res. 19, 3269-3274 [Abstract/Free Full Text]
  20. Saksela, K., and Baltimore, D. (1993) Mol. Cell. Biol. 13, 3698-3705 [Abstract/Free Full Text]
  21. Barnes, W. M. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 2216-2220 [Abstract/Free Full Text]
  22. Lenardo, M. J., and Baltimore, D. (1989) Cell 58, 227-229 [CrossRef][Medline] [Order article via Infotrieve]
  23. Chomczynski, P., and Sacchi, N. (1987) Anal. Biochem. 162, 156-159 [Medline] [Order article via Infotrieve]
  24. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. (eds) (1987) in Current Protocols in Molecular Biology, Vols. 1 and 2, pp. 2.12 and 12.31-12.35, Green Publishing Associates and Wiley Interscience, New York
  25. Dignam, J. D., Lebovitz, R. M., and Roeder, R. G. (1983) Nucleic Acids Res. 11, 1475-1489 [Abstract/Free Full Text]
  26. LeBowitz, J. H., Kobayashi, T., Staudt, L., Baltimore, D., and Sharp, P. A. (1988) Genes Dev. 2, 1227-1237 [Abstract/Free Full Text]
  27. Williams, M., Brys, A., Weiner, A. M., and Maizels, N. (1992) Nucleic Acids Res. 20, 4935-4936 [Free Full Text]
  28. Garrity, P. A., and Wold, B. J. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 1021-1025 [Abstract/Free Full Text]
  29. Gross, D. S., and Garrard, W. T. (1988) Annu. Rev. Biochem. 57, 159-197 [CrossRef][Medline] [Order article via Infotrieve]
  30. Jehn, B., Costello, E., Marti, A., Keon, N., Deane, R., Li, F., Friis, R. R., Burri, P. H., Martin, F., and Jaggi, R. (1992) Mol. Cell. Biol. 12, 3890-3902 [Abstract/Free Full Text]
  31. Kunsch, C., Ruben, S. M., and Rosen, C. A. (1992) Mol. Cell. Biol. 12, 4412-4421 [Abstract/Free Full Text]
  32. Sica, A., Tan, T. H., Rice, N., Kretzschmar, M., Ghosh, P., and Young, H. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 1740-1744 [Abstract/Free Full Text]
  33. Brown, A. M., Linhoff, M. W., Stein, B., Wright, K. L., Baldwin, A. S., Basta, P. V., and Ting, J. P. Y. (1994) Mol. Cell. Biol. 14, 2926-2935 [Abstract/Free Full Text]
  34. Baldwin, A. S., Jr., LeClair, K. P., Singh, H., and Sharp, P. A. (1990) Mol. Cell. Biol. 10, 1406-1414 [Abstract/Free Full Text]
  35. Fan, C. M., and Maniatis, T. (1990) Genes Dev. 4, 29-42 [Abstract/Free Full Text]
  36. Rustgi, A. K., van Veer, L. J., and Bernards, R. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 8707-8710 [Abstract/Free Full Text]
  37. Ron, D., Brasier, A. R., and Habener, J. F. (1991) Mol. Cell. Biol. 11, 2887-2895 [Abstract/Free Full Text]
  38. van Veer, L. J., Lutz, P. M., Isselbacher, K. J., and Bernards, R. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 8971-8975 [Abstract/Free Full Text]
  39. Makino, S., Akiyama, K., Yasuda, J., Mashiyama, S., Honda, S., Sekiya, T., and Hayashi, K. (1994) Nucleic Acids Res. 22, 5679-5685 [Abstract/Free Full Text]
  40. Nomura, N., Zhao, M.-J., Nagase, T., Maekawa, T., Ishizaki, R., Tabata, S., and Ishii, S. (1991) J. Biol. Chem. 266, 8590-8594 [Abstract/Free Full Text]
  41. Baeuerle, P. A. (1991) Biochim. Biophys. Acta 1072, 63-80 [Medline] [Order article via Infotrieve]
  42. Grilli, M., Chiu, J. J., and Lenardo, M. J. (1993) Int. Rev. Cytol. 143, 1-62 [Medline] [Order article via Infotrieve]
  43. Grimm, S., and Baeuerle, P. A. (1993) Biochem. J. 290, 297-308
  44. Muller, J. M., Ziegler-Heitbrock, H. W., and Baeuerle, P. A. (1993) Immunobiology 187, 233-256 [Medline] [Order article via Infotrieve]
  45. Oeth, P. A., Parry, G. C., Kunsch, C., Nantermet, P., Rosen, C. A., and Mackman, N. (1994) Mol. Cell. Biol. 14, 3772-3781 [Abstract/Free Full Text]
  46. Siebenlist, U., Franzoso, G., and Brown, K. (1994) Annu. Rev. Cell Biol. 10, 405-455 [CrossRef]

©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
S. C. Garrett, K. M. Varney, D. J. Weber, and A. R. Bresnick
S100A4, a Mediator of Metastasis
J. Biol. Chem., January 13, 2006; 281(2): 677 - 680.
[Full Text] [PDF]


Home page
Am. J. Pathol.Home page
S. Greenway, R. J. van Suylen, G. Du Marchie Sarvaas, E. Kwan, N. Ambartsumian, E. Lukanidin, and M. Rabinovitch
S100A4/Mts1 Produces Murine Pulmonary Artery Changes Resembling Plexogenic Arteriopathy and Is Increased in Human Plexogenic Arteriopathy
Am. J. Pathol., January 1, 2004; 164(1): 253 - 262.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
L. Mazzucchelli
Protein S100A4: Too Long Overlooked by Pathologists?
Am. J. Pathol., January 1, 2002; 160(1): 7 - 13.
[Full Text] [PDF]


Home page
Nucleic Acids ResHome page
M. A. Cohn, I. Hjelmso, L.-C. Wu, P. Guldberg, E. M. Lukanidin, and E. M. Tulchinsky
Characterization of Sp1, AP-1, CBF and KRC binding sites and minisatellite DNA as functional elements of the metastasis-associated mts1/S100A4 gene intronic enhancer
Nucleic Acids Res., August 15, 2001; 29(16): 3335 - 3346.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. Hjelmsoe, C. E. Allen, M. A. Cohn, E. M. Tulchinsky, and L.-C. Wu
The kappa B and V(D)J Recombination Signal Sequence Binding Protein KRC Regulates Transcription of the Mouse Metastasis-associated Gene S100A4/mts1
J. Biol. Chem., January 14, 2000; 275(2): 913 - 920.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Melkonyan, H. A. Hofmann, W. Nacken, C. Sorg, and M. Klempt
The Gene Encoding the Myeloid-related Protein 14 (MRP14), a Calcium-binding Protein Expressed in Granulocytes and Monocytes, Contains a Potent Enhancer Element in the First Intron
J. Biol. Chem., October 9, 1998; 273(41): 27026 - 27032.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tulchinsky, E.
Right arrow Articles by Lukanidin, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tulchinsky, E.
Right arrow Articles by Lukanidin, E.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1997 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement