![]()
|
|
||||||||
-Phosphoadenylylsulfate:galactosylceramide 3
-Sulfotransferase*
(Received for publication, November 6, 1996)
§,
,
,
and
From the We have isolated a cDNA clone encoding
human 3 Sulfoglycolipids are a class of acidic glycolipids containing
sulfate esters on their oligosaccharide chains which were originally found in the human brain by Thudichum (1). Sulfoglycolipids are
abundant in myelin, spermatozoa, kidney, and small intestine (for
review, see Ref. 2) and have been implicated in a variety of
physiological functions through their interactions with extracellular matrix proteins, cellular adhesive receptors, blood coagulation systems, complement activation systems, cation transport systems, and
microorganisms (for a review, see Ref. 3). The addition of sulfate
ester is catalyzed by a sulfotransferase with
PAPS1 serving as the sulfate donor.
We have demonstrated that GalCer sulfotransferase activity is
remarkably enhanced in human renal cell carcinoma (4, 5) and that the
sulfotransferase level in cancer cells is raised by the action of
epidermal growth factor (6), transforming growth factor- GalCer sulfotransferase was purified from 1 × 1010 cells from a human renal cell carcinoma cell line,
SMKT-R3 (11) using a method described previously (10). The purified
sulfotransferase (10 µg) was reduced and
S-pyridylethylated. The treated enzyme was applied to a
reversed phase HPLC column (Cosmosil 5C4-AR-300, 4.6 × 50 mm,
Nacalai tesque, Japan) and eluted with a linear gradient of 0-70%
acetonitrile in 0.1% trifluoroacetic acid. Following digestion of the
isolated enzyme with lysylendopeptidase (Achromobacter protease I, Wako, Japan), the hydrolysate was subjected to another reversed phase HPLC column (Aquapore OD-300, 7 µm, 1.0 × 250 mm, Applied Biosystems) and eluted with the solvent system described above. The NH2-terminal sequence analysis of separated
peptides was performed by automated Edman degradation using a protein
sequencer (Applied Biosystems 492).
Based on the
amino acid sequence of peptides (Table I) derived from
the purified GalCer sulfotransferase, degenerate oligonucleotides of
both sense and antisense strands were synthesized with deoxyinosine substitution (Applied Biosystems 392) as indicated in Table
II. These oligonucleotides served as primers for RT-PCR
analysis using total RNA from SMKT-R3 cells. A reverse transcriptase
reaction was performed at 37 °C for 1 h using 50 pmol of
oligo(dT) primers, 2 µg of total RNA, a 0.5 mM
concentration of each dNTP, 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 10 mM dithiothreitol, and 200 units of Moloney murine leukemia
virus reverse transcriptase (SuperScript II, Life Technologies, Inc.)
in a final volume of 20 µl. The reaction mixture of the following PCR
contained 4-µl aliquots of the reverse transcriptase reaction
solution, 100 pmol of each primer, a 0.25 mM concentration
of each dNTP, 50 mM KCl, 10 mM Tris-HCl (pH
8.3), 1. 5 mM MgCl2, and 1.25 units of
Taq polymerase (Perkin-Elmer) in a final volume of 50 µl.
The reactions were subjected to 35 cycles of denaturation at 94 °C
for 30 s, annealing at 45-55 °C for 30 s, and extension
at 72 °C for 1-2 min. After agarose electrophoresis of the PCR
products, DNA fragments were excised, subcloned into pT7Blue vector
(Novagen), and sequenced as described below.
Amino acid sequence data for peptides from human renal cancer cell
GalCer sulfotransferase
Oligonucleotide primers for the cDNA clone isolation experiments
using PCR
Department of Molecular Medicine,
Hokkaido Bunkyo
Junior College,
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
Acknowledgments
REFERENCES
-phosphoadenylylsulfate:galactosylceramide
3
-sulfotransferase (EC 2.8.2.11). Degenerate oligonucleotides,
based on amino acid sequence data for the purified enzyme, were used as
primers to amplify fragments of the gene from human renal cancer cell
cDNA by the polymerase chain reaction method. The amplified
cDNA fragment was then used as probe to screen a human renal cancer
cell cDNA library. The isolated cDNA clone contained an open
reading frame encoding 423 amino acids including all of the peptides
that were sequenced. The deduced amino acid sequence predicts a type II
transmembrane topology and contains two potential
N-glycosylation sites. There is no significant homology
between this sequence and either the sulfotransferases cloned to date
or other known proteins. Northern blot analysis demonstrated that a
1.9-kilobase mRNA was unique to renal cancer cells. When the
cDNA was inserted into the expression vector pSVK3 and transfected
into COS-1 cells, galactosylceramide sulfotransferase activity in the
transfected cells increased from 8- to 16-fold over that of controls,
and the enzyme product, sulfatide, was expressed on the transformed
cells.
(7), and
hepatocyte growth factor (8). Furthermore, tyrosine kinases have been
shown to be involved in the expression of sulfotransferase in cancer
cells (9). Previously, we purified GalCer sulfotransferase to apparent
homogeneity from human renal cancer cells (10). Not only GalCer but
also lactosylceramide, galactosyl
1-alkyl-2-acyl-sn-glycerol, and galactosyl diacylglycerol served as good acceptors for the purified enzyme. Now we have cloned a
cDNA encoding the human GalCer sulfotransferase on the basis of the
partial amino acid sequence of the purified enzyme. This is the first
report on gene cloning of glycolipid sulfotransferase.
Amino Acid Sequencing of Peptides Derived from GalCer
Sulfotransferase
Peptide
Amino acid sequence
P1
TASSTLLNILFRFGQK
P2
KPWESMAK
P3
SILGYNLK
P4
LSAGDK
P5
LNA
DXPV
P6
HRLK
P7
FI
DFL
X
or AGT/C as the codon for each serine
residue were synthesized (1Sa-1Sd, 2Sa-2Sb, and 2Aa-2Ab). Nucleotide I
indicates deoxyinosine.
Oligonucleotide
Nucleotide sequence
1Sa
5
-ACIGCITCITCIACICT-3
1Sb
5
-ACIGCIAGTTCIACICT-3
C
1Sc
5
-ACIGCITCIAGTACICT-3
C
1Sd
5
-ACIGCIAGTAGTACICT-3
C C
1A
5
-TTTTGICCAAAICGAAA-3
C G G
2Sa
5
-AAACCITGIGAATCIATGG-3
G G
2Sb
5
-AAACCITGIGAAAGTATGG-3
G G C
2Aa
5
-TIGCCATIGATTCICAIGG-3
C
2Ab
5
-TIGCCATACTTTCICAIGG-3
G C
3S
5
-ATTCTIGGITATAATCTITATAA-3
C C C C
3A
5
-TTATAIAGATTATAICCIAGAAT-3
G G G G
Total RNA was
extracted from SMKT-R3 cells, and poly(A)+ RNA was purified
with oligo(dT)-latex (Oligotex-dT30, Roche). Double-stranded cDNA
was synthesized using a cDNA synthesis kit (SuperScript Choice System, Life Technologies, Inc.). Briefly, the first cDNA strand was synthesized by reverse transcription of the poly(A)+
RNA with oligo(dT) primers. After synthesis of the second strand, the
double-stranded cDNA was ligated with an EcoRI adapter.
Then, the EcoRI-adapted cDNA was ligated to
EcoRI-digested
gt10 and subsequently packaged in
vitro (Ready-To-Go Lambda Packaging Kit, Pharmacia Biotech
Inc.).
Based on
the sequence of the PCR products using primer sets 1Sd and 1A, mixed
oligonucleotides
(5
-TTCTGGCCA/GAAGCGGAACAGGATGTTGAGCAGCGTA/GCTA/GCTCGCCGT-3
), termed
OP1, were synthesized and labeled at their 3
-ends with terminal
transferase using a DIG Oligonucleotide Tailing Kit (Boehringer Mannheim). Southern hybridization of RT-PCR products was carried out at
55 °C for 4 h with a nylon membrane (Boehringer Mannheim) in a
hybridization buffer containing 2 pmol/ml digoxigenin-labeled oligonucleotide probe, 5 × SSC, 1% blocking reagent (Boehringer Mannheim), 0.1% N-laurylsarcosine, and 0.02% SDS. The
detection procedure was carried out with a DIG luminescent detection
kit (Boehringer Mannheim) according to the manufacturer's
instructions.
Approximately 2 × 105
recombinant phages were screened by plaque hybridization with a
digoxigenin-labeled RNA probe (see "Results") which had been
synthesized using a DIG RNA labeling kit with T7 RNA polymerase
(Boehringer Mannheim). Hybridization was carried out at 50 °C
overnight with a nylon membrane (Boehringer Mannheim) in a
hybridization buffer containing 1 ng of digoxigenin-labeled RNA
probe/cm2 of membrane, 50% formamide, 5 × SSC, 2%
blocking reagent (Boehringer Mannheim), 0.1%
N-laurylsarcosine, and 0.02% SDS. Six
phage clones were
picked up from positive plaques, and the inserted cDNAs were
subcloned into pBluescript (Toyobo, Tokyo, Japan) by EcoRI digestion.
The subcloned DNAs were sequenced by the dideoxy chain termination method using Taq DNA polymerase (dye terminator cycle sequencing kit, Perkin-Elmer) with a DNA sequencer (Applied Biosystems 373A).
Northern Blot AnalysisTen µg of total RNA from SMKT-R3,
THP-1 (human monocytic leukemia), GOTO (human neuroblastoma), and
HT-1080 (human fibrosarcoma) cells were denatured in 50% (v/v)
formamide, 6% (v/v) formaldehyde, 20 mM MOPS (pH 7.0) at
65 °C, electrophoresed in a 1% agarose gel containing 6%
formaldehyde, and transferred to a nylon membrane (Boehringer
Mannheim). A digoxigenin-labeled DNA probe was synthesized from the
0.64-kilobase SacII-fragment of pBS-hCST1 (nucleotides 425-1065 in Fig. 1) using a DIG high prime kit (Boehringer Mannheim). The membrane was hybridized with the DNA probe at 50 °C. Other methods were the same as those used for the plaque hybridization.
Expression of GalCer Sulfotransferase cDNA in COS-1 Cells
pBS-hCST1 was digested with EcoRI, and the inserted DNA was ligated into the EcoRI site of expression vector pSVK3 (Pharmacia). The direction of the inserted sequence was determined by the restriction enzyme map. COS-1 cells (2 × 105) precultured for 1 day in a 35-mm-diameter dish were transfected with 1 µg of plasmid DNA and 5 µl of LipofectAMINE (Life Technologies, Inc.). After 72 h, the cells were washed twice with 2 ml of cold Tris-buffered saline, harvested with 0.2 ml of Tris-buffered saline containing 0.1% Triton X-100 using a silicon scraper, sonicated on ice, and assayed for GalCer sulfotransferase activity (12) and protein concentration (BCA protein assay kit, Pierce).
To examine the expression of sulfatide on the COS-1 cells transfected with the cDNA, the cells (1 × 104) were transfected with 0.5 µg of plasmid DNA and 1 µl of LipofectAMINE in a Lab-Tek chamber slide (Nunc Inc.). After 48 h, the cells were washed with phosphate-buffered saline, fixed in 1% paraformaldehyde in phosphate-buffered saline, blocked with 1% bovine serum albumin in phosphate-buffered saline, and incubated with an anti-sulfatide monoclonal antibody, Sulph I (13), followed by fluorescein isothiocyanate-conjugated goat anti-mouse IgG antibody (Zymed Laboratories Inc.). Each incubation was for 45 min. Labeled cells were mounted in Vectashield mounting medium (Vector Laboratories). A Zeiss Axiophot with epi-illumination for fluorescence was used for fluorescence and phase microscopy.
To determine a partial amino acid sequence, purified GalCer sulfotransferase was digested with lysylendopeptidase, and the hydrolysates were isolated on a reversed phase HPLC column. Amino acid sequences determined for seven peptides are shown in Table I. Based on the amino acid sequences of three peptides, P1, P2, and P3, we synthesized degenerate oligonucleotides for sense and antisense primers (Table II). To reduce the primer combinations, deoxyinosine was substituted in positions where the codon degeneration exceeded 2; and the frequently used codon, CTX, was employed for leucine. For each serine residue, we prepared primer combinations of two codon types: TCX and AGC/T. Oligonucleotides 1S(a-d) and 1A were synthesized on the basis of the amino- and the carboxyl-terminal sequences, respectively, of P1. Four possible pairs of sense (1Sa-1Sd) and antisense (1A) primers were first used in RT-PCR analysis with total RNA from human renal cancer cells, SMKT-R3, as the template. The pair of 1Sd and 1A primer sets produced a cDNA fragment of 47 bp, corresponding to the length estimated from the amino acid sequence of P1. When the fragment was subcloned and sequenced, the deduced amino acid sequence coincided with that of P1. Then, we synthesized a mixed oligonucleotide probe (OP1) based on the sequence of the 47-bp cDNA fragment for Southern hybridization of RT-PCR products. In the RT-PCR products using primer sets of 2Sa and 3A, a band of 600 bp was hybridized with the OP1 probe. Based on sequencing analysis, the 600-bp fragment included the sequence encoding P1 and P4, suggesting that the fragment was a part of the target gene. However, we later recognized that the 600-bp fragment lacked nucleotides 304-425 and 825-1291 sequences of the cloned cDNA (Fig. 1A) and contained an aberrant sequence of 70 nucleotides. The reason for the discrepancy is not clear at present.
Screening of cDNA Library of Human Renal Cancer CellsWe
have screened a
gt10 cDNA library made from SMKT-R3 cells using
a digoxigenin-labeled RNA probe synthesized from the above described
600-bp cDNA fragment. Six positive clones were isolated from 2 × 105 plaques and subcloned into pBluescript. The
nucleotide sequence of the largest cDNA insert (1.8 kilobases),
termed pBS-hCST1, was determined.
DNA sequencing analysis revealed that the
cDNA consisted of 1791 nucleotides with a putative initiator codon
at 204 and a TGA stop codon at 1473, having an open reading frame
encoding 423 amino acid residues with a molecular mass of 48,763 Da. A putative polyadenylation signal was located at nucleotide 1761 followed
by poly(A) tracts. The 1801-bp cDNA length is highly consistent
with the mRNA size observed in SMKT-R3 cells (Fig. 2), indicating that the cDNA is nearly full-length.
The deduced amino acid sequence contained two potential
N-linked glycosylation sites (Fig. 1A). Since the
renal cancer GalCer sulfotransferase bound to lectin columns such as
concanavalin A- and wheat germ agglutinin-agarose,2 the enzyme may be
modified by N-linked oligosaccharide chain(s). If the enzyme
protein possesses two N-linked oligosaccharide chains, the
molecular mass will agree with that of the purified protein, which is
54 kDa, observed on SDS-polyacrylamide gel electrophoresis (10). The
deduced amino acid sequence included all of the amino acid sequences
obtained from the purified protein. A hydropathy plot analysis revealed
one prominent hydrophobic segment in the amino-terminal region (Fig.
1B), predicting that this protein has type II transmembrane
topology, as has been the case for all glycoconjugate sulfotransferases
and most glycosyltransferases cloned to date. One of the peptides
obtained, P2 (Lys7-Lys14), is nearer the amino
terminus than the putative transmembrane domain
(Gly15-Leu37), an observation that is in
accordance with the enzyme having been purified from the membrane
fraction (10). The total GC content of the coding region was high
(65.5%).
Northern Analysis
A Northern blot of total RNA from human
cultured cells, renal cell carcinoma (SMKT-R3), monocytic leukemia
(THP-1), neuroblastoma (GOTO), and fibrosarcoma (HT-1080), was
hybridized with a digoxigenin-labeled (
) strand DNA probe made from
the sulfotransferase cDNA. As shown in Fig. 2, a transcript of 1.9 kilobases was observed in SMKT-R3 cells, whereas no bands were detected
in the other human cancer cells.
To demonstrate that the isolated cDNA clone encodes
GalCer sulfotransferase, the cDNA was inserted into a mammalian
expression vector, pSVK3, and overexpressed in COS-1 cells. As shown in
Fig. 3A, COS-1 cells transfected with the
cloned cDNA (pSV-hCST) showed sulfotransferase activity 16 times
higher than those transfected with the pSVK3 vector and eight times
higher than those transfected with the plasmid in which the cDNA
had been inserted in the opposite direction (pSV-hCSTR). To determine
whether the transfected cells express sulfatide, the product of GalCer
sulfotransferase, the cells were visualized immunocytochemically with
an anti-sulfatide monoclonal antibody, Sulph I. Some of the
pSV-hCST-transfected cells displayed surface immunofluorescence,
whereas control cells did not exhibit marked staining (Fig.
3B). This observation indicates that the cDNA can serve
as a template for the synthesis of sulfoglycolipids in cells. The types
of sulfoglycolipids synthesized in the transformed cells remain to be
determined.
We have cloned a cDNA that encodes human GalCer sulfotransferase. Several lines of evidence indicate that the cloned cDNA corresponds to the GalCer sulfotransferase purified previously from human renal cancer cells: (a) the predicted sequence of the protein contains all seven peptides obtained from the purified enzyme protein; (b) when the cDNA was introduced into a eukaryotic expression vector and transfected into COS-1 cells, the enzyme activity expressed exceeded that in controls by 8-16-fold; and (c) the characteristics of the predicted protein are consistent with those of the purified protein in terms of molecular mass and membrane localization.
Sulfonation is an important pathway in the metabolism of many drugs, xenobiotics, hormones, and neurotransmitters. Sulfotransferases involved in this process are cytosolic enzymes and a number of cDNA clones coding for these sulfotransferases have been isolated (for a review, see Ref. 14). These cytosolic sulfotransferases, including plant flavonol sulfotransferases, show considerable homology and have been classified into three families on the basis of their amino acid sequences (14). However, Golgi sulfotransferases functioning in the sulfonation of glycosaminoglycans, N-deacetylase/N-sulfotransferase (15-17) and chondroitin 6-sulfotransferase (18), have little homology with the cytosolic sulfotransferases. There is no significant homology between N-deacetylase/N-sulfotransferase and chondroitin 6-sulfotransferase (18). The present GalCer sulfotransferase showed homology to neither the cytosolic sulfotransferases nor the Golgi sulfotransferases. These observations suggest that GalCer sulfotransferase has an evolutionary origin different from that of the other sulfotransferases.
Based on a modification with pyridoxal phosphate, we suggested previously that lysine residue(s) may be involved in the PAPS binding site of human GalCer sulfotransferase (19). Hashimoto et al. (15) noted a putative PAPS binding motif in sulfotransferases, GXXGXXK, which resembles the P-loop nucleotide binding motif for ATP- and GTP-binding proteins, and this motif is actually conserved near the COOH terminus of many sulfotransferases cloned to date (20). However, there was no such sequence in GalCer sulfotransferase. The conserved motif, YPKSGT(T/N)W, which is located in the NH2-terminal portion of cytosolic sulfotransferases and bacterial sulfotransferases and has been suggested to be a PAPS binding site (21), was not present in GalCer sulfotransferase. Another candidate for the PAPS binding motif, LEKCGR, which has been demonstrated in arylsulfotransferase IV by affinity labeling with ATP dialdehyde (22), was also absent from GalCer sulfotransferase. Accordingly, we plan to continue the search for another PAPS binding motif in GalCer sulfotransferase.
Since there is only one in-frame ATG codon upstream from the sequence
of the P2 peptide, which is the most upstream peptide obtained, in the
open reading frame, we identified the initiation codon a
priori. Compared with the consensus eukaryotic translation initiation sequence (23), the most important purine, which is at the
3 position, is conserved. The putative hydrophobic transmembrane domain of GalCer sulfotransferase contains 23 amino acid residues with
cationic borders characteristic of type II transmembrane proteins. From
the nucleotide sequence of the cDNA, we deduced the amino acid
sequence of GalCer sulfotransferase, showed it to consist of 423 amino
acids, and calculated a molecular mass of 48,763 Da. Considering the
two N-glycosylation sites, the 54-kDa purified human enzyme
(10) appears to reflect the size of the mature enzyme. However, the
sizes of the GalCer sulfotransferases from rat kidney (24) and testis
(25), 64 and 56 kDa, respectively, are too large. On the other hand,
the 31 kDa of the mouse brain enzyme (26) is too small. Although the
reason for these discrepancies is unknown, possibilities include
species differences and the existence of isozymes.
On Northern analysis, transcripts of GalCer sulfotransferase were detected only in SMKT-R3 cells. When we measured the sulfotransferase activity of various human cell lines, this sulfotransferase was detectable only in renal cancer cells (5). These observations suggest that the high sulfotransferase activity in renal cancer cells is based on a high level of the gene expression. Future studies will be directed at elucidating the regulatory mechanisms of sulfotransferase expression in human renal cancer cells. It is also of particular interest to ascertain what causes the tissue-specific expression of sulfoglycolipids. In addition, experimental manipulation of sulfotransferase expression may clarify the physiological role of sulfoglycolipids in various biological processes such as myelination and fertilization.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) D88667[GenBank].
-phosphate 5
-phosphosulfate; GalCer, galactosylceramide; HPLC, high
performance liquid chromatography; PCR, polymerase chain reaction;
RT-PCR, reverse transcription-polymerase chain reaction; MOPS,
4-morpholinepropanesulfonic acid; bp, base pair(s).
We thank Dr. Taiji Tsukamoto, Sapporo Medical University, for providing SMKT-R3 cells. We acknowledge gratefully the generous gift of the Sulph I antibody from Dr. Pam Fredman, Göterborg University, Sweden. We are also grateful to Miwako Yamane for research assistance; Dr. Bierta Barfod for English proofreading of this manuscript; and Dr. Naoyuki Taniguchi, Osaka University Medical School, for encouragement throughout the study.
This article has been cited by other articles:
![]() |
T. Takahashi, K. Murakami, M. Nagakura, H. Kishita, S. Watanabe, K. Honke, K. Ogura, T. Tai, K. Kawasaki, D. Miyamoto, et al. Sulfatide Is Required for Efficient Replication of Influenza A Virus J. Virol., June 15, 2008; 82(12): 5940 - 5950. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Garcia, N. Callewaert, and L. Borsig P-selectin mediates metastatic progression through binding to sulfatides on tumor cells Glycobiology, February 1, 2007; 17(2): 185 - 196. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Niimura and I. Ishizuka Isolation and identification of nine sulfated glycosphingolipids containing two unique sulfated gangliosides from the African green monkey kidney cells, Verots S3, and their possible metabolic pathways Glycobiology, August 1, 2006; 16(8): 729 - 735. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhang, Y. Hayashi, X. Cheng, T. Watanabe, X. Wang, N. Taniguchi, and K. Honke Testis-specific sulfoglycolipid, seminolipid, is essential for germ cell function in spermatogenesis Glycobiology, June 1, 2005; 15(6): 649 - 654. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Chen, K. Ichihara-Tanaka, and T. Muramatsu Role of the Carboxyl-Terminal Region in the Activity of N-Acetylglucosamine 6-O-Sulfotransferase-1 J. Biochem., November 1, 2004; 136(5): 659 - 664. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Ogawa, K. Shikata, K. Honke, S. Sato, M. Matsuda, R. Nagase, A. Tone, S. Okada, H. Usui, J. Wada, et al. Cerebroside Sulfotransferase Deficiency Ameliorates L-selectin-dependent Monocyte Infiltration in the Kidney after Ureteral Obstruction J. Biol. Chem., January 16, 2004; 279(3): 2085 - 2090. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Uemura, K. Kabayama, M. Noguchi, Y. Igarashi, and J.-i. Inokuchi Sialylation and sulfation of lactosylceramide distinctly regulate anchorage-independent growth, apoptosis, and gene expression in3LL Lewis lung carcinoma cells Glycobiology, March 1, 2003; 13(3): 207 - 216. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Honke, Y. Hirahara, J. Dupree, K. Suzuki, B. Popko, K. Fukushima, J. Fukushima, T. Nagasawa, N. Yoshida, Y. Wada, et al. Paranodal junction formation and spermatogenesis require sulfoglycolipids PNAS, April 2, 2002; 99(7): 4227 - 4232. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Fukuda, N. Hiraoka, T. O. Akama, and M. N. Fukuda Carbohydrate-modifying Sulfotransferases: Structure, Function, and Pathophysiology J. Biol. Chem., December 14, 2001; 276(51): 47747 - 47750. [Full Text] [PDF] |
||||
![]() |
N. Ikeda, H. Eguchi, S. Nishihara, H. Narimatsu, R. Kannagi, T. Irimura, M. Ohta, H. Matsuda, N. Taniguchi, and K. Honke A Remodeling System of the 3'-Sulfo-Lewis a and 3'-Sulfo-Lewis x Epitopes J. Biol. Chem., October 12, 2001; 276(42): 38588 - 38594. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Bai, J. R. Brown, A. Varki, and J. D. Esko Enhanced 3-O-sulfation of galactose in Asn-linked glycans and Maackia amurenesis lectin binding in a new Chinese hamster ovary cell line Glycobiology, August 1, 2001; 11(8): 621 - 632. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Tadano-Aritomi, T. Hikita, H. Fujimoto, K. Suzuki, K. Motegi, and I. Ishizuka Kidney lipids in galactosylceramide synthase-deficient mice: absence of galactosylsulfatide and compensatory increase in more polar sulfoglycolipids J. Lipid Res., August 1, 2000; 41(8): 1237 - 1243. [Abstract] [Full Text] |
||||
![]() |
P. Fredman, J.-E. Mansson, B.-M. Rynmark, K. Josefsen, A. Ekblond, L. Halldner, T. Osterbye, T. Horn, and K. Buschard The glycosphingolipid sulfatide in the islets of Langerhans in rat pancreas is processed through recycling: possible involvement in insulin trafficking Glycobiology, January 1, 2000; 10(1): 39 - 50. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Ong, J.-C. Yeh, Y. Ding, O. Hindsgaul, L. C. Pedersen, M. Negishi, and M. Fukuda Structure and Function of HNK-1 Sulfotransferase. IDENTIFICATION OF DONOR AND ACCEPTOR BINDING SITES BY SITE-DIRECTED MUTAGENESIS J. Biol. Chem., September 3, 1999; 274(36): 25608 - 25612. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Nastuk, S. Davis, G. D. Yancopoulos, and J. R. Fallon Expression Cloning and Characterization of NSIST, a Novel Sulfotransferase Expressed by a Subset of Neurons and Postsynaptic Targets J. Neurosci., September 15, 1998; 18(18): 7167 - 7177. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Uchimura, H. Muramatsu, K. Kadomatsu, Q.-W. Fan, N. Kurosawa, C. Mitsuoka, R. Kannagi, O. Habuchi, and T. Muramatsu Molecular Cloning and Characterization of an N-Acetylglucosamine-6-O-sulfotransferase J. Biol. Chem., August 28, 1998; 273(35): 22577 - 22583. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Ong, J.-C. Yeh, Y. Ding, O. Hindsgaul, and M. Fukuda Expression Cloning of a Human Sulfotransferase That Directs the Synthesis of the HNK-1 Glycan on the Neural Cell Adhesion Molecule and Glycolipids J. Biol. Chem., February 27, 1998; 273(9): 5190 - 5195. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Fukuta, J. Inazawa, T. Torii, K. Tsuzuki, E. Shimada, and O. Habuchi Molecular Cloning and Characterization of Human Keratan Sulfate Gal-6-Sulfotransferase J. Biol. Chem., December 19, 1997; 272(51): 32321 - 32328. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Fujimoto, K. Tadano-Aritomi, A. Tokumasu, K. Ito, T. Hikita, K. Suzuki, and I. Ishizuka Requirement of Seminolipid in Spermatogenesis Revealed by UDP-galactose:Ceramide Galactosyltransferase-deficient Mice J. Biol. Chem., July 21, 2000; 275(30): 22623 - 22626. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Hiraoka, H. Nakagawa, E. Ong, T. O. Akama, M. N. Fukuda, and M. Fukuda Molecular Cloning and Expression of Two Distinct Human Chondroitin 4-O-Sulfotransferases That Belong to the HNK-1 Sulfotransferase Gene Family J. Biol. Chem., June 23, 2000; 275(26): 20188 - 20196. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Honke, M. Tsuda, S. Koyota, Y. Wada, N. Iida-Tanaka, I. Ishizuka, J. Nakayama, and N. Taniguchi Molecular Cloning and Characterization of a Human beta -Gal-3'-sulfotransferase That Acts on Both Type 1 and Type 2 (Galbeta 1-3/1-4GlcNAc-R) Oligosaccharides J. Biol. Chem., January 5, 2001; 276(1): 267 - 274. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Okuda, S. Mita, S. Yamauchi, M. Fukuta, H. Nakano, T. Sawada, and O. Habuchi Molecular Cloning and Characterization of GalNAc 4-Sulfotransferase Expressed in Human Pituitary Gland J. Biol. Chem., December 15, 2000; 275(51): 40605 - 40613. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. M. El-Fasakhany, K. Uchimura, R. Kannagi, and T. Muramatsu A Novel Human Gal-3-O-Sulfotransferase. MOLECULAR CLONING, CHARACTERIZATION, AND ITS IMPLICATIONS IN BIOSYNTHESIS OF (SO4-3)Galbeta 1-4(Fucalpha 1-3)GlcNAc J. Biol. Chem., July 13, 2001; 276(29): 26988 - 26994. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kabayama, N. Ito, K. Honke, Y. Igarashi, and J.-i. Inokuchi Suppression of Integrin Expression and Tumorigenicity by Sulfation of Lactosylceramide in 3LL Lewis Lung Carcinoma Cells J. Biol. Chem., July 13, 2001; 276(29): 26777 - 26783. [Abstract] [Full Text] [PDF] |
||||