|
Volume 272, Number 8,
Issue of February 21, 1997
pp. 5056-5062
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.
Novel Repeat Elements Direct Rat Proenkephalin Transcription
during Spermatogenesis*
(Received for publication, August 19, 1996, and in revised form, November, 20, 1996)
Feng
Liu
,
John
Tokeson
,
Stephan P.
Persengiev
,
Karl
Ebert
§ and
Daniel L.
Kilpatrick
¶
From the Neurobiology Group, Worcester Foundation for Biomedical
Research, Shrewsbury, Massachusetts 01545 and the
§ Department of Anatomy and Cell Biology, Tufts University
School of Veterinary Medicine,
North Grafton, Massachusetts 01536
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
Acknowledgments
REFERENCES
ABSTRACT
The developmental program controlling sperm
formation occurs in multiple stages that sequentially involve mitosis,
meiosis, and spermiogenesis. The transcriptional mechanisms regulating these distinct phases are poorly understood. In particular, while a
required role for the germ cell transcription factor cyclic AMP
response element modulator- during spermiogenesis has recently been
demonstrated, the transcriptional mechanisms leading to early haploid
cell formation are unknown. The rat and mouse proenkephalin genes are
selectively expressed from an alternate, germ cell-specific promoter in
meiotic and early haploid cells. In this study, the minimal rat
proenkephalin germ line promoter was localized to a 116-bp region
encompassing the transcriptional start site region. Further, a proximal
51-bp sequence located in the 5 -flanking region is absolutely required
for germ line promoter activity. This 51 bp sequence corresponds to a
previously characterized binding element (GCP1) that forms
cell-specific complexes with rat spermatogenic cell nuclear factors
distinct from cyclic AMP response element binding proteins. Further,
GCP1 contains novel direct repeat sequences required for factor binding
and transgene expression in spermatogenic cells. These repeat elements
are highly similar to sequences within the active regions of other male
germ line promoters expressed during meiosis. GCP1 may therefore
contain transcriptional elements that participate more generally during meiosis in the differentiation of spermatocytes and early haploid spermatids.
INTRODUCTION
Spermatogenesis consists of a well defined developmental program
involving a series of proliferative and differentiative stages. These
events can be divided into three phases: 1) mitosis involving spermatogonial cell types, 2) meiotic division and differentiation of
spermatocytes into haploid spermatids, and 3) spermiogenesis in which
spermatids morphologically differentiate into spermatozoa. Successful
integration of these phases requires the sequential expression of
different subsets of genes and involves, in part, stage-dependent transcription from spermatogenic
cell-specific promoters. Developmental regulation of distinct and
sometimes cell-specific transcription factors appears to be a critical
mechanism controlling this spermatogenic program. For example, a number of proliferation-associated transcriptional regulators, including c-fos, c-jun, and c-myc, are expressed
exclusively in spermatogonial cell types (1, 2). Similarly, germ
cell-specific forms of CREB1 and CREM, as
well as novel mRNAs for Sp1, are expressed during meiotic and/or
postmeiotic stages (3-5).
Recent studies have begun to shed light on the role of transcriptional
regulators during specific phases of sperm development. CREM , a
spermatogenic cell-specific CREM isoform, functions as a
transcriptional activator of promoters containing cAMP response elements (CREs) (6). Expression of CREM protein is reportedly restricted to postmeiotic (spermatid) stages, suggesting a specific role during spermiogenesis (4). Consistent with this, it has been shown
to activate transcription from a number of haploid-specific promoters
that contain CREs, including those for RT7, protamine-1, and transition
protein-1 (6-8). In addition, CREM-deficient mice are infertile due to
the failure to complete spermiogenesis beyond the round spermatid
stage, and they lack testicular expression of several haploid-specific,
CRE-dependent genes (9, 10). Clearly, while CREM has a
critical role in regulating spermiogenesis via CRE-containing
promoters, additional transcription pathways are required for
appropriate sperm maturation. For example, several germ cell promoters
are active during meiosis alone or in both late meiotic and early
postmeiotic germ cells, including those for histones H1 and H2B,
lactate dehydrogenase c, Pdha-2, proacrosin, and pgk-2
(11-16). Further, formation of pachytene spermatocytes and early
(round) spermatids is not interrupted in CREM-deficient mice, and
proacrosin expression persists in these mutants (9, 10). Thus,
CREM-independent transcriptional mechanisms clearly are important for
meiosis and haploid cell formation.
The proenkephalin gene, which codes for enkephalin-containing opioid
peptides, is expressed in a stage-dependent manner during rat and mouse spermatogenesis (17, 18). Opioid peptides have been
implicated in paracrine interactions between germ cells and Sertoli
cells that may be important for maintenance of spermatogenesis (19,
20). Proenkephalin expression occurs initially at low levels in early
meiotic stages and then increases markedly in late pachytene
spermatocytes and round spermatids and declines thereafter. These cells
use an independent, alternate promoter within the single copy
proenkephalin gene to synthesize a novel 1700-nt germ cell-specific
mRNA (21). Previous studies have demonstrated that the rat
proenkephalin germ line promoter is contained within a 500-bp TATA-less
sequence located within the first somatic intron (22). While the
upstream somatic promoter contains functional CRE elements (23), the
germ line proenkephalin promoter lacks such consensus sequences. Since
this promoter is highly active in both pachytene spermatocytes and
round spermatids, its characterization should provide valuable insight
into CRE-independent transcriptional mechanisms governing formation of
late meiotic and early haploid cells. Here we report the identification
of novel cis-acting repeat elements required for expression
of the rat germ line proenkephalin promoter using a transgenic mouse model. The existence of germ cell-specific nuclear factors interacting with these elements is also demonstrated.
MATERIALS AND METHODS
DNA Constructs
Previous transgenic studies (22) used a rat
proenkephalin chloramphenicol acetyltransferase (CAT) fusion construct
encompassing the germ cell proenkephalin start site region as well as
adjacent 3 - and 5 -sequences (RPKCAT0.5). Derivatives of this
transgene were generated as follows (see Fig. 1). RPKCAT0.5 MSP and
RPKCAT0.5 BSM were prepared by isolation of
HindIII-MspI and
HindIII-BsmI fragments, respectively, from
RPKCAT0.5 and subcloning into the promoterless RPKCAT vector using
HindIII and SmaI sites. RPKCAT0.4 was made by
deletion of the first 100 bp from RPKCAT0.5 using TfiI and XhoI and re-ligation of blunt ends.
Fig. 1.
Expression patterns of different RPKCAT
transgenes. Promoter regions contained within different transgene
constructs are shown as solid bars above the corresponding
rat proenkephalin promoter regions. The black boxes in the
GCP1mut construct indicate the locations of mutated repeat elements.
The initiation sites for the somatic (upstream) and germ cell
(downstream) transcripts are indicated by arrows. The
locations of restriction sites used in generating different constructs
and of the GCP1 element are also shown. Exon 1S is the first
exon for the somatic transcript. Exon 1T is the first exon
for the germ cell-specific transcript. Expression data for the CAT
reporter gene in transgenic mice are presented in the table
as the numbers of independent lines that specifically contained CAT
transcripts in the testis and germ cells, but not in somatic tissues,
and that were initiated from the appropriate start sites (plus
column). The minus column shows the number of
transgenic lines that did not express CAT either in testis or in
somatic tissues. The asterisk indicates aberrant CAT
expression in both testis and somatic tissues in one transgenic line
for the RPKCAT0.4 construct.
[View Larger Version of this Image (32K GIF file)]
Constructs RPKCAT0.5-3 Del, RPKCAT0.4-3 Del, RPKCAT5 Del, RPKCAT0.45,
and RPKCAT0.45-3 Del were all generated using the polymerase chain
reaction (PCR). Vent DNA polymerase (New England Biolabs, Inc.,
Beverly, MA) was used in 20 cycle reactions. The DNA sequences of
5 -primers were as follows: 0.5-3 Del,
GTACTACCATCGATGCATGCGATCGTCCAACTTTCT; 0.4-3 Del,
CAGTACCGCTCGAGAATCTTGCCCTAAGCAACCGAC; 0.45 and 0.45-3 Del, ACTACCATCGATGCGCCTGCTCCCGAGCCG; and 0.5-5 Del,
GTACTACCATCGATCAGGAAGACAGGATGCCCCA. The 3 -primer used for each
RPKCAT-3 Del construct was TCCTGTCCTTCCGAGGGCGC, while that used for
constructs 0.5-5 Del and 0.45 was GCTGGTACCAGATCTGAGCTC. Restriction sites within the RPKCAT vector used for subcloning of
PCR products were as follows: 0.5-3 Del, 0.5-5 Del, 0.45 and 0.45-3 Del for ClaI/SmaI; and 0.4-3 Del for
XhoI/SmaI.
The transgene GCP1mut was prepared by annealing sense and antisense
oligonucleotides containing GCP1 sequences that extended to the third
repeat element at its 3 -end where a TfiI site is located and that
contained mutations in the second and third repeats (shown in lower
case): CGATGCGCCTGCTCCCGAGCCGCGAAtaCagtTGTTCGtaCagt (sense) and
actGtaCGAACAactGtaTTCGCGGCTGGGAGCAGGGCGCAT (antisense). This
annealed fragment contained a cohesive PstI overhang at its 5 -end and a blunt 3 -end. A DNA fragment containing the remaining 3 -sequences for RPKCATO.45 was isolated as a
TfiI-XmaI fragment, with the TfiI site
blunt-ended using Klenow. These two DNA fragments were then ligated to
a PstI/XmaI fragment prepared from pRPKCAT0.5 containing CAT, SV40, and vector sequences.
All constructs were confirmed by DNA sequencing before use in
transgenic experiments. Transgenes containing promoter, CAT, and SV40
3 sequences were released by restriction digestion of plasmid DNAs and
gel purified prior to injection. Numbering of sequences within the germ
line promoter are based on assignment of the most upstream initiation
site as +1.
Generation of Transgenic Mice
Transgenic mice were made by
microinjection of the purified transgenes into the male pronucleus of
fertilized mouse eggs. To determine transgene integration, tail DNA
from founder mice was analyzed by PCR using primers to CAT sequences
(ACGTTTCAGTTTGCTCATGG and AGCTAAGGAAGCTAAAATGG) (24). TSH primers
(TCCTCAAAGATGCTCATTAG and GTAACTCACTCATGCAAAGT) were used as a positive
internal control.
Positive founders were bred to obtain male transgenic offspring prior
to analysis. Tissues were removed from males for each positive line
following sexual maturation. A sufficient number of independent
transgenic lines (typically 4-8) were generated for each construct to
ensure clear interpretation of results. In particular, all
non-functional constructs in this study yielded no positive lines,
while expressing transgenes had an expression rate of typically 67% or
greater. This success rate for functionally active transgenes is
consistent with previous transgenic studies (22, 25).
RNase Protection
Total RNA from tissues or isolated cells
was prepared by the method of Chirgwin et al. (26). RNase
protection was performed as described previously (25). Briefly,
radiolabeled antisense RNA probes were generated from linearized
plasmids using [ -32P]UTP and either T7 or T3 RNA
polymerase. The RNA probes were annealed to total RNA in a final volume
of 30 µl of hybridization buffer and then digested with 40 µg/ml
RNase A and 2 µg/ml RNase T1. Samples were treated with proteinase K
(20 mg/ml) and then extracted, precipitated, and analyzed on 5%
polyacrylamide sequencing gels. Riboprobes vectors for CAT (pCAT)
sequences and the rat proenkephalin germ line start site region (pAva)
have been previously described (25). The vector p0.45-3 DelCAT was
used for start site analysis of the RPKCAT-3 Del constructs. It was
prepared by subcloning a XhoI/EcoRI fragment from
RPKCAT0.45-3 Del into the same sites within pBS-SK( ) (Stratagene, La
Jolla, CA).
Preparation of Germ Cells and Nuclear
Extracts
Spermatogenic cells enriched in pachytene spermatocytes
and spermatids were prepared by enzymatic digestion of adult transgenic mouse testes essentially as described by Bellve et al. (27). For nuclear extracts, enriched spermatogenic cells were isolated from
adult rat testes and homogenized in the presence of a protease inhibitor mixture (5 µg/ml each aprotonin, pepstatin A, and
leupeptin, 2 mM benzamidine, and 0.5 mM
phenylmethylsulfonyl fluoride) (22). Nuclei were isolated on sucrose
gradients, and nuclear proteins were extracted as described previously
(22, 28) and stored at 70 C.
Gel Mobility Shift Assays
Gel-shift assays were performed
according to previous protocols (22) with some modifications. Briefly,
0.25-1 ng of 32P-labeled DNA (oligonucleotide or genomic)
was incubated on ice for 20 min with 2 µg of nuclear extract in a
total reaction buffer volume of 14 µl. The reaction buffer contained
10 mM HEPES (pH 7.9), 30 mM NaCl, 10% (v/v)
glycerol, 0.5 mM dithiothreitol, 6 mM
MgCl2, 6 mM spermidine, 0.5 µg of sonicated
salmon sperm DNA, and 0.5 µg of poly(dA-dT). DNA-protein complexes
were resolved on 4% non-denaturing polyacrylamide gels using low ionic
strength buffer containing 12.5 mM Tris borate (pH 8.0) and
0.25 mM EDTA. Competition assays were performed by addition
of excess amounts of unlabeled oligonucleotide into the reaction
mixture.
Double-stranded oligonucleotides and genomic restriction fragments
containing 5 overhangs were labeled with [ -32P]dCTP
by fill-in reactions with Klenow. Genomic fragments were prepared by
restriction digestion of pRPKCAT0.5 (22). DNA sequences of
oligonucleotide probes were as follows: GCP1,
GCGCCTGCTCCCGAGCCGCGAACTCCAGTGTTCGCTCCAGAATCTTGCCCT; and GCP1-mut123,
GCGCCTGtaCagtAGCCGCGAAtaCagtTGTTCGtacagtAATCTTGCCCT. GCP1mut1,
GCP1mut2, GCP1mut3, and GCP1mut23 oligonucleotides contained the same
mutated bases of the indicated repeat elements as in GCP1mut123.
TATA-mut sequences were used as nonspecific competitor DNA:
GGGGGGGGAGAAAAGGGGT. Additional competitor DNAs used were: CRE,
AGAGATTGCCTGACGTCAGAGAGCTAG; CREmut, AGAGATTGCCTGTGGTCAGAGAGCTAG; and
Gli, GAA AGATTGTCCCTGCTGGTCCTGCTCCACGACCCACCCGGCAAGGTT.
Autoradiographs of competition experiments using wild-type and mutated
GCP1 sequences were quantified using densitometric scanning (PDI,
Huntington Station, NY).
Sequence Analysis
A search for transcription factor binding
elements within rat proenkephalin promoter sequences was performed
using the Tfsites program (Genetics Computer Group, Madison, WI).
RESULTS
Functional Mapping of Downstream Sequences within the
Testis-specific Proenkephalin Promoter
Previous work demonstrated
that a fusion gene construct (RPKCAT0.5) containing 500 bp of the rat
proenkephalin gene linked to the reporter gene CAT was sufficient for
cell- and stage-specific expression of the germ line proenkephalin
promoter (22). RPKCAT0.5 contains the transcriptional start site region
for the rat promoter as well as neighboring 5 - and 3 -sequences (Fig.
1). To further map cis-elements that specify
spermatogenic cell transcription, a series of proenkephalin-CAT
constructs containing different portions of this 500 bp promoter
sequence were generated and tested in transgenic mice. Fig. 1
summarizes the results for a series of nine different constructs in
comparison with RPKCAT0.5. Constructs RPKCAT0.5 MSP ( 118 to +312),
RPKCAT0.5 Bsm ( 118 to +168), RPKCATO.8 (which also contains the
upstream somatic promoter), and RPKCAT0.5-3 Del ( 118 to +62)
comprise sequential deletions of the 3 promoter region. All four
constructs actively expressed CAT transcripts in testes of transgenic
mice but not in somatic tissues (kidney, liver, heart, or cerebellum)
as determined by RNase protection analysis of total RNA using an
antisense riboprobe to CAT sequences. In each case, a 250-nt CAT
protection fragment was selectively detected in testis RNA (Fig.
2; data not shown). To confirm that the transgenes were
expressed in the male germ line, RNase protection was performed using
RNA from enriched preparations of pachytene spermatocytes and round
spermatids, stages that express rat proenkephalin in high amounts. CAT
transcripts were abundantly detected in these germ cells for all four
transgenes (Fig. 3A and data not shown). The
level of transgene expression in germ cells was equivalent to that for
the original RPKCAT0.5 construct, as shown for RPKCAT0.5-3 Del (Fig.
3A).
Fig. 2.
3 deletion analysis of the germ line
promoter by RNase protection. Total RNA (50 µg) prepared from
various tissues was examined by RNase protection for different RPKCAT
transgenic lines harboring different 3 deletions of the proenkephalin
germ line promoter (see Fig. 1). The riboprobe used was pCAT, which contains 250 nt of CAT coding sequence. Transgene designations are
given above the bars and transgenic line numbers and tissues are indicated above each lane. T, testis;
K, kidney; H, heart; L, liver. CAT
sense strand, which contains 270 nt of complementary CAT and plasmid
sequence, was used as a positive control. Riboprobe digested in the
presence of yeast RNA served as a negative control (probe).
MspI-digested fragments of pBR322 were used as size markers (M), and their positions are indicated in base pairs in the
margins. Arrows indicate the 250 nt protection
products.
[View Larger Version of this Image (49K GIF file)]
Fig. 3.
Expression of the RPKCAT0.5-3 Del transgene
in spermatogenic cells. A, protection analysis of CAT
transcripts in total RNA from spermatogenic cells. Fifty µg of total
RNA was used except for the first lane of line 1 for the
0.5-3 Del transgene (0.5-3 Del-1) (100 µg). RNA from purified germ
cells of RPKCAT0.5 transgenic mice (0.5(+)) was used as a positive
control while kidney RNA (0.5-3 Del-1K( )) served as a negative
control. Probe, pCAT riboprobe digested alone; M,
size markers. B, analysis of transcription start sites for
the RPKCAT0.5-3 Del construct. RNase protection was performed with the
p0.45-3 DELCAT riboprobe using total RNA from transgenic mouse testes
and kidney (50 µg of each). Total RNA from non-transgenic mouse
testis (MT) was used as a negative control. Numbers
above lanes refer to specific transgenic lines. K,
kidney; T, testis. The major protected bands have lengths of approximately 300, 309, 320, and 334 nt and are shown by
arrows. This result agrees well with the sizes predicted for
transcripts initiated from the 3 -Del transgenes, as shown in the
schematic in panel C. C, the region encompassed
by the p0.45-3 DELCAT riboprobe is shown together with the four
observed protection fragments generated from the initiation region
(In) below it.
[View Larger Version of this Image (37K GIF file)]
Transcriptional initiation of the 1.7-kilobase proenkephalin mRNAs
in rat and mouse testis occurs at multiple sites spanning a 35-bp
region within the germ line promoter. RNase protection using probes
encompassing this region was performed to determine whether
transcription of the four transgenes initiated from these same sites.
Analysis of testicular RNA from RPKCAT0.5-3 Del mice using the
p0.45-3 DELCAT riboprobe generated multiple protection fragments of
approximately 300, 309, 320, and 334 nt that agree well with the
predicted sizes for products initiated from the germ line start sites
(Fig. 3, B and C). Appropriate initiation from
the other 3 deleted transgenes (RPKCAT0.5 MSP, BSM, and RPKCAT0.8) was also confirmed by RNase protection (data not shown). Based on these results, sequences downstream of position +62 are dispensable for appropriate stage- and cell-specific initiation from
the rat proenkephalin promoter in male germ cells.
Analysis of 5 -Flanking Sequences
In contrast to the above
findings, deletion of either 128 ( 118 to +10) (RPKCAT5 -Del) or 105 bp ( 118 to 14) (RPKCAT0.4) of the 5 -flanking region resulted in
complete loss of detectable CAT transcripts in testes of transgenic
mice (Figs. 1 and 4). For all but one transgenic line,
CAT expression was also absent in somatic tissues of mice harboring
these transgenes. One RPKCAT0.4 line exhibited expression in multiple
somatic tissues as well as testis (data not shown). This appears to
reflect the fortuitous insertion of the transgene adjacent to or within
a ubiquitously active transcription unit. These results demonstrated
the existence of one or more functional cis-elements within
the 5 -flanking sequence extending from 118 to 14.
Fig. 4.
5 -deletion analysis in transgenic mice.
Total RNA (50 µg) from different tissues of mice containing the
RPKCAT-5 Del and 0.4 constructs was submitted to RNase protection using
the pCAT riboprobe as described in the legend to Fig. 2. Number
designations above each lane refer to the specific transgenic line
examined. T, testis; K, kidney.
[View Larger Version of this Image (21K GIF file)]
Previous experiments detected multiple sites within the 500 bp
proenkephalin germ line promoter that were bound by nuclear proteins
from spermatogenic cells (22). One of these sites, termed GCP1 ( 54 to
4), was contained within the functional 105 bp 5 -flanking sequence,
immediately upstream of the initiation region (Fig. 1). To determine
whether binding within this region was functionally important, another
transgene (RPKCAT0.45) was tested in which the 51-bp GCP1 sequence was
selectively added back to the RPKCAT0.4 transgene. Readdition of these
sequences restored testis- specific transgene expression (Fig.
5A). The level of RPKCAT0.45 expression was
also comparable with that found for the other functional transgenes
(Fig. 5A). Further analysis also confirmed that the
transgene was expressed in spermatogenic cells (Fig. 5B). To
determine whether transcription initiated from the appropriate start
sites, RNase protection was performed on transgenic testis RNA using
the pAva riboprobe (Fig. 5C). Multiple protection fragments
identical in size to those generated from rat testis RNA were observed.
Thus, sequences from 54 to 4 contain regulatory elements that are
critical for stage-dependent, spermatogenic cell-specific
expression of the rat proenkephalin gene.
Fig. 5.
Expression of the RPKCAT0.45 transgene in
testis and spermatogenic cells. A, RNase protection analysis
of transgenic mouse tissues. Lanes are labeled as in Fig. 2,
with numbers above lanes referring to the individual
transgenic lines tested. T, testis; K, kidney;
C, cerebellum. The arrow indicates the specific 250-nt CAT protection fragment. Testis RNA for line 58-1 was run in
two amounts (50 and 20 µg); all other samples were 50 µg.
B, protection analysis of spermatogenic cells from
RPKCAT0.45 transgenic mice. Samples were analyzed as described in the
legend to Fig. 3A. K( ), transgenic mouse kidney
RNA; 0.5(+), total RNA from RPKCAT0.5 germ cells;
0.45-1, germ cell RNA from RPKCAT0.45 line 1. The
arrow indicates the 250-nt CAT transcript. C,
transcriptional start sites were determined using the pAva riboprobe
and 50 µg of total RNA from transgenic mouse testis. The specific
protection products are shown by the bracket. Rat testis
(RT) and non-transgenic mouse testis (MT) served
as positive and negative controls, respectively. The transgenic lines
tested are given by numbers above each lane. T,
testis; K, kidney.
[View Larger Version of this Image (72K GIF file)]
To define more accurately the minimal promoter sequences required for
the proenkephalin germ line promoter, the construct RPKCAT0.45-3 Del
was studied (Fig. 1). This transgene was equally active in directing
testis-specific expression (Fig. 6A) that also localized to germ cells and initiated from the appropriate sites
(data not shown), thus further defining the minimal promoter region to
a 116-bp sequence ( 54 to +62). In addition to GCP1, this minimal
promoter encompasses the initiation region and a previously defined
(22) downstream protein interaction site (GCP2) (Fig.
6B).
Fig. 6.
Analysis of the RPKCAT0.45-3 Del transgene.
A, RNase protection analysis was performed on tissues from
different transgenic lines as in Fig. 2. The individual transgenic
lines tested are indicated by the numbers above each lane.
T, testis; K, kidney; C, cerebellum.
Larger bands above the specific 250-nt CAT protected fragments
(arrow) are products of incomplete digestion by RNase. B, schematic of the 116-bp minimal rat proenkephalin germ
line promoter. Two regions that bind spermatogenic cell nuclear
factors, GCP1 (1) and GCP2 (2), are shown
together with the transcriptional initiation region (In).
The minimal promoter within the RPKCAT0.5 sequence is indicated above
by the bar. Exon 1T, exon 1 for the rat
proenkephalin germ cell transcripts.
[View Larger Version of this Image (30K GIF file)]
Novel Spermatogenic Cell Nuclear Factors Specifically Interact with
GCP1
The preceding findings indicated that nuclear protein
interactions with GCP1 sequences are critical for activity of the
proenkephalin germ line promoter during spermatogenesis. Sequence
analysis did not reveal any consensus binding sites for known
transcription factors within this region. However, the GCP1 sequence
does contain three direct repeats (CTCCA/CG) (Fig.
7A) that could function to regulate transcription. The
possible involvement of these repeated sequences in factor binding was,
therefore, examined using gel-shift analysis. GCP1 sequences form a
major and additional minor complexes of higher mobility with rat testis
and germ cell nuclear extracts that are distinct from those formed with
liver nuclear proteins (Fig. 7B). The relative abundance of
the higher mobility complexes varied in different experiments (Fig. 7,
C and D), and they may reflect probe
heterogeneity and/or partial proteolysis in some experiments.
Competition experiments demonstrated that binding of germ cell factors
to GCP1 was DNA sequence-specific (Fig. 7C). This analysis
also revealed that GCP1 sequences were not recognized by CRE-binding
proteins present in spermatogenic cell nuclear extracts (Fig.
7C). Further, mutation of the three direct repeats abolished
the binding of germ cell factors (Fig. 7D), suggesting the
direct involvement of these elements in GCP1/protein interactions.
Fig. 7.
Mobility shift assays using the GCP1
oligonucleotide probe. A, nucleotide sequences of wild-type
(W.T.) and mutated (Mut123) GCP1
oligonucleotides. The repeat regions (R1, R2, and R3) and mutated sequences are underlined.
B, gel-shift analysis of GCP1 binding to rat germ cell
(G) and liver (L) nuclear extracts. Arrows indicate complexes detected in liver and germ cells.
C, 10- and 25-fold excess of unlabeled GCP1, CRE, CRE-Mut,
and nonspecific TATA-mut (NS) oligos were used as cold
competitors of binding to rat germ cell extracts. C,
control; P, probe alone. D, competition using a
10-fold excess of either wild-type GCP1, GCP1mut23 (M23), or
GCPmut123 (M123) with rat germ cell extracts. C,
control.
[View Larger Version of this Image (61K GIF file)]
Functional Analysis of GCP1
Additional studies of the repeat
sequences were performed to determine their relative contributions to
factor binding by GCP1. Mutation of the first repeat alone had a
negligible effect on this interaction (Fig. 8). However,
mutation of either the second or third repeat resulted in partial loss
of binding activity (50-65% decrease) and mutation of both resulted
in essentially complete disruption of the GCP1/protein complex (Fig. 8;
see also Fig. 7D). Mutation of repeat 1 together with either
the second or third repeat did not further reduce GCP1 binding
activity, nor did deletion of the 5 -end of GCP1 including the first
repeat (Fig. 8). Thus, the second and third repeats, which are
identical in sequence and differ from the first repeat in the fifth
position (A instead of C), are required for maximal binding of GCP1 to
germ cell nuclear factors. It is possible that the first repeat is
inactive because of this single base difference in the fifth position
or because of its positioning within GCP1, or both.
Fig. 8.
Role of individual repeat elements in germ
cell factor binding to GCP1. Gel-shift assays were performed using
rat germ cell nuclear extracts and the GCP1 probe in the presence and
absence of varying concentrations of competitor DNAs. Mutations of the GCP1 repeat elements (R1, R2, or R3) are
indicated by black boxes (open boxes signify wild
type sequences). The amount of the specific GCP1 complex (shown by
arrow in Fig. 7D) in each case was quantified by
densitometry, and the binding activity of each competitor relative to
GCP1 is indicated as follows: ++++, 90-100%; ++, 35-50%; , <10%.
[View Larger Version of this Image (14K GIF file)]
To examine the functional significance of these in vitro
protein interactions with GCP1 sequences, an additional transgene, containing mutations of the second and third repeats identical to those
used in gel-shift analysis, was constructed and tested (GCP1mut; Fig.
1). Mutation of these two sites resulted in complete loss of transgene
expression in mouse testis and did not produce abberant expression in
somatic tissues (Fig. 9). These findings indicate that
the interactions between spermatogenic cell nuclear proteins and the
second and third repeat elements within GCP1 are critical for
proenkephalin germ line promoter activity.
Fig. 9.
Functional analysis of the GCP1 repeat
elements. RNase protection analysis of tissues from GCP1mut
transgenic mice was performed as described in Fig. 2. The
arrows indicate the predicted position for the 250 nt CAT
protection fragment. Total RNA from testes of RPKCAT0.45 transgenic
mice was used as a positive control.
[View Larger Version of this Image (46K GIF file)]
DISCUSSION
Spermatogenic cells are characterized by the production of a large
number of unique transcript forms often encoding ubiquitously expressed
proteins (30). Some of these mRNAs encode germ cell-specific isoforms that may perform specialized functions during spermatogenesis (30). In other cases, novel untranslated sequences are present that may
have specific regulatory roles, as in the translational control of
testis-specific superoxide dismutase-1 mRNA involving its
5 -untranslated region (31). Transcription from an alternate spermatogenic cell-specific promoter is often involved in generation of
these unique transcripts (32-34), as for rat and mouse proenkephalin. Alternate promoters expressed in somatic cells frequently function selectively during cell development and differentiation (35). It is
therefore possible that some germ cell-specific transcripts reflect the
necessity for an alternate promoter that provides appropriate
cell-specific and developmentally regulated expression in the male germ
line.
Previous work showed that the rat proenkephalin germ line promoter
functions independently of the upstream somatic promoter and that a
500-bp region could mediate cell- and stage-specific expression (22).
In this study, we have demonstrated that a 116-bp region encompassing
the start site region is sufficient for appropriate transcription of
the proenkephalin promoter in spermatocytes and spermatids and that a
51-bp 5 -flanking sequence (GCP1) is absolutely required for its
activity. These data are consistent with the presence of one or more
cell-specific transactivators in these spermatogenic stages that
interact with specific elements in GCP1. At present, there is no
evidence for the involvement of transcriptional repression in somatic
cells since deletion analyses did not result in ectopic transgene
expression in somatic tissues. However, a role for silencer elements
located elsewhere within the minimal promoter region cannot be ruled
out. This is relevant since repression has been implicated in
spermatogenic cell transcription of the c-mos, lactate
dehydrogenase c, Tctex-1, and histone H2b promoters (12, 36-38).
Recent studies have begun to characterize transcriptional regulation
during spermatogenesis using transgenic, cell transfection and in
vitro transcription approaches (7, 11, 15, 22, 32, 39-44). While
numerous germ cell-specific promoters have been analyzed, much remains
to be learned regarding the specific transcriptional mechanisms
mediating stage-dependent gene expression in the male germ
line. A critical role for CREM proteins and CRE-dependent promoter regulation in mediating spermiogenesis has been established (9, 10). However, additional mechanisms appear necessary for formation
of meiotic and early postmeiotic germ cells. In fact, several
testis-specific DNA binding proteins apparently unrelated to CREMs have
been implicated in promoter regulation in these spermatogenic stages.
For example, novel ets-domain-like proteins appear to regulate the
pgk-2 promoter in mouse germ cells (39), and a
testis-specific protein recognizes a novel palindromic regulatory
element involved in testis-specific transcription of the mouse lactate
dehydrogenase c gene (37). Both of these promoters function during
spermatocyte and spermatid stages. In addition, testis-specific factors
bind to regulatory elements (TE1 and TE2) unrelated to CREs within the
spermatocyte-specific histone H1t promoter (45). However, the
identities and functional roles for these and other putative germ
cell-specific trans-factors, such as Tet-1 (46), are
generally unknown.
The proenkephalin germ line promoter also becomes highly active in
pachytene spermatocytes, and the 51-bp GCP1 regulatory region does not
contain CRE-like sequences and is not responsive to CREM or CREB in
transient co-transfection assays (data not shown). In addition,
proenkephalin expression is not reduced in testes of CREM-deficient
mice.2 Therefore, the proenkephalin gene is
also regulated by CREM-independent mechanisms during spermatogenesis.
Consistent with this, germ cell-specific nuclear proteins distinct from
CREM and other CRE-binding proteins specifically bind to this
region. Factor binding involves a novel sequence (CTCCAG) repeated
twice within GCP1, and more importantly, mutation of these two elements
abolishes proenkephalin germ line promoter activity. Interestingly,
this repeat resembles sequences within the lactate dehydrogenase c
palindromic element that are required for germ cell-specific
transcription (CTCCTG) (37). In both promoters, these sequences are
located just upstream of the start sites, and in both cases, germ cell
proteins bind to DNA segments containing these elements. Similarly, the
testis-specific element TE2 found within the rat histone H1t promoter
also contains sequences resembling the GCP1 repeats (CCCCAG) (45). It
is therefore possible that sequences related to the repeat elements
within GCP1 may regulate multiple germ cell-specific promoters
expressed during late meiosis. Repeated elements are often required for proper DNA binding or enhanced activation by trans-acting
factors. For example, DNA binding by thyroid hormone requires
appropriately spaced direct repeats (47), and Sp1 exhibits synergistic
promoter activation when multiple binding sites are present (48).
Functional analysis of other sequences within the 116-bp promoter
region is an important goal of future analyses. For example, initiation
regions are often critical for activation of TATA-less promoters (49)
although sequences resembling typical initiator (Inr) elements are not
found within the start site region of the proenkephalin germ line
promoter. In addition, another region is present within the defined
minimal promoter (GCP2) that binds germ cell-specific nuclear factors
and contains a palindromic GC-box (see Fig. 6B). Finally,
characterization of the GCP1 binding proteins, their developmental
expression, and potential interactions with other promoters active
during late meiosis are clearly important to pursue.
FOOTNOTES
*
This work was supported by U. S. Public Health Service
Grant DK36468 and National Research Service Award F32 DK09006. The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Present address: Dept. of Life Sciences, Virginia State
University, Petersburg, VA 23806.
¶
To whom correspondence should be addressed. Tel.:
508-842-8921, ext. 134; Fax: 508-842-9632; E-mail:
kilpatrick{at}sci.wfbr.edu.
1
The abbreviations used are: CREB, cyclic AMP
response element binding protein; CRE, cyclic AMP response element;
CREM , cyclic AMP response element modulator- ; CAT,
chloramphenicol acetyltransferase; nt, nucleotide(s); bp, base
pair(s).
2
J. Blendy and G. Shütz, unpublished
observations.
Acknowledgments
We thank Donna Marshall for excellent
technical assistance and Dr. Priti Raval for contributions to initial
aspects in this work. We also thank Cathy Warren for invaluable help in
preparing this manuscript.
REFERENCES
-
Propst, F., Rosenberg, M. P., and Vande Woude, G. F.
(1988)
Trends Genet.
4,
183-187
[CrossRef][Medline]
[Order article via Infotrieve]
-
Torry, D. S.
(1992)
Am. J. Reprod. Immunol.
27,
167-170
-
Waeber, G., Meyer, T. E., LeSieur, M., Hermann, H. L., Gerard, N., and Habener, J. F.
(1991)
Mol. Endocrinol.
5,
1418-1430
[Abstract/Free Full Text]
-
Delmas, V., van der Hoorn, F., Mellstrom, B., Jegou, B., and Sassone-Corsi, P.
(1993)
Mol. Endocrinol.
7,
1502-1514
[Abstract/Free Full Text]
-
Persengiev, S. P., Raval, P. J., Rabinovitch, S., Millette, C. F., and Kilpatrick, D. L.
(1996)
Endocrinology
137,
638-646
[Abstract]
-
Delmas, V., and Sassone-Corsi, P.
(1994)
Mol. Cell. Endocrinol.
100,
121-124
[CrossRef][Medline]
[Order article via Infotrieve]
-
Kistler, M. K., Sassone-Corsi, P., and Kistler, W. S.
(1994)
Biol. Reprod.
51,
1322-1329
[Abstract]
-
Zambrowicz, B. P., and Palmiter, R. D.
(1994)
Biol. Reprod.
50,
65-72
[Abstract]
-
Nantel, F., Monaco, L., Foulkes, N. S., Masquiller, D., LeMeur, M., Henriksen, K., Dierich, A., Parvinen, M., and Sasson-Corsi, P.
(1996)
Nature
380,
159-162
[CrossRef][Medline]
[Order article via Infotrieve]
-
Blendy, J. A., Kaestner, K. H., Weinbauer, G. F., Nieschlag, E., and Schutz, G.
(1996)
Nature
380,
162-165
[CrossRef][Medline]
[Order article via Infotrieve]
-
van Wert, J. M., Wolfe, S. A., and Grimes, S. R.
(1995)
Biochemistry
34,
8733-8743
[CrossRef][Medline]
[Order article via Infotrieve]
-
Lim, K., and Chae, C.-B.
(1992)
J. Biol. Chem.
267,
15271-15273
[Abstract/Free Full Text]
-
Thomas, K., Del Mazo, J., Eversole, P., Bellve, A., Hiraoka, Y., Li, S. L., and Simon, M.
(1990)
Development
109,
483-493
[Abstract]
-
Iannello, R. C., Kola, I., and Dahl, H.-H. M.
(1993)
J. Biol. Chem.
268,
22581-22590
[Abstract/Free Full Text]
-
Nayernia, K., Nieter, S., Kremling, H., Oberwinkler, H., and Engel, W.
(1994)
J. Biol. Chem.
269,
32181-32186
[Abstract/Free Full Text]
-
Robinson, M. O., McCarrey, J. R., and Simon, M. I.
(1989)
Proc. Natl. Acad. Sci. U. S. A.
86,
8437-8441
[Abstract/Free Full Text]
-
Kilpatrick, D. L., and Millette, C. F.
(1986)
Proc. Natl. Acad. Sci. U. S. A.
83,
5015-5081
[Abstract/Free Full Text]
-
Kilpatrick, D. L., Borland, K., and Jin, D.
(1987)
Proc. Natl. Acad. Sci. U. S. A.
84,
5695-5699
[Abstract/Free Full Text]
-
Fabbri, A., Tsai-Morris, C. H., Luna, S., Fraioli, F., and Dufau, M. L.
(1985)
Endocrinology
117,
2544-2546
[Abstract/Free Full Text]
-
Morris, P. L., Vale, W. W., and Bardin, C. W.
(1987)
Biochem. Biophys. Res. Commun.
148,
1513-1519
[CrossRef][Medline]
[Order article via Infotrieve]
-
Kilpatrick, D. L., Zinn, S. A., Fitzgerald, M., Higuchi, H., Sabol, S. L., and Meyerhardt, J.
(1990)
Mol. Cell. Biol.
10,
3717-3726
[Abstract/Free Full Text]
-
Galcheva-Gargova, Z., Tokeson, J. P., Karagyosov, L. K., Ebert, K. M., and Kilpatrick, D. L.
(1993)
Mol. Endocrinol.
7,
979-991
[Abstract/Free Full Text]
-
Hyman, S. E., Comb, M., Lin, Y.-S., Pearlberg, J., Green, M. R., and Goodman, H. M.
(1988)
Mol. Cell. Biol.
8,
4225-4233
[Abstract/Free Full Text]
-
Walter, C. A., Nasr-Schirf, D., and Luna, V. J.
(1989)
BioTechniques
7,
1065-1070
[Medline]
[Order article via Infotrieve]
-
Zinn, S. A., Ebert, K. M., Mehta, N. D., Joshi, J., and Kilpatrick, D. L.
(1991)
J. Biol. Chem.
266,
23850-23855
[Abstract/Free Full Text]
-
Chirgwin, J. M., Przbyla, A. E., MacDonald, R. J., and Rutter, W. J.
(1979)
Biochemistry
18,
5294-5299
[CrossRef][Medline]
[Order article via Infotrieve]
-
Bellve, A. R., Millette, C. F., Bhatnagar, Y. M., and O'Brien, D. A. (1977) J. Histochem. Cytochem
-
Cereghini, S., Raymondjean, M., Carranca, A. G., Herbomel, P., and Yaniv, M.
(1987)
Cell
50,
627-638
[CrossRef][Medline]
[Order article via Infotrieve]
-
Williams, M., Brys, A., Weiner, A. M., and Maizels, N.
(1992)
Nucleic Acids Res.
20,
4935-4936
[Free Full Text]
-
Wolgemuth, D., and Watrin, F.
(1991)
Mamm. Genome
1,
283-288
[CrossRef][Medline]
[Order article via Infotrieve]
-
Gu, W., and Hecht, N. B.
(1996)
Mol. Cell. Biol.
16,
4535-4543
[Abstract]
-
Sun, Z., and Means, A. R.
(1995)
J. Biol. Chem.
270,
20962-20967
[Abstract/Free Full Text]
-
Teruya, J. H., Kutsunai, S. Y., Spear, D. H., Edwards, P., and Clarke, C. F.
(1990)
Mol. Cell. Biol.
10,
2315-2326
[Abstract/Free Full Text]
-
Howard, T. E., Shai, S.-Y., Langford, K. G., and Martin, B. M.
(1990)
Mol. Cell. Biol.
10,
4294-4302
[Abstract/Free Full Text]
-
Schibler, U., and Sierra, F.
(1987)
Trends Genet.
21,
237-257
-
Zinkel, S. S., Pal, S. K., Szeberenyi, J., and Cooper, G. M.
(1992)
Mol. Cell. Biol.
12,
2029-2036
[Abstract/Free Full Text]
-
Zhou, W., and Goldberg, E.
(1996)
Biol. Reprod.
54,
84-90
[Abstract]
-
O'Neill, M. J., and Artzt, K.
(1995)
Development
121,
561-568
[Abstract]
-
Goto, M., Masamune, Y., and Nakanishi, Y.
(1993)
Nucleic Acids Res.
21,
209-214
[Abstract/Free Full Text]
-
van der Hoorn, F. A., and Tarnasky, H. A.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
703-707
[Abstract/Free Full Text]
-
Langford, K. G., Shai, S.-Y., Howard, T. E., Kovac, M. J., Overbeek, P. A., and Bernstein, K. E.
(1991)
J. Biol. Chem.
266,
15559-15562
[Abstract/Free Full Text]
-
Zhou, W., Xu, J., and Goldberg, E.
(1994)
Biol. Reprod.
51,
425-432
[Abstract]
-
Bunick, D., Johnson, P. A., Johnson, T. R., and Hecht, N. B.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
891-895
[Abstract/Free Full Text]
-
Zambrowicz, B. P., Harendza, C. J., Zimmermann, J. W., Brinster, R. L., and Palmiter, R. D.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
5071-5075
[Abstract/Free Full Text]
-
Wolfe, S. A., van Wert, J. M., and Grimes, S. R.
(1995)
Biochemistry
34,
12461-12469
[CrossRef][Medline]
[Order article via Infotrieve]
-
Tamura, T., Makino, Y., Mikoshiba, K., and Muramatsu, M.
(1992)
J. Biol. Chem.
267,
4327-4332
[Abstract/Free Full Text]
-
Glass, C. K.
(1994)
Endocr. Rev.
15,
391-407
[Abstract/Free Full Text]
-
Pascal, E., and Tjian, R.
(1991)
Genes & Dev.
5,
1646-1656
[Abstract/Free Full Text]
-
Smale, S., and Baltimore, D.
(1989)
Cell
57,
103-113
[CrossRef][Medline]
[Order article via Infotrieve]
©1997 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
B. L. Sartini, H. Wang, W. Wang, C. F. Millette, and D. L. Kilpatrick
Pre-Messenger RNA Cleavage Factor I (CFIm): Potential Role in Alternative Polyadenylation During Spermatogenesis
Biol Reprod,
March 1, 2008;
78(3):
472 - 482.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Tang, A. Kung, and E. Goldberg
Regulation of Murine Lactate Dehydrogenase C (Ldhc) Gene Expression
Biol Reprod,
March 1, 2008;
78(3):
455 - 461.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Hsia, J. P. Brousal, S. R. Hann, and G. A. Cornwall
Recapitulation of Germ Cell- and Pituitary-Specific Expression With 1.6 kb of the Cystatin-Related Epididymal Spermatogenic (Cres) Gene Promoter in Transgenic Mice
J Androl,
March 1, 2005;
26(2):
249 - 257.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Wang, R. E. Stock, R. M. Gronostajski, Y. W. Wong, M. Schachner, and D. L. Kilpatrick
A Role for Nuclear Factor I in the Intrinsic Control of Cerebellar Granule Neuron Gene Expression
J. Biol. Chem.,
December 17, 2004;
279(51):
53491 - 53497.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Wang, J. T. San Agustin, G. B. Witman, and D. L. Kilpatrick
Novel Role for a Sterol Response Element Binding Protein in Directing Spermatogenic Cell-Specific Gene Expression
Mol. Cell. Biol.,
December 15, 2004;
24(24):
10681 - 10688.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Han, W. Xie, S. H. Kim, L. Yue, and J. DeJong
A Short Core Promoter Drives Expression of the ALF Transcription Factor in Reproductive Tissues of Male and Female Mice
Biol Reprod,
September 1, 2004;
71(3):
933 - 941.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Wang, F. Liu, C. F. Millette, and D. L. Kilpatrick
Expression of a Novel, Sterol-Insensitive Form of Sterol Regulatory Element Binding Protein 2 (SREBP2) in Male Germ Cells Suggests Important Cell- and Stage-Specific Functions for SREBP Targets during Spermatogenesis
Mol. Cell. Biol.,
December 15, 2002;
22(24):
8478 - 8490.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Xie, S. Han, M. Khan, and J. DeJong
Regulation of ALF Gene Expression in Somatic and Male Germ Line Tissues Involves Partial and Site-specific Patterns of Methylation
J. Biol. Chem.,
May 10, 2002;
277(20):
17765 - 17774.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. P. Reddi, C. J. Flickinger, and J. C. Herr
Round Spermatid-Specific Transcription of the Mouse SP-10 Gene Is Mediated by a 294-Base Pair Proximal Promoter
Biol Reprod,
November 1, 1999;
61(5):
1256 - 1266.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
M. Charron, N. L. Shaper, B. Rajput, and J. H. Shaper
A Novel 14-Base-Pair Regulatory Element Is Essential for In Vivo Expression of Murine beta 4-Galactosyltransferase-I in Late Pachytene Spermatocytes and Round Spermatids
Mol. Cell. Biol.,
August 1, 1999;
19(8):
5823 - 5832.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Blaise, T. Guillaudeux, G. Tavernier, D. Daegelen, B. Evrard, A. Mairal, C. Holm, B. Jegou, and D. Langin
Testis Hormone-sensitive Lipase Expression in Spermatids Is Governed by a Short Promoter in Transgenic Mice
J. Biol. Chem.,
February 9, 2001;
276(7):
5109 - 5115.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1997 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|