![]()
|
|
||||||||
Vol. 273, Issue 1, 302-308, January 2, 1998
From the Activated hepatic stellate cells (HSC)
participate in matrix remodeling and deposition in liver fibrosis. The
present study demonstrates that interleukin (IL)-10 is expressed by HSC
upon activation in vitro or in vivo and that
autocrine effects of this cytokine include inhibition of collagen
production. Culture activation of HSC caused a distinct increase in
IL-10 mRNA level compared with freshly isolated quiescent HSC.
Treatment of cultured HSC with tumor necrosis factor- Hepatic stellate cells
(HSC)1 are vitamin A-storing
perisinusoidal cells in the liver. These cells participate in matrix
remodeling and wound healing of the liver via their myofibroblastic
activation (see Ref. 1 for review). Several plausible mechanisms have been proposed which underlie HSC activation (1). One such mechanism involves soluble factors such as cytokines and inflammatory mediators, which seem to induce different aspects of the cellular activation. Fox
example, platelet-derived growth factor, IL-1, TNF- IL-10 is a cross-regulatory cytokine produced by Th2 cells,
macrophages, mast cells, and B cells. It mediates several key functions
of multiple cell types. IL-10 inhibits functions of Th1 cells and their
expression of IL-2 and In this report, we demonstrate for the first time, induced expression
of IL-10 by rat HSC upon activation in vitro by culturing on
plastic dish and in vivo by cholestatic liver injury. IL-10 expression by HSC is up-regulated by TNF- Cholestatic Liver Injury--
Cholestatic liver injury was
induced in male Wistar rats weighing 500-600 g by aseptic ligation and
transection of the common bile duct (BDL) as described previously (30).
Another group of the rats was sham-operated to serve as controls
(Sham). The animal protocol described in this study was approved by the
Institutional Care and Use Committee of the University of Southern
California.
HSC Isolation and Culture--
HSC were isolated from normal
male Wistar rats, BDL, and Sham animals by in situ digestion
of the liver and arabinogalactan gradient ultracentrifugation as
reported previously (31, 32). The purity and the viability of the cells
from all animals exceeded 98 and 97%, respectively. The cells from
normal rats were cultured in RPMI with 10% fetal calf serum in 24-well
plates for 5-6 days after isolation. For experiments testing effects
of TNF- RNA Extraction, RT-PCR--
Total RNA was extracted from freshly
isolated and cultured cells by a method of Chomczynski and Sacchi (33).
For RT-PCR, total RNA was reverse-transcribed using 600 units of
Moloney murine leukemia virus reverse transcriptase and oligo(dT) at
37 °C for 60 min. The synthesized cDNA for IL-10, interstitial
collagenase, IL-10 cDNA Fragment Subcloning and Sequencing--
The
475-bp IL-10 cDNA fragment generated by PCR was isolated from 1.5%
agarose gel with an elution buffer (0.5 M ammonium acetate,
10 mM magnesium acetate, 1 mM EDTA, 0.1% SDS,
pH 8.0). The eluted cDNA was ligated into a PCRTM vector from a TA
cloning kit (Invitrogen Corp., San Diego, CA). After a large scale
plasmid preparation, the sequence of the cDNA was determined by the
chain termination method (U. S. Biochemical Corp.). A partial
EcoRI fragment (326 bp) of the cDNA insert was purified
from agarose gel as described above and used as a probe for Northern
blot hybridization.
Northern Blot Analysis--
For Northern blot analysis for
IL-10, 10 µg of total RNA was electrophoresed in 1% agarose gel
containing formaldehyde and transferred to nylon filter (Micron
Separations, Westboro, MA) as described (31). The 326-bp IL-10 cDNA
fragment was labeled with [ Enzyme-linked Immunosorbent Assay and Western Blot
Analysis--
For determination of the IL-10 concentration in the HSC
culture medium, the media from three wells were combined, dialyzed, lyophilized, and analyzed for IL-10 using a mouse IL-10 enzyme-linked immunosorbent assay kit (QuantikineTM, R & D Systems). To detect IL-10
in HSC, Western blot analysis was performed. Freshly isolated HSC were
subjected to protein extraction using a 2 × lysis buffer (100 mM Tris-HCl, pH 6.8, 4% SDS, 20% glycerol, and 2%
Collagen Synthesis Assay--
To examine whether neutralization
of IL-10 produced by HSC affects collagen production, the cultured
cells were incubated for 48 h with serum-free RPMI with ascorbic
acid (50 µg/ml) and Transfection and Reporter Gene Assays--
To examine whether
IL-10 has any effects on collagen gene promoter activity, cultured HSC
after the first passage were transiently co-transfected with a collagen
reporter gene plasmid (pGLCO2 or pGLCO3) (38) and a murine
sense or antisense IL-10 expression vector (39), which was kindly
provided by Dr. Lili Feng at the Scripps Research Institute. The
collagen reporter gene, pGLCO2, contains 2200 bp of the
murine Statistical Analysis--
All data are expressed as means ± S.E. The significance for the difference between the groups was
assessed using standard t test. For quantification of
competitive RT-PCR data, a linear regression analysis was performed
between the concentration of the competitive template used in the assay
and the ratio of densitometric results for the competitor product over
than of the target gene product.
IL-10 RT-PCR for Cultured HSC--
RT-PCR analysis of RNA from
freshly isolated HSC from normal rats showed no detectable product for
IL-10 using 35 cycles of amplification (first lane, Fig.
1 (upper panel)). However, HSC cultured on plastic wells for 7 days showed an increase in IL-10 mRNA as indicated by a detectable PCR product (second
lane, Fig. 1 (upper panel)). Furthermore, incubation of
HSC with TNF-
Expression of Interleukin-10 by in Vitro and in
Vivo Activated Hepatic Stellate Cells*
,
,
¶
Division of Gastrointestinal and Liver
Diseases, University of Southern California School of Medicine and
Department of Veterans Affairs Outpatient Clinic, Los Angeles,
California 90033 and the § Gastrointestinal Research
Laboratory, University of North Carolina, Chapel Hill, North Carolina
27599-7038
![]()
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
, transforming
growth factor-
, or lipopolysaccharide further increased IL-10
mRNA by 2-fold and resulted in the release of IL-10 protein into
the medium. HSC isolated from rats after bile duct ligation (BDL)
showed prominent increases in IL-10 mRNA (× 100) and protein (× 30) levels at 7 days after BDL, but such induction disappeared in
advanced liver fibrosis (19 days after BDL). IL-10 expression
correlated positively with mRNA expression of interstitial
collagenase and inversely with that of
1(I) collagen. Addition of
anti-IL-10 IgG to cultured HSC caused enhanced collagen production
under a basal or stimulated condition with TGF-
, tumor necrosis
factor-
, or lipopolysaccharide. These effects were associated with
increased
1(I) collagen mRNA and reciprocally reduced
collagenase mRNA levels. Co-transfection of HSC with an IL-10
expression vector and collagen reporter genes showed a 40% inhibition
of
1(I) collagen promoter activity. These results demonstrate that
activation of HSC causes enhanced autocrine expression of IL-10 which
possesses a negative autoregulatory effect on HSC collagen production
mediated at least in part by
1(I) collagen transcriptional
inhibition and stimulation of collagenase expression. These findings,
along with the demonstrated early induction of HSC IL-10 expression and
its late disappearance during biliary liver fibrosis, suggest its
in vivo role in matrix remodeling and a possibility that
failure for HSC to sustain IL-10 expression underlies pathologic
progression to liver cirrhosis.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
, TGF-
are all
mitogenic to HSC (2, 3), while TGF-
is a potent fibrogenic cytokine
that not only induces expression of matrix genes (3-5) and tissue
inhibitors of metalloprotease (TIMP) (6), but may also confer HSC a
myofibroblastic phenotype by up-regulating
-smooth muscle actin
expression (7, 8). These soluble factors are released by effector cells
such as hepatic macrophages (9-11), endothelial cells (12),
hepatocytes (13), or platelets (14) to establish a paracrine mode of
action or produced by HSC to achieve autocrine effects (15). It also
seems important to recognize that one of the primary activities of many
of these cytokines resides in their modulation of inflammation and
immune responses. As integral part of wound repair processes,
monocytes, fibroblasts, and myofibroblasts are recruited to the injury
site by platelet-derived growth factor (16) and TGF-
(17). HSC are
shown to express MCP-1 (18), which chemoattracts monocytes; M-CSF (19),
which induces proliferation and differentiation of monocytes; PAF (20) and CINC (21), which recruit neutrophils; and ICAM (22), which causes
adhesion and transmigration of neutrophils. Thus, HSC may also actively
participate in regulation of inflammation in the liver.
-interferon (23), suppresses macrophages,
including antigen presentation to Th1 cells, cytokine production, and
cytotoxic activities (24, 25). In contrast, IL-10 stimulates mast cells
(26) and B cells (27). In addition, IL-10 has been shown recently to
down-regulate type I collagen gene expression and to increase matrix
metalloprotease-1 (interstitial collagenase) and matrix
metalloprotease-3 (stromelysin-1) (MMP-1 and -3) expression in cultured
skin fibroblasts, suggesting a role of IL-10 in the breakdown and
remodeling of the extracellular matrix (28). In contrast, exogenous
IL-10 inhibits synthesis of MMP-9 (92-kDa gelatinase) and blocks
LPS-stimulated MMP-1 expression by human macrophages while it
stimulates their TIMP-1 production (29). Thus, these findings suggest
fibrogenic effects of IL-10 on macrophages, which seem to oppose the
aforementioned effects on fibroblasts.
and TGF-
1 in
vitro and induced conspicuously during the early phase of
cholestatic injury followed by a disappearance of the induction at the
late fibrogenic phase. In vitro neutralization experiments
demonstrate autocrine stimulation of interstitial collagenase
expression and inhibition of
1(I) collagen expression by IL-10 in
HSC, suggesting its role in initiation of matrix remodeling.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
(0.1-10 ng/ml), TGF-
(0.1-10 ng/ml), LPS (1-100
µg/ml), and anti-IL-10 IgG (20 µg/ml), the cells were washed with
phosphate-buffered saline twice and incubated with serum-free RPMI and
test substances for 42 h. TNF-
, TGF-
, and goat anti-mouse
IL-10 IgG were purchased from R & D System (Minneapolis, MN), and LPS
and non-immune goat IgG were from Sigma.
1(I) collagen, and
-actin were amplified using
specific sets of primers designed from published cDNA sequences
(34-36) as follow: IL-10, CTGGCTCAGCACTGCTAT and ATTCATGGCCTTGTAGACAC;
rat interstitial collagenase, CGAACACTCAAATGGTCCCA and
TCCACATGGTTGGGAAGTTC; collagen
1(I), ACAGCACGCTTGTGGAT and
GTCTTCAAGCAAGAGGACCA;
-actin, GAGCTATGAGCTGCCTGACG and
AGCACTTGCGGTCCACGATG. A competitive template containing the specific
primer sequences for IL-10 was constructed using a PCR MIMICTM
(CLONTECH). For competitive PCR, sample cDNA
was amplified in the presence of the increasing amount of the
competitor (5 × 10
21 to 1.6 × 10
19 mol). The mRNA quantity was assessed by
calculating the amount of the competitor added to achieve an equimolar
amount of the PCR products of the competitor and IL-10.
-32P]dCTP using a random
primer labeling kit (Life Technologies, Inc.). Prehybridization,
hybridization, washing, and autoradiography were performed as described
previously (31). Equivalent RNA loading was confirmed by
rehybridization of the filter for 18 S rRNA.
-mercaptoethanol). Samples (100 µg of protein per each sample)
were separated by 8% polyacrylamide gel electrophoresis using reducing
conditions and transferred to nitrocellulose filters (Bio-Rad). The
filters were first treated with 10% non-fat milk in 20 mM
Tris base, pH 7.6, 137 mM NaCl, and 0.1% Tween 20 (TBST)
and incubated with goat polyclonal anti-mouse IL-10 antibodies (R & D
Systems) at 1:300 dilution in TBST with 1% bovine serum albumin,
followed by incubation with rabbit anti-goat IgG antibodies (1:2000)
conjugated with horseradish peroxidase. The immobilized IL-10-antibody
complex was detected by chemiluminescence using ECL kit (Amersham
Corp.).
-aminopropionitrile fumarate (50 µg/ml) in
the presence of anti-IL-10 IgG or nonimmune IgG (20 µg/ml) and
incubated with [2,3,4,5-3H]proline (10 µCi/ml) for the
last 18 h to radiolabel newly synthesized collagen (3). The cell
and media proteins were precipitated with 10% trichloroacetic acid.
Collagen production was determined by a collagenase digestion method
(37).
1(I) collagen gene 5
-flanking region linked to the
luciferase reporter gene, while pGLCOL3 contains 220 bp of
1(I)
collagen gene 5
-flanking region. Liposomes were prepared using 3 µg
of a reporter gene plasmid and 5 µg of the expression vector along
with 32 µl of LipofectAMINE reagent (Life Technologies, Inc.). The
cells were incubated with the liposomes for 8 h, the liposome
mixture removed, and fresh medium containing 10% fetal calf serum
added. The cells were incubated for additional 36 h, washed with
phosphate-buffered saline, and lysed for luciferase assay as described
previously (38).
![]()
RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
or TGF-
, cytokines known to stimulate HSC (3),
caused further increases in IL-10 mRNA (lane 3-8, Fig.
1 (upper panel)). Semiquantitative analyses of the RT-PCR
results were performed by scanning densitometry of the IL-10 PCR
product and standardization with
-actin results (Fig. 1, lower
panel). These analyses show 2-fold increases in IL-10 mRNA
expression by TGF-
(10 ng/ml) or TNF-
(10 ng/ml) and a 50%
increase by LPS (10 µg/ml).

View larger version (45K):
[in a new window]
Fig. 1.
Upper panel, IL-10 mRNA expression
by culture activated HSC. IL-10 mRNA expression in HSC was assessed
by RT-PCR. Freshly isolated HSC show very low levels of IL-10
(first lane), whereas culture-activated HSC grown in plastic
dish for 6 days expressed appreciably more IL-10 mRNA (second
lane). Treatment of cultured HSC with TNF-
and TGF-
further
increased IL-10 mRNA levels (third to eighth
lanes). Lower panel, densitometric analysis of IL-10 mRNA expression by cultured HSC. Densitometric RT-PCR data for IL-10 mRNA were standardized with
-actin signals and
statistically compared between different treatment groups. Treatment of
cultured HSC with TNF-
(10 ng/ml) and TGF-
(10 ng/ml) resulted in
significant 2-fold increases in IL-10 mRNA expression, while LPS
(10 µg/ml) caused a 40% increase. *, p < 0.05 as
compared with control.
IL-10 Release by Cultured HSC--
To assess the levels of IL-10
released by cultured HSC following treatment with several agonists, and
enzyme-linked immunosorbent assay was performed on the medium samples
(Table I). No detectable IL-10 was
measured in the medium from untreated HSC. However, TNF-
, TGF-
,
and LPS all stimulated IL-10 release by HSC.
|
HSC IL-10 mRNA Expression in Cholestatic Liver Injury-- To determine whether IL-10 is expressed by HSC during the course of cholestatic liver injury, HSC were isolated from rats at 2, 7, and 19 days after bile duct ligation or sham operation, and RT-PCR was performed on HSC RNA samples for detection of IL-10 mRNA (Fig. 2). Sham HSC show undetectable or minimal IL-10 mRNA levels at each time point. In contrast, HSC from BDL show a distinct increase in IL-10 mRNA at 2 days, which was further accentuated at 7 days. Interestingly, this induction of IL-10 mRNA expression was completely abrogated at 19 days. To quantitatively assess the induction at 7 days, competitive PCR was performed using a specifically constructed competitive template. As shown in the upper panel of Fig. 3A, addition of an increasing amount of the competitor (from right to left) resulted in a progressive reduction in the level of IL-10 PCR product from the Sham sample while reciprocally raising the level of the competitor product. For the BDL samples, which are expected to have much lower levels, 40 cycles of amplification was used. Even though the level of IL-10 product was still lower, the similarly effective competition by the competitor was shown but with the amounts of the competitor that were approximately 2 orders of magnitude lower than those used for Sham. Linear regression analysis was performed for three pairs of competitive PCR data (Fig. 3B). As predicted, the level of IL-10 mRNA in 7-day BDL HSC was 100-fold higher than that in Sham HSC.
|
|
Subcloning and Sequencing of IL-10 PCR Product-- To verify that the PCR product detected was truly a IL-10 cDNA fragment, we subcloned the product into a TA vector and sequenced a partial EcoRI fragment (326 bp) following a large scale plasmid preparation and cDNA purification. The sequence of the fragment showed a perfect match with the published nucleotide sequence of rat IL-10 cDNA (34), demonstrating that our PCR indeed detected IL-10 mRNA in HSC. Furthermore, we have utilized the purified 326-bp IL-10 cDNA fragment as a probe to perform Northern blot analysis on HSC RNA samples. Northern blot analysis clearly confirmed prominent induction of IL-10 mRNA expression in HSC from 7-day BDL as compared with corresponding Sham (Fig. 4).
|
Detection of IL-10 Protein in Activated HSC-- Western blot analysis was performed to examine whether IL-10 protein level is coordinately increased in HSC from 7-day BDL (Fig. 5). The analysis detected an immunoreactive band with a distinct increased intensity in BDL (last two lanes), which corresponded to the molecular size (17 kDa) of authentic recombinant mouse IL-10 standard (first lane). As an internal control, desmin was immunoblotted using the same samples, which showed the relatively similar immunoreactivity between the two groups of the samples (bottom panel).
|
Relationship of IL-10 Expression to Collagen or Collagenase
Expression in BDL--
We were very intrigued by the
time-dependent induction of IL-10 in HSC at 7 days in BDL
animals. Since recent studies suggested regulation of collagen and
collagenase genes by IL-10 in other cell types (28, 29), we examined
1(I) collagen and interstitial collagenase mRNA expression in
the same HSC RNA samples used for IL-10 RT-PCR analysis (Fig. 2,
lower two panels). Induction of interstitial collagenase
mRNA expression was shown to coincide with that of IL-10 at 7 days
as was the disappearance of induction of both genes at 19 days. On the
contrary, marked induction of
1(I) collagen expression occurred when
IL-10 expression ceased at 19 days.
IL-10 Neutralization Enhances HSC Collagen Production--
The
above results suggested a possible link between IL-10 expression by
activated HSC and matrix homeostasis. To examine this possibility,
collagen production was assessed by incorporation of
[3H]proline with cultured HSC exposed to TGF-
(10 ng/ml), TNF-
(10 ng/ml), and LPS (10 µg/ml) in the presence of
anti-IL-10 IgG or nonimmune IgG (Fig. 6).
The addition of anti-IL-10 IgG alone caused a 50% increase in basal
collagen production. TGF-
-mediated stimulation of collagen
production was doubled by the addition of the antibodies. Even though
TNF-
or LPS alone did not increase collagen production, concomitant
IL-10 neutralization resulted in significant enhancements in collagen
synthesis. These results clearly demonstrate an inhibitory autocrine
effect of IL-10 on collagen synthesis by culture-activated HSC.
|
IL-10 Neutralization Affects
1(I) Collagen and Collagenase
mRNA Expression--
To investigate mechanisms underlying the
observed inhibitory role of IL-10 in HSC collagen production, we have
examined effects of IL-10 neutralization on mRNA expression of
1(I) collagen and interstitial collagenase by cultured HSC. Exposure
of HSC to TNF-
(10 ng/ml) or LPS (10 µg/ml) stimulated mRNA
expression of collagenase (Fig. 7,
upper left panel). However, addition of anti-IL-10 IgG clearly suppressed these stimulatory effects (Fig. 7, upper right panel). TGF-
(10 ng/ml) stimulated
1(I) collagen mRNA
expression in cultured HSC and LPS marginally showed the effect (Fig.
7, upper panel). Addition of anti-IL-10 antibodies further
promoted the increases in
1(I) collagen mRNA levels in TGF-
-
or LPS-stimulated HSC (Fig. 7, upper panel). Densitometric
data from at least three sets of experiments were standardized with
-actin results and statistically compared between the different
treatments (Fig. 7, lower panel). Addition of anti-IL-10
antibodies slightly, but significantly, reduced basal interstitial
collagenase mRNA expression. Furthermore, it suppressed an increase
in interstitial collagenase mRNA levels induced by TNF-
and LPS
(Fig. 7, lower left panel). On the contrary, IL-10
neutralization significantly enhanced by 2-fold the increase in
1(I)
collagen mRNA expression by HSC exposed to TGF-
and LPS (Fig. 7,
lower right panel). These results suggested that IL-10
secreted by culture-activated HSC not only induces basal expression of
collagenase but also mediates up-regulation of collagenase expression
caused by TNF-
and LPS. At the same time, IL-10 expression induced
by TGF-
and LPS appears to exert an inhibitory effect on
1(I)
collagen expression.
|
IL-10 Suppresses COLL Promoter Activity--
To examine whether
the observed inhibitory effect of IL-10 on collagen expression is
mediated via its effect at transcriptional level, transient
co-transfections were performed using an IL-10 expression vector (sense
or antisense) with an
1(I) collagen promoter-luciferase construct
(pGLCO2 or pGLCO3). As compared with transfection with the antisense
IL-10 expression vector, collagen promoter activity was inhibited 40%
with the sense IL-10 expression vector (Fig.
8). This suggests that IL-10's negative autoregulatory effects on HSC collagen expression is mediated at least
in part via its transcriptonal inhibition of collagen gene.
|
| |
DISCUSSION |
|---|
|
|
|---|
The present study is the first to demonstrate that HSC express
IL-10 upon their activation in vivo and in vitro.
HSC are considered as pericytes in the liver (40), which are also known
to serve as principal cells to participate in liver fibrogenesis via
their myofibroblastic activation (1). A recent report demonstrated expression of IL-10 by mesangial cells, the pericytes in the
glomerulus, which are incriminated as the major source of
fibroproliferative responses in glomerulonephritis (41). Since HSC and
mesangial cells are considered analogous due to their similar
functionality and pathophysiologic roles, we hypothesized that HSC may
express IL-10. Our results demonstrate IL-10 is expressed by HSC upon activation in culture and during the early stage of biliary liver injury. Our RT-PCR specificity was verified by sequencing of the IL-10
PCR product, with which we further confirmed induced mRNA expression via Northern blot analysis. Western blot analysis of HSC
protein extracts revealed a prominently expressed 17-kDa IL-10 protein
at 7 days after BDL, and the cultured HSC were shown to express and
release IL-10 in response to TNF-
, TGF-
, and LPS.
Our previous work showed enhanced expression of TNF-
by hepatic
macrophages at 1 and 2 weeks after BDL but an almost complete disappearance of such induction at 3 weeks (42). Since our in vitro experiment demonstrates induction of IL-10 in HSC by
TNF-
, it may be assumed that macrophage-derived TNF-
in the liver
might have induced IL-10 expression by HSC in the
time-dependent manner in the BDL model. However, the
concomitant induction (7 days) and repression (19 days) of macrophage
TNF-
and HSC IL-10 expression in this in vivo model also
suggest IL-10 derived from HSC may not function as an anti-inflammatory
cytokine toward hepatic macrophages. This assumption led us to think of
other biological significance that HSC-derived IL-10 may possesses in
the liver. To this end, we were intrigued by recent studies that showed
IL-10-mediated regulation of the genes involved in matrix remodeling
and homeostasis such as MMP-1, MMP-3, MMP-9, TIMP-1, and
1(I)
collagen in skin fibroblasts (28) and macrophages (29). Indeed, our
culture study clearly demonstrates IL-10 released by HSC suppresses
their collagen production and this effect is mediated at least in part by transcriptional inhibition of collagen gene and enhanced expression of interstitial collagenase. These findings suggest a negative autoregulatory role of IL-10 in HSC collagen production in matrix remodeling. In support of this view, our in vivo data
reveals concomitant induction of IL-10 and interstitial collagenase in HSC during the early stage of cholestatic liver fibrosis (7 days after
BDL) and the lack of HSC IL-10 expression in association with marked
1(I) collagen induction in advanced liver fibrosis at 19 days. This
raises an intriguing secondary hypothesis that the failure of HSC to
continue their expression of IL-10 may underlie progressive
fibrogenesis leading to liver cirrhosis.
Interplay between soluble factors of paracrine and autocrine sources is
complex in regulation of HSC biology. Among several cytokines
implicated in activation of HSC, TGF-
is considered a potent
fibrogenic cytokine that seems capable of conferring HSC most aspects
of cellular activation (3-8). This cytokine can be released by hepatic
macrophages (9) or HSC by themselves (15), and the paracrine and
autocrine interaction can be established via its ability to autoinduce
its expression (15). In our in vitro study, TGF-
induced
IL-10 in cultured HSC. However, IL-10 induction was abolished in HSC at
19 days after BDL despite HSC (43) and hepatic
macrophages2 continue to
express TGF-
1 at this time point in this model. Thus, unlike the
close in vivo association between IL-10 and TNF-
expression in the BDL model, this dissociation of IL-10 and TGF-
expression suggests complex regulation of IL-10 expression by TGF-
.
Another discrepancy noted in the present study was the continued
induction of IL-10 expression by culture-activated HSC as compared with
the time-dependent induction seen in vivo. This obviously suggests cellular or molecular differences in in
vitro and in vivo activated HSC or reflects the absence
of other in vivo factors that may cause the
time-dependent expression in the culture system. It is
attractive to speculate that these factors may be derived from other
cell types in the liver including hepatic macrophages. Additional
studies are obviously needed to test this hypothesis.
| |
FOOTNOTES |
|---|
* This work was supported by National Institutes of Health Grants AA06603 (to H. T.) and AA10459 (to R. A. R.) and by the Medical Research Service of Department of Veterans Affairs (to H. T.) and USC Research Center for Liver Disease Molecular Biology Core Facility Grant P30-DK-48522.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
¶ To whom all correspondence and reprint requests should be addressed: Division of GI and Liver Diseases, USC School of Medicine, 2011 Zonal Ave., HMR-101, Los Angeles, CA 90033-4581. Tel.: 213-342-5107; Fax: 213-342-5425; E-mail: htsukamo{at}hsc.usc.edu.
1 The abbreviations used are: HSC, hepatic stellate cells; IL, interleukin; TNF, tumor necrosis factor; TGF, transforming growth factor; TIMP, tissue inhibitors of metalloprotease; MMP, matrix metalloprotease; LPS, lipopolysaccharide; BDL, bile duct ligation; RT-PCR, reverse transcription-polymerase chain reaction; bp, base pair(s).
2 S. C. Wang, M. Ohata, M. Lin, and H. Tsukamoto, unpublished observation.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
S. L. Friedman Hepatic Stellate Cells: Protean, Multifunctional, and Enigmatic Cells of the Liver Physiol Rev, January 1, 2008; 88(1): 125 - 172. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Safadi, E. Zigmond, O. Pappo, Z. Shalev, and Y. Ilan Amelioration of hepatic fibrosis via beta-glucosylceramide-mediated immune modulation is associated with altered CD8 and NKT lymphocyte distribution Int. Immunol., August 13, 2007; (2007) dxm069v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Rachmawati, C. Reker-Smit, M. N. Lub-de Hooge, A. van Loenen-Weemaes, K. Poelstra, and L. Beljaars Chemical Modification of Interleukin-10 with Mannose 6-Phosphate Groups Yields a Liver-Selective Cytokine Drug Metab. Dispos., May 1, 2007; 35(5): 814 - 821. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Horani, N. Muhanna, O. Pappo, A. Melhem, C. E. Alvarez, S. Doron, W. Wehbi, K. Dimitrios, S. L. Friedman, and R. Safadi Beneficial effect of glatiramer acetate (Copaxone) on immune modulation of experimental hepatic fibrosis Am J Physiol Gastrointest Liver Physiol, February 1, 2007; 292(2): G628 - G638. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. STICKEL and C. H. OSTERREICHER THE ROLE OF GENETIC POLYMORPHISMS IN ALCOHOLIC LIVER DISEASE Alcohol Alcohol., May 1, 2006; 41(3): 209 - 224. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Sparmann, C. Hohenadl, J. Tornoe, R. Jaster, B. Fitzner, D. Koczan, H.-J. Thiesen, A. Glass, D. Winder, S. Liebe, et al. Generation and characterization of immortalized rat pancreatic stellate cells Am J Physiol Gastrointest Liver Physiol, July 1, 2004; 287(1): G211 - G219. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yokoyama, W. C. Kitchens, B. Toth, M. G. Schwacha, L. W. Rue III, K. I. Bland, and I. H. Chaudry Role of IL-10 in regulating proinflammatory cytokine release by Kupffer cells following trauma-hemorrhage Am J Physiol Gastrointest Liver Physiol, June 1, 2004; 286(6): G942 - G946. [Abstract] [Full Text] [PDF] |
||||
![]() |
N Ohnishi, T Miyata, H Ohnishi, H Yasuda, K Tamada, N Ueda, H Mashima, and K Sugano Activin A is an autocrine activator of rat pancreatic stellate cells: potential therapeutic role of follistatin for pancreatic fibrosis Gut, October 1, 2003; 52(10): 1487 - 1493. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P Iredale Cirrhosis: new research provides a basis for rational and targeted treatments BMJ, July 17, 2003; 327(7407): 143 - 147. [Full Text] [PDF] |
||||
![]() |
Z. Song, S. Barve, T. Chen, W. Nelson, S. Uriarte, D. Hill, and C. McClain S-adenosylmethionine (AdoMet) modulates endotoxin stimulated interleukin-10 production in monocytes Am J Physiol Gastrointest Liver Physiol, June 1, 2003; 284(6): G949 - G955. [Abstract] [Full Text] [PDF] |
||||
![]() |
|