Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kallal, L.
Right arrow Articles by Benovic, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kallal, L.
Right arrow Articles by Benovic, J. L.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Vol. 273, Issue 1, 322-328, January 2, 1998

Visualization of Agonist-induced Sequestration and Down-regulation of a Green Fluorescent Protein-tagged beta 2-Adrenergic Receptor*

Lorena Kallal, Alison W. Gagnon, Raymond B. Penn, and Jeffrey L. BenovicDagger

From the Department of Microbiology and Immunology, Kimmel Cancer Institute, Thomas Jefferson University, Philadelphia, Pennsylvania 19107

    ABSTRACT
Top
Abstract
Introduction
Procedures
Results & Discussion
References

To date, the visualization of beta 2-adrenergic receptor (beta 2AR) trafficking has been largely limited to immunocytochemical analyses of acute internalization events of epitope-tagged receptors in various transfection systems. The development of a beta 2AR conjugated with green fluorescent protein (beta 2AR-GFP) provides the opportunity for a more extensive optical analysis of beta 2AR sequestration, down-regulation, and recycling in cells. Here we demonstrate that stable expression of beta 2AR-GFP in HeLa cells enables a detailed temporal and spatial analysis of these events. Time-dependent colocalization of beta 2AR-GFP with rhodamine-labeled transferrin and rhodamine-labeled dextran following agonist exposure demonstrates receptor distribution to early endosomes (sequestration) and lysosomes (down-regulation), respectively. The observed temporal distribution of beta 2AR-GFP was consistent with measures of receptor sequestration and down-regulation generated by radioligand-receptor binding assays. Cells stimulated with different beta -agonists revealed time courses of beta 2AR-GFP redistribution reflective of the intrinsic activity of each agonist.

    INTRODUCTION
Top
Abstract
Introduction
Procedures
Results & Discussion
References

Upon agonist stimulation, beta 2-adrenergic receptors (beta 2ARs)1 are rapidly desensitized by receptor phosphorylation (1). Receptor phosphorylation by G protein-coupled receptor kinases and subsequent binding of non-visual arrestins initiates the internalization of beta 2ARs via clathrin-coated pits (2, 3). Previous studies have demonstrated that internalized receptors have multiple potential fates. One such fate is the recycling of internalized receptors to the plasma membrane, presumably completing an ill defined "resensitization " process involving beta 2AR dephosphorylation in an endosomal compartment (4, 5). Depending upon the duration of agonist exposure, internalized beta 2ARs may ultimately appear "lost" or destroyed (undetectable by radioligand binding), ostensibly trafficking to lysosomes where they are degraded. Previously, the analysis of these events has been heavily dependent on biochemical and pharmacological approaches.

Agonist-mediated subcellular redistribution of beta 2ARs was initially inferred from ligand binding studies (6, 7) and the coincident migration of beta 2ARs with enzyme markers (8, 9) or epidermal growth factor (10, 11) into subcellular fractions resolved through centrifugation. However, direct visualization of beta 2AR trafficking events remained lacking until von Zastrow and Kobilka (12) provided immunocytochemical evidence of rapid, agonist-induced redistribution of epitope-tagged beta 2ARs into small, punctate accumulations within the cytoplasm. The time course of beta 2AR redistribution assessed by confocal microscopy paralleled that of beta 2AR sequestration measured by radioligand binding. Importantly, internalized beta 2ARs colocalized with transferrin receptors, suggesting that sequestered beta 2ARs undergo processing through endosomal compartments in a manner similar to that observed for constitutively internalized receptors.

Advances in the development of proteins conjugated with green fluorescent protein (GFP) have since provided the opportunity for real time optical analysis of protein trafficking events in individual cells (13-15). Green fluorescent protein is a naturally occurring protein isolated from several different species of jellyfish (Aequoria) and sea cucumbers (Renilla). When expressed in cells, proteins conjugated with GFP may be visualized with routine fluorescent microscopy without the need to fix cells. Recently, Barak et al. (16) established the utility of a beta 2AR-GFP fusion protein in visualizing agonist-mediated beta 2AR internalization in HEK293 cells transiently expressing the construct. This study also demonstrated that beta 2AR-GFP is fully functional with regard to ligand binding and adenylyl cyclase stimulation and that it can undergo agonist-dependent phosphorylation and sequestration. Here we demonstrate that stable expression of beta 2AR-GFP in HeLa cells enables a detailed temporal and spatial analysis of beta 2AR trafficking events associated with receptor sequestration, down-regulation, and recycling. Colocalization of the beta 2AR-GFP with rhodamine-labeled transferrin and rhodamine-labeled dextran during agonist treatment revealed sequential localization of receptor in cellular compartments containing these compounds. Moreover, this system appears capable of distinguishing the differing effects of various beta -agonists (including the highly hydrophobic ligand salmeterol) on beta 2AR trafficking, overcoming some of the limitations in previous analyses of these compounds.

    EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results & Discussion
References

Construction of a beta 2AR-GFP Fusion Expression Construct-- To create a Flag-tagged beta 2AR-GFP fusion protein, PCR was used to amplify both the beta 2AR and Aequoria victoria GFP-S65T. An amino-terminal beta 2AR primer, TGCGCGCCATGGGGCAAC, was combined with a primer designed against the carboxyl terminus, GCTCTAGACAGCAGTGAGTCATTTGT, in which the stop codon is replaced by an XbaI site that encodes two extra amino acids, serine and arginine. Similarly, primers were designed to amplify GFP from the phGFP-S65T template (CLONTECH) with an XbaI site at the NH2 terminus, GCTCTAGAATGGTGAGCAAGGGCGAG, and a SalI site at the COOH terminus, AAGCTTGTCGACTTACTTGTACAGCTCGTC. The two PCR products were cut with NcoI/XbaI for the beta 2AR or XbaI/SalI for the GFP and subcloned into NcoI/SalI digested pBCflagbeta 2AR (provided by B. Kobilka). An NcoI/NcoI fragment of the pBC backbone was recloned in, and to circumvent sequencing the entire open reading frame of the beta 2AR, an NcoI/EcoRV region was replaced with that portion of the original pBCflagbeta 2AR construct. The final ligated product was sequenced through the regions that were generated by PCR. This construct was further modified by exchanging a small HindIII/NcoI fragment containing the region encoding the flag epitope with an identical fragment generated by PCR that contains a Kozak consensus sequence for translation initiation (ACCATGG). For the present studies, the region encoding the entire Flag-tagged beta 2AR-GFP fusion was removed with HindIII/SalI and cloned into the BamHI site of pcDNA3 (Invitrogen) using BamHI linkers. This final construct, pcDNA3-beta 2AR-GFP, was used in transient transfections and for making the stable HeLa cell line. A Flag-tagged beta 2AR construct in pcDNA3 was created by digesting pBCflagbeta 2AR with SalI followed by Klenow to blunt the 3' end. The insert was excised with HindIII and the ~2-kilobase fragment was ligated into HindIII/EcoRV digested pcDNA3.

Transient and Stable Transfection of HeLa Cells-- HeLa cells were maintained in Dulbecco's modified Eagle's medium (Life Technologies, Inc.) supplemented with 10-15% fetal bovine serum, 100 units/ml penicillin G, and 100 µg/ml streptomycin sulfate at 37 °C in a humidified atmosphere of 95% air/5% CO2. Cells grown to 80-90% confluence were transfected with 10 µg of pcDNA3-beta 2AR-GFP using 65 µl of LipofectAMINE reagent (Life Technologies, Inc.) per T75 flask, according to the manufacturer's instructions. Briefly, HeLa cells were incubated with a DNA/LipofectAMINE mixture for 3-4 h, the media were replaced, and the cells were analyzed 48 h after transfection. For stable transfections, 10 µg of PvuI linearized pcDNA3-beta 2AR-GFP was used to transfect HeLa cells. Three days after transfection, cells were trypsinized, diluted, and replated in media supplemented with 1 mg/ml Geneticin (Life Technologies, Inc.). Media were subsequently replaced every 3 days with complete media containing 0.5 mg/ml Geneticin. Stable transformants were isolated approximately 2 weeks after transfection, and clonal expression was confirmed by examining cells grown on coverslips by fluorescent microscopy.

cAMP Assays-- cAMP assays were performed using CHW cells (provided by R. Lefkowitz), a hamster fibroblast line that does not express endogenous beta 2ARs. CHW cells were transfected using a modification of an adenovirus-assisted transfection procedure (17). Briefly, harvested cells in Dulbecco's modified Eagle's medium containing 2% fetal bovine serum were mixed with 40 µg/ml DEAE-dextran, 100 µl of replication-defective adenovirus (GPT-Ad5; a gift from P. Garcia), and 2 µg of plasmid DNA. Transfected cells were passaged the next day onto 12-well plates, and experiments examining agonist-mediated cAMP production were performed 5 days after transfection. Cells were washed with phosphate-buffered saline (PBS) and stimulated at 37 °C for 10 min with 500 µl of PBS containing 300 µM ascorbic acid, 1 mM isobutylmethylxanthine, and no addition (basal), 10-11-10-4 M (-)-isoproterenol, or 100 µM forskolin. Reactions were stopped by placing the plates on ice, aspirating the media, and adding 500 µl of ice-cold ethanol. The contents of each well were collected, lyophilized, resuspended, and assayed for cAMP content by radioimmunoassay using [125I]cAMP (NEN Life Science Products) and anti-cAMP antibody (a gift from M. Ascoli) as described previously (18).

beta 2AR Binding and Ligand Competition Assays-- For determination of beta 2AR density in control and transfected cells, whole cells were harvested with trypsin/EDTA, or membranes were prepared (for competition binding assays). Whole cells were incubated in PBS containing 200 pM [125I]iodopindolol (NEN Life Science Products, 2200 Ci/mmol) ± 10 µM (-)-alprenolol at 37 °C for 1 h as described previously (18). Competition binding studies on cell membranes were performed as described previously (18). Briefly, cells were collected into cold homogenization buffer (25 mM Tris, pH 7.5, 5 mM EDTA, 1 mM EGTA, 0.02 mg/ml leupeptin, 0.2 mg/ml benzamidine, 0.5 mM phenylmethylsulfonyl fluoride) and homogenized by Polytron disruption. Homogenates were centrifuged, washed, resuspended, and assayed. Approximately 5 µg (transfected cells) or 50 µg (untransfected cells) of membrane protein were incubated at 37 °C for 1 h with 30 pM [125I]iodopindolol in the presence of 10-11-10-4 M (-)-isoproterenol. For down-regulation studies, cells were treated with isoproterenol for various times, washed, and homogenized in lysis buffer (20 mM Tris, pH 8, 5 mM EDTA, 2 mM EGTA, 5 µg/ml leupeptin, 0.2 mg/ml benzamidine) using a Polytron (2 × 30 s at 25,000 rpm), and approximately 50 µg of lysate were incubated at 37 °C for 1 h with 1 nM [125I]iodopindolol. All binding reactions were terminated by the addition of 5 × 4 ml of ice-cold 25 mM Tris, pH 7.5, 2 mM MgCl2 followed by filtration through Whatman GF/C filters using a Brandel cell harvester.

beta 2AR Sequestration Assays-- HeLa cells stably expressing beta 2AR-GFP were grown to 80-90% confluence, and internalization of receptor was assayed as described previously using the hydrophilic ligand [3H]CGP-12177 (3). Briefly, cells were harvested by trypsinization, resuspended in PBS, and incubated at 37 °C for 0-60 min with 10 µM (-)-isoproterenol. Incubations were stopped by the addition of ice-cold PBS, and cells were washed thoroughly with cold PBS. Cells were resuspended in cold PBS, and cell surface beta 2AR density was assessed in binding assays using 10-15 nM [3H]CGP-12177 ± 10 µM (-)-alprenolol at 14 °C for 3 h. For sequestration studies in transiently transfected HeLa cells, cells were harvested 48 h after transfection, incubated at 37 °C for 30 min with 1 µM (-)-isoproterenol, and then assayed for cell surface receptors using [3H]CGP-12177 following a 0-, 20-, or 60-min agonist washout.

Fluorescence Microscopy and Single Cell Time Courses-- Fluorescence microscopy was performed on a Bio-Rad MRC-Zeiss Axiovert 100 confocal microscope (Hemmelholsteadt, UK), using a Zeiss Plan-Apo 63 × 1.40 NA oil immersion objective. Cells were grown on glass coverslips and mounted on an imaging chamber (Warner Instrument Corp) with an inlet port through which media and drugs could be perfused. The media used for microscopy did not contain phenol red or antibiotics. For time course studies, the temperature was maintained at 37 ± 1 °C using an adjustable warm air flow and digital temperature probe (Yellow Springs Instrument Co., Inc.). For labeling of the lysosomal compartments, cells were incubated overnight with 1 mg/ml rhodamine-labeled dextran (Molecular Probes, Eugene, OR) on glass coverslips. The dextran was washed out of cells by rinsing once with media and then placing fresh media on cells 1.5 h before imaging. Agonists were added to the media and/or rhodamine-dextran mixes, depending on the treatment. For the transferrin experiments, the cells were incubated in media lacking serum for 30 min, followed by incubation with 20 or 200 µg/ml rhodamine-labeled transferrin for 30-60 min at 37 °C before imaging. The rhodamine-transferrin was only briefly rinsed off of cells three times with PBS before imaging. Incubations were timed so that agonist exposure end points coincided with the rhodamine-dextran or -transferrin loading and washing procedure end points. Cells for the rhodamine colocalization studies were rinsed quickly three times with PBS, incubated for 10 min at room temperature in 3.7% formaldehyde to fix, rinsed again in PBS, and mounted on a microscope slide with SlowfadeTM mounting medium (Molecular Probes) before imaging by confocal microscopy.

    RESULTS AND DISCUSSION
Top
Abstract
Introduction
Procedures
Results & Discussion
References

Pharmacological and Functional Properties of beta 2AR-GFP-- The complete GFP-S65T open reading frame was directly fused to the carboxyl terminus of a flag-tagged beta 2AR. Preliminary experiments were then performed to establish the suitability of beta 2AR-GFP as a model. Radioligand binding experiments using HeLa cells transiently expressing the receptor constructs demonstrated pharmacological properties of beta 2AR-GFP that were similar to those observed for the wild type beta 2AR. Competition of [125I]iodopindolol binding with isoproterenol revealed comparable IC50 values (~50 nM) measured using cells expressing either beta 2AR-GFP or wild type beta 2AR (Fig. 1A). Similar results were also obtained by Barak et al. (16), although calculated Ki values for both beta 2AR-GFP and wild type beta 2AR expressed in HEK293 cells were considerably higher, perhaps reflecting differences in receptor-G protein coupling between the respective model cells.


View larger version (32K):
[in this window]
[in a new window]
 
Fig. 1.   A, competition binding in transiently transfected HeLa cells. Wild type beta 2AR and beta 2AR-GFP were expressed transiently in HeLa cells using LipofectAMINE to levels of ~2 and 3.5 pmol/mg membrane protein, respectively (25-40-fold above endogenous beta 2AR levels in HeLa cells). Binding experiments contained 30 pM [125I]iodopindolol, which was competed with the indicated concentrations of isoproterenol. Results represent duplicate binding assays. B, cyclic AMP generation in CHW cells. Receptors were expressed transiently in CHW cells as described under "Experimental Procedures," and the cells were then treated with various concentrations of isoproterenol for 10 min at 37 °C. cAMP was assayed by radioimmunoassay and was compared with receptor-independent cAMP levels generated by incubation with 10 µM forskolin. Results represent the means ± S.E. of two experiments performed in duplicate. The wild type beta 2AR and beta 2AR-GFP were expressed at ~600 and 500 fmol/mg protein, respectively, likely accounting for the slightly higher response of the wild type receptor. C, agonist-promoted sequestration of beta 2AR-GFP. HeLa cells stably expressing beta 2AR-GFP (~200 fmol/mg protein) were treated for the indicated times with 10 µM isoproterenol, and binding to the hydrophilic ligand [3H]CGP-12177 was assessed. Binding at various time points was compared with the unstimulated cells. Results represent the the means ± S.E. of four experiments performed in triplicate. D, down-regulation in HeLa cells stably expressing beta 2AR-GFP. HeLa cells stably expressing beta 2AR-GFP (~200 fmol/mg protein) were treated for the indicated times with 10 µM isoproterenol, the cells were washed and lysed in a hypotonic buffer, and binding to the hydrophobic antagonist [125I]iodopindolol was assessed. Results represent the the means ± S.E. of three to six experiments performed in triplicate.

The capacity of beta 2AR-GFP to promote agonist-mediated cAMP production was also examined (Fig. 1B). CHW cells, which lack endogenous beta 2ARs, were transiently transfected with either wild type beta 2AR or beta 2AR-GFP, and the dose-dependent response to isoproterenol was examined. Isoproterenol was both efficacious (maximal cAMP reached approximately 2.5-fold basal) and potent (EC50 = ~1-2 nM) in stimulating cAMP production in cells expressing beta 2AR-GFP. Moreover, beta 2AR-GFP responsiveness was similar to that observed for the wild type beta 2AR. Collectively, these data suggest that fusion of the 238-amino acid GFP protein to the carboxyl terminus of the beta 2AR does not alter the salient pharmacological or functional properties of the receptor.

Assessment of agonist-mediated internalization of beta 2AR-GFP was performed in HeLa cells stably expressing beta 2AR-GFP at ~200 fmol/mg protein (Fig. 1C). Cells were pretreated with 10 µM isoproterenol for 0-60 min, and cell surface beta 2AR density was subsequently assessed using the hydrophilic beta -antagonist [3H]CGP-12177. The results demonstrate a classical time-dependent sequestration of beta 2ARs. Within 15 min of agonist treatment an ~30% loss of cell surface receptors was observed, reaching ~50% by 60 min. These results are also comparable with those observed by Barak et al., in which flow cytometry was used to measure agonist-mediated sequestration (16). In addition, these results imply that mechanisms involving the acute trafficking events of the wild type beta 2AR (3) appear applicable to beta 2AR-GFP. Indeed when transiently expressed in COS-1 cells, agonist-mediated beta 2AR-GFP internalization was enhanced by co-expression of beta -arrestin (data not shown). These results suggest that beta -arrestin is capable of binding to the beta 2AR-GFP and mediating its internalization, as has been observed with the wild type beta 2AR (2, 3).

Alterations in cellular beta 2AR content following chronic exposure to beta -agonist were subsequently determined in HeLa cells (Fig. 1D). Cells were treated with 10 µM isoproterenol for 0-24 h, and total beta 2AR density was measured in crude cell lysates by radioligand binding using the hydrophobic beta -antagonist [125I]iodopindolol. As with the sequestration data, the temporal profile of beta 2AR-GFP down-regulation was typical of that observed for wild type beta 2AR expressed in various cell systems (19, 20).

Visualization of Time-dependent Trafficking of beta 2AR-GFP-- Having established beta 2AR-GFP as an appropriate model of beta 2AR function and trafficking, we subsequently performed experiments designed to visualize the subcellular distribution of beta 2AR-GFP following acute and chronic exposure to beta -agonist. These experiments were performed using HeLa cells in which stable transfection of beta 2AR-GFP resulted in expression levels of 200-700 fmol/mg protein. Examination of numerous cells suggests that the beta 2AR-GFP is diffusely distributed on the cell surface before agonist treatment (seen in Fig. 2, left panels in top and bottom rows). However, significant perinuclear staining was also visible in some cells (e.g. Fig. 2, bottom row). Cyclohexamide treatment reveals that although some of the perinuclear staining is likely due to Golgi localization of receptors, some receptors are also in a presently unknown cellular compartment.


View larger version (89K):
[in this window]
[in a new window]
 
Fig. 2.   Visualization of receptor internalization and recycling. HeLa cells stably expressing beta 2AR-GFP were observed using fluorescence confocal microscopy during stimulation with the agonist isoproterenol. Top row, single cell before treatment and after 5, 10, and 20 min of exposure to 10 µM isoproterenol. Bottom row, single cell before treatment, after 10 min of exposure to isoproterenol, and 10 and 20 min after replacement of the isoproterenol with 10 µM alprenolol.

Initial studies examined the rapid internalization of beta 2AR-GFP following exposure of HeLa cells to 10 µM isoproterenol (Fig. 2). Fluorescent images obtained from single cells using confocal microscopy demonstrate the rapid appearance of a punctate staining pattern with accumulations that become progressively larger and more numerous over a 20-min course of agonist exposure (Fig. 2, top row). These images are consistent with the time course of sequestration suggested by our radioligand binding data (Fig. 1C) as well as with those studies utilizing immunocytochemistry of fixed and permeabilized cells to visualize internalization of epitope-tagged beta 2ARs (3, 21).

We then observed cells in which a 10-min agonist treatment was followed by media washout and exposure to the beta 2AR antagonist alprenolol (Fig. 2, lower panels). Antagonist was included in the wash to prevent agonist rebinding during the washes. The punctate localization pattern of the receptor was shown to revert to a more diffuse pattern within 20 min of agonist removal, suggesting that receptors are recycling back to the plasma membrane. Radioligand binding experiments in transiently transfected HeLa cells indicate that the return of the beta 2AR-GFP to the cell surface after agonist removal is temporally and quantitatively similar to that of the wild type beta 2AR (Fig. 3). However, complete recycling of internalized receptor was not observed until 60 min after agonist washout. Our findings agree with other pharmacological studies, suggesting that the receptor relocalizes to the plasma membrane upon removal of agonist (7), and with results from immunocytochemistry experiments using fixed cells (21). The ability to observe this process in live cells should provide unique insight into receptor recycling, and what signals, if any, affect this dynamic process.


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 3.   Sequestration and recycling of receptors as assessed by radioligand binding. HeLa cells transiently expressing beta 2AR or beta 2AR-GFP (2-5 pmol/mg protein) were treated with agonist only or agonist followed by a wash period with warm media. Cells were then harvested by trypsinization and washed in PBS, and cell surface receptor levels were assessed using [3H]CGP-12177. The level of cell surface receptor loss was calculated by comparison with untreated cells. Results represent the means ± S.E. of three experiments performed in duplicate. iso, isoproterenol.

We next examined the localization patterns of beta 2AR-GFP induced by exposure to beta -agonists of differing pharmacological properties (Fig. 4). We hypothesized that the rate of observable punctate pattern formation would correlate with the intrinsic activity and/or onset of action of the various beta -agonists tested. The effect of formoterol, a long acting beta -agonist of high intrinsic activity and rapid onset of action, on beta 2AR-GFP redistribution is depicted in Fig. 4A. The rate and pattern of vesicular formation were comparable with that induced by isoproterenol. Conversely, albuterol, a short acting agonist with moderate intrinsic activity, exhibited a slightly slower rate of receptor relocalization than that observed with either isoproterenol or formoterol (Fig. 4B). Multiple experiments suggest that cells exposed to albuterol required approximately 25-30 min to reach a pattern of beta 2AR-GFP distribution caused by a 20-min exposure to isoproterenol (Figs. 2 and 4 and data not shown).


View larger version (78K):
[in this window]
[in a new window]
 
Fig. 4.   Observation of single cells during stimulation with 10 µM RRSS-formoterol (A, for), 100 µM R-albuterol (B, alb), and 10 µM R-salmeterol (C, sal). Numbers above each photo indicate the length of treatment in min. Photographs represent typical responses observed.

Most striking, however, were the data obtained using salmeterol, a long acting beta -agonist with low instrinsic activity and a very slow rate of onset of action, characteristics determined in part by the very hydrophobic nature of the compound (22, 23). Cells exposed to salmeterol (Fig. 4C) required ~70 min of treatment to exhibit a level of receptor internalization comparable with that observed at the 20-min isoproterenol time point. Yet it was possible to show that salmeterol clearly caused relocalization of receptors to intracellular vesicles, providing evidence of salmeterol-induced sequestration not obtainable in previous studies (23, 24). Because treatment of cells with salmeterol causes stable activation of adenylyl cyclase that survives extensive wash procedures and sucrose-gradient purification of plasma membrane fractions (23), radioligand binding is rendered an unreliable tool for the analysis of salmeterol effects on beta 2AR trafficking. Here we demonstrate that direct visualization of beta 2AR-GFP distribution circumvents the limitations conferred by salmeterol retention and represents an important tool in future analyses of this compound.

Colocalization of beta 2AR-GFP with Rhodamine-labeled Transferrin and Dextran-- To assess differences in subcellular localization of beta 2AR-GFP following acute (sequestration) versus chronic (associated with down-regulation) exposure to beta -agonists, we examined the time-dependent colocalization of beta 2AR-GFP with additional fluorescent compounds (rhodamine-labeled transferrin and dextran) known to accumulate in distinct subcellular compartments. Transferrin primarily internalizes with transferrin receptors and constitutively recycles with the receptors through early endosomes to a recycling compartment and then back to the cell surface (25). Conversely, dextran has been shown to specifically accumulate in late endosomes and lysosomes (26). Previous studies have demonstrated co-localization of transferrin receptors and an epitope-tagged beta 2AR following beta -agonist treatment (21), whereas dextran has recently been used to demonstrate lysosomal localization of the thyrotropin-releasing hormone receptor (27). Fig. 5A demonstrates that in unstimulated cells, the beta 2AR-GFP distribution displays a relatively diffuse membrane localization pattern, whereas 20-min incubation of these cells with transferrin results in accumulation of transferrin in small vesicles. 30 min after treatment with isoproterenol, a significant portion of beta 2AR-GFP is seen to distribute into early endosomal compartments coincident with the presence of transferrin (Fig. 5B, colocalization shown in yellow). In contrast, when cells are exposed to isoproterenol for 3.5 h followed by a 1-h treatment with transferrin in the absence of beta -agonist, minimal co-localization of beta 2AR-GFP and transferrin is evident (Fig. 5C). These results demonstrate that under such conditions a large fraction of the beta 2AR-GFPs remain in internal vesicles that lack transferrin receptors, possibly in late endosomes and/or lysosomes.


View larger version (52K):
[in this window]
[in a new window]
 
Fig. 5.   Colocalization of the beta 2AR-GFP with transferrin during isoproterenol treatment. HeLa cells stably expressing the beta 2AR-GFP were grown onto coverslips, incubated with rhodamine-labeled transferrin, and treated with 10 µM isoproterenol for the times indicated above each photograph. A, 20 min of incubation with 20 µg/ml transferrin only. B, 30 min of incubation with isoproterenol and 20 µg/ml transferrin. C, 3.5 h of incubation with isoproterenol followed by 1 h of incubation with 200 µg/ml transferrin in the absence of isoproterenol. The cells shown were fixed in formaldehyde and imaged using both fluorescein isothiocyanate and rhodamine filter sets on a confocal microscope. Images were overlaid using Photoshop software.

The agonist- and time-dependent localization of beta 2AR-GFP with lysosomes is revealed in cells loaded with rhodamine-labeled dextran. Cells were incubated with 1 mg/ml rhodamine-labeled dextran for 24 h and then washed for 1.5 h in the absence of dextran to remove any accumulation in early endosomes. During the latter portion of these incubations the cells were also incubated with 10 µM isoproterenol for 30 min, 1 h, 3.5 h, or 24 h prior to fixing the cells. Unstimulated cells display dextran localized to large vesicles typical of lysosomes, many of which are centrally located in the cells (Fig. 6, upper left). Following 30 min of isoproterenol exposure, the beta 2AR-GFP has moved into early endosomes and shows minimal co-localization with dextran. After 1 h of isoproterenol treatment, the beta 2AR-GFP exhibits significant co-localization with dextran, with this colocalization increasing somewhat at the 3.5- and 24-h time points. Cells treated in a time-dependent manner with salmeterol displayed a similar pattern, although the progression of colocalization of beta 2AR-GFP with dextran was slower. Although salmeterol treatment for 24 h results in images similar to those obtained with isoproterenol treatment, colocalization of dextran with beta 2AR-GFP was not evident until after 3 h of treatment with salmeterol (data not shown), suggesting that the relatively slow kinetics of salmeterol binding/activation of the beta 2AR translate into attenuated rates of beta 2AR sequestration and down-regulation.


View larger version (136K):
[in this window]
[in a new window]
 
Fig. 6.   Colocalization of the beta 2AR-GFP with dextran during beta -agonist treatment. HeLa cells stably expressing beta 2AR-GFP were grown onto coverslips, incubated with 1 mg/ml rhodamine-labeled dextran for 24 h, and then washed in media without dextran for 1.5 h. During the latter portion of this incubation period, the cells were incubated with 10 µM isoproterenol or salmeterol for the times indicated above each photograph. Cells were fixed and imaged as described in the legend to Fig. 4.

In conclusion, we have utilized beta 2AR-GFP to visualize real time cellular redistribution of beta 2ARs in live cells responding to agonists. We have demonstrated the rapid colocalization of the beta 2AR in transferrin-containing endosomes following acute beta -agonist exposure. Following prolonged (but not acute) exposure to beta -agonists, beta 2AR-GFP is shown to colocalize with dextran in lysosomes. Experiments examining the effects of various beta -agonists suggest that beta 2AR distribution, sequestration, and down-regulation are regulated by the intrinsic activity and onset of action of a ligand. In this regard, the beta 2AR-GFP was especially advantageous for the examination of the lipophilic compound salmeterol. Our results suggest that GFP conjugated G protein-coupled receptors are powerful tools for visualizing the dynamics of receptor trafficking in living cells.

    ACKNOWLEDGEMENTS

We thank Drs. J. Keen and C. Schmutte and members of the Benovic and Keen labs for helpful discussions, J. Dispoto and P. Hingorani for confocal microscopy, and H. Alder and the Kimmel Nucleic Acids facility for DNA synthesis and sequencing. We also thank Dr. B. Kobilka for the Flag tagged beta 2AR construct, Dr. R. Lefkowitz for CHW cells, Dr. M. Ascoli for the cAMP antibody, Dr. P. Garcia for the GPT-Ad5, and Sepracor Inc. for providing formoterol, albuterol, and salmeterol.

    FOOTNOTES

* This work was supported in part by National Institutes of Health Grants GM44944 and GM47417.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger Established investigator of the American Heart Association. To whom correspondence should be addressed: Kimmel Cancer Inst., Thomas Jefferson University, 233 South 10th St., Philadelphia, PA 19107. Tel.: 215-503-4607; Fax: 215-923-1098; E-mail: benovic{at}lac.jci.tju.edu.

1 The abbreviations used are: beta 2AR, beta 2-adrenergic receptor; GFP, green fluorescent protein; PCR, polymerase chain reaction; PBS, phosphate-buffered saline.

    REFERENCES
Top
Abstract
Introduction
Procedures
Results & Discussion
References

  1. Sterne-Marr, R., and Benovic, J. L. (1995) in Vitamins and Hormones (Litwack, G., ed), pp. 193-234, Academic Press, New York
  2. Ferguson, S. S. G., Downey, W. E., III, Colapietro, A. M., Barak, L. S., Menard, L., Caron, M. G. (1996) Science 271, 363-365[Abstract]
  3. Goodman, O. B. J., Krupnick, J. G., Santini, F., Gurevich, V. V., Penn, R. B., Gagnon, A. W., Keen, J. H., Benovic, J. L. (1996) Nature 383, 447-450[CrossRef][Medline] [Order article via Infotrieve]
  4. Pippig, S., Andexinger, S., and Lohse, M. (1995) Mol. Pharmacol. 47, 666-676[Abstract]
  5. Krueger, K. M., Daaka, Y., Pitcher, J. A., Lefkowitz, R. J. (1997) J. Biol. Chem. 272, 5-8[Abstract/Free Full Text]
  6. Toews, M. L., Liang, M., and Perkins, J. P. (1987) Mol. Pharmacol. 32, 737-742[Abstract]
  7. Kurz, J. B., and Perkins, J. P. (1992) Mol. Pharmacol. 41, 375-381[Abstract]
  8. Chuang, D. M. (1982) Biochem. Biophys. Res. Commun. 105, 1466-1472[CrossRef][Medline] [Order article via Infotrieve]
  9. Waldo, G. L., Northup, J. K., Perkins, J. P., Harden, T. K. (1983) J. Biol. Chem. 258, 13900-13908[Abstract/Free Full Text]
  10. Wakshull, E., Hertel, C., O'Keefe, E. J., Perkins, J. P. (1985) J. Cell. Biochem. 29, 127-141[CrossRef][Medline] [Order article via Infotrieve]
  11. Liao, J.-F., and Perkins, J. P. (1993) Mol. Pharmacol. 44, 364-370[Abstract]
  12. von Zastrow, M., and Kobilka, B. K. (1992) J. Biol. Chem. 267, 3530-3538[Abstract/Free Full Text]
  13. Prasher, D. C., Eckenrode, V. K., Ward, W. W., Prendergast, F. G., Cormier, M. J. (1992) Gene (Amst.) 111, 229-233[CrossRef][Medline] [Order article via Infotrieve]
  14. Kain, S. R., Adams, M., Kondepudi, A., Yang, T.-T., Ward, W. W., Kitts, P. (1995) BioTechniques 19, 650-654 [Medline] [Order article via Infotrieve]
  15. Inouye, S., and Tsuji, F. I. (1994) FEBS Lett. 341, 277-280[CrossRef][Medline] [Order article via Infotrieve]
  16. Barak, L. S., Ferguson, S. S. G., Zhang, J., Martenson, C., Meyer, T., and Caron, M. G. (1997) Mol. Pharmacol. 51, 177-184[Abstract/Free Full Text]
  17. Forsayeth, J. R., and Garcia, P. D. (1994) BioTechniques 17, 354-358 [Medline] [Order article via Infotrieve]
  18. Penn, R. B., Kelsen, S. G., and Benovic, J. L. (1994) Am. J. Respir. Cell Mol. Biol. 11, 496-505[Abstract]
  19. Hausdorff, W. P., Campbell, P. T., Ostrowski, J., Yu, S. S., Caron, M. G., Lefkowitz, R. J. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 2979-2983[Abstract/Free Full Text]
  20. Valiquette, M., Bonin, H., Hnatowich, M., Caron, M. G., Lefkowitz, R. J. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 5089-5093[Abstract/Free Full Text]
  21. von Zastrow, M., and Kobilka, B. K. (1994) J. Biol. Chem. 269, 18448-18452[Abstract/Free Full Text]
  22. Linden, A., Rabe, K. G., and Lofdahl, C.-G. (1996) Lung 174, 1-22[Medline] [Order article via Infotrieve]
  23. Clark, R. B., Allal, C., Friedman, J., Johnson, M., and Barber, R. (1996) Mol. Pharmacol. 49, 182-189[Abstract]
  24. Green, S. A., Spasoff, A. P., Coleman, R. A., Johnson, M., Liggett, S. B. (1996) J. Biol. Chem. 271, 24029-24035[Abstract/Free Full Text]
  25. Schmid, S. L., Fuchs, R., Male, P., and Mellman, I. (1988) Cell 52, 73-83[CrossRef][Medline] [Order article via Infotrieve]
  26. Ohkuma, S., and Poole, B. (1978) Proc. Natl. Acad. Sci. U. S. A. 75, 3327-3331[Abstract/Free Full Text]
  27. Petrou, C., Chen, L., and Tashjian, A. H., Jr. (1997) J. Biol. Chem. 272, 2326-2333[Abstract/Free Full Text]


Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
M. Scarselli and J. G. Donaldson
Constitutive Internalization of G Protein-coupled Receptors and G Proteins via Clathrin-independent Endocytosis
J. Biol. Chem., February 6, 2009; 284(6): 3577 - 3585.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
S. Adachi, T. Nagao, S. To, A. K. Joe, M. Shimizu, R. Matsushima-Nishiwaki, O. Kozawa, H. Moriwaki, F. R. Maxfield, and I.B. Weinstein
(-)-Epigallocatechin gallate causes internalization of the epidermal growth factor receptor in human colon cancer cells
Carcinogenesis, October 1, 2008; 29(10): 1986 - 1993.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
L. Stanasila, L. Abuin, J. Dey, and S. Cotecchia
Different Internalization Properties of the {alpha}1a- and {alpha}1b-Adrenergic Receptor Subtypes: The Potential Role of Receptor Interaction with {beta}-Arrestins and AP50
Mol. Pharmacol., September 1, 2008; 74(3): 562 - 573.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
E. M. Awumey, A. C. Howlett, J. W. Putney Jr., D. I. Diz, and R. D. Bukoski
Ca2+ mobilization through dorsal root ganglion Ca2+-sensing receptor stably expressed in HEK293 cells
Am J Physiol Cell Physiol, May 1, 2007; 292(5): C1895 - C1905.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Z. Kilianova, N. Basora, P. Kilian, M. D. Payet, and N. Gallo-Payet
Human Melanocortin Receptor 2 Expression and Functionality: Effects of Protein Kinase A and Protein Kinase C on Desensitization and Internalization
Endocrinology, May 1, 2006; 147(5): 2325 - 2337.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
V. Lamian, A. Rich, Z. Ma, J. Li, R. Seethala, D. Gordon, and Y. Dubaquie
Characterization of Agonist-Induced Motilin Receptor Trafficking and Its Implications for Tachyphylaxis
Mol. Pharmacol., January 1, 2006; 69(1): 109 - 118.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
S. Osawa, M. Kajimura, S. Yamamoto, M. Ikuma, C. Mochizuki, H. Iwasaki, A. Hishida, and S. Terakawa
Alteration of intracellular histamine H2 receptor cycling precedes antagonist-induced upregulation
Am J Physiol Gastrointest Liver Physiol, November 1, 2005; 289(5): G880 - G889.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Krasel, M. Bunemann, K. Lorenz, and M. J. Lohse
{beta}-Arrestin Binding to the {beta}2-Adrenergic Receptor Requires Both Receptor Phosphorylation and Receptor Activation
J. Biol. Chem., March 11, 2005; 280(10): 9528 - 9535.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
R. H. Moore, E. E. Millman, E. Alpizar-Foster, W. Dai, and B. J. Knoll
Rab11 regulates the recycling and lysosome targeting of {beta}2-adrenergic receptors
J. Cell Sci., July 1, 2004; 117(15): 3107 - 3117.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
J.-G. Chen, S. Pandey, J. Huang, J. M. Alonso, J. R. Ecker, S. M. Assmann, and A. M. Jones
GCR1 Can Act Independently of Heterotrimeric G-Protein in Response to Brassinosteroids and Gibberellins in Arabidopsis Seed Germination
Plant Physiology, June 1, 2004; 135(2): 907 - 915.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
J. Wiejak, L. Surmacz, and E. Wyroba
Dynamin-association with agonist-mediated sequestration of beta-adrenergic receptor in single-cell eukaryote Paramecium
J. Exp. Biol., April 15, 2004; 207(10): 1625 - 1632.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
W. Liang, P. K. Curran, Q. Hoang, R. T. Moreland, and P. H. Fishman
Differences in endosomal targeting of human {beta}1- and {beta}2-adrenergic receptors following clathrin-mediated endocytosis
J. Cell Sci., February 15, 2004; 117(5): 723 - 734.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. P. Singh, D. McDonald, T. J. Hope, and B. S. Prabhakar
Upon Thyrotropin Binding the Thyrotropin Receptor Is Internalized and Localized to Endosome
Endocrinology, February 1, 2004; 145(2): 1003 - 1010.
[Abstract] [Full Text] [PDF]


Home page
Protein Eng Des SelHome page
D. Ott, R. Frischknecht, and A. Pluckthun
Construction and characterization of a kappa opioid receptor devoid of all free cysteines
Protein Eng. Des. Sel., January 1, 2004; 17(1): 37 - 48.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
Z. Gao, D. Lei, J. Welch, K. Le, J. Lin, S. Leng, and D. Duhl
Agonist-Dependent Internalization of the Human Melanocortin-4 Receptors in Human Embryonic Kidney 293 Cells
J. Pharmacol. Exp. Ther., December 1, 2003; 307(3): 870 - 877.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. J. Dupre, Z. Chen, C. Le Gouill, C. Theriault, J.-L. Parent, M. Rola-Pleszczynski, and J. Stankova
Trafficking, Ubiquitination, and Down-regulation of the Human Platelet-activating Factor Receptor
J. Biol. Chem., November 28, 2003; 278(48): 48228 - 48235.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Wu, G. Zhao, and Y. He
Distinct Pathways for the Trafficking of Angiotensin II and Adrenergic Receptors from the Endoplasmic Reticulum to the Cell Surface: Rab1-INDEPENDENT TRANSPORT OF A G PROTEIN-COUPLED RECEPTOR
J. Biol. Chem., November 21, 2003; 278(47): 47062 - 47069.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Lavine, N. Ethier, J. N. Oak, L. Pei, F. Liu, P. Trieu, R. V. Rebois, M. Bouvier, T. E. Hebert, and H. H. M. Van Tol
G Protein-coupled Receptors Form Stable Complexes with Inwardly Rectifying Potassium Channels and Adenylyl Cyclase
J. Biol. Chem., November 22, 2002; 277(48): 46010 - 46019.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
E. Shumay, X. Song, H.-y. Wang, and C. C. Malbon
pp60Src Mediates Insulin-stimulated Sequestration of the beta 2-Adrenergic Receptor: Insulin Stimulates pp60Src Phosphorylation and Activation
Mol. Biol. Cell, November 1, 2002; 13(11): 3943 - 3954.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Ohshima, S. Ishii, T. Izumi, and T. Shimizu
Receptor-dependent Metabolism of Platelet-activating Factor in Murine Macrophages
J. Biol. Chem., March 15, 2002; 277(12): 9722 - 9727.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
P. Burke, K. Schooler, and H. S. Wiley
Regulation of Epidermal Growth Factor Receptor Signaling by Endocytosis and Intracellular Trafficking
Mol. Biol. Cell, June 1, 2001; 12(6): 1897 - 1910.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
A. Seibold, B. Williams, Z.-F. Huang, J. Friedman, R. H. Moore, B. J. Knoll, and R. B. Clark
Localization of the Sites Mediating Desensitization of the beta 2-Adrenergic Receptor by the GRK Pathway
Mol. Pharmacol., November 1, 2000; 58(5): 1162 - 1173.
[Abstract] [Full Text]


Home page
NeuroscientistHome page
T. E. Hughes
Looking at Receptors: What Have Fluorescent Receptors and Channels Told Us?
Neuroscientist, October 1, 2000; 6(5): 371 - 379.
[Abstract] [PDF]


Home page
Mol. Pharmacol.Home page
J.-G. Li, J. L. Benovic, and L.-Y. Liu-Chen
Mechanisms of Agonist-Induced Down-Regulation of the Human kappa -Opioid Receptor: Internalization Is Required for Down-Regulation
Mol. Pharmacol., October 1, 2000; 58(4): 795 - 801.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Renal Physiol.Home page
R. Chen, Y. V. Mukhin, M. N. Garnovskaya, T. E. Thielen, Y. Iijima, C. Huang, J. R. Raymond, M. E. Ullian, and R. V. Paul
A functional angiotensin II receptor-GFP fusion protein: evidence for agonist-dependent nuclear translocation
Am J Physiol Renal Physiol, September 1, 2000; 279(3): F440 - F448.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. I. Tsao and M. von Zastrow
Type-specific Sorting of G Protein-coupled Receptors after Endocytosis
J. Biol. Chem., April 6, 2000; 275(15): 11130 - 11140.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Wang, R. T. Windh, C. A. Chen, and D. R. Manning
N-Myristoylation and beta gamma Play Roles beyond Anchorage in the Palmitoylation of the G Protein alpha o Subunit
J. Biol. Chem., December 24, 1999; 274(52): 37435 - 37442.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
A. J. McLean, N. Bevan, S. Rees, and G. Milligan
Visualizing Differences in Ligand Regulation of Wild-Type and Constitutively Active Mutant beta 2-Adrenoceptor-Green Fluorescent Protein Fusion Proteins
Mol. Pharmacol., December 1, 1999; 56(6): 1182 - 1191.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
R. Jockers, S. Angers, A. Da Silva, P. Benaroch, A. D. Strosberg, M. Bouvier, and S. Marullo
beta 2-Adrenergic Receptor Down-regulation. EVIDENCE FOR A PATHWAY THAT DOES NOT REQUIRE ENDOCYTOSIS
J. Biol. Chem., October 8, 1999; 274(41): 28900 - 28908.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
N. Dzimiri
Regulation of beta -Adrenoceptor Signaling in Cardiac Function and Disease
Pharmacol. Rev., September 1, 1999; 51(3): 465 - 502.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. B. Wheeler, R. W. Gelling, S. A. Hinke, B. Tu, R. A. Pederson, F. Lynn, J. Ehses, and C. H. S. McIntosh
Characterization of the Carboxyl-terminal Domain of the Rat Glucose-dependent Insulinotropic Polypeptide (GIP) Receptor. A ROLE FOR SERINES 426 AND 427 IN REGULATING THE RATE OF INTERNALIZATION
J. Biol. Chem., August 27, 1999; 274(35): 24593 - 24601.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. A. Groarke, S. Wilson, C. Krasel, and G. Milligan
Visualization of Agonist-induced Association and Trafficking of Green Fluorescent Protein-tagged Forms of Both beta -Arrestin-1 and the Thyrotropin-releasing Hormone Receptor-1
J. Biol. Chem., August 13, 1999; 274(33): 23263 - 23269.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
C. Schwencke, M. Yamamoto, S. Okumura, Y. Toya, S.-J. Kim, and Y. Ishikawa
Compartmentation of Cyclic Adenosine 3',5'-Monophosphate Signaling in Caveolae
Mol. Endocrinol., July 1, 1999; 13(7): 1061 - 1070.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
O. Dery, M. S. Thoma, H. Wong, E. F. Grady, and N. W. Bunnett
Trafficking of Proteinase-activated Receptor-2 and beta -Arrestin-1 Tagged with Green Fluorescent Protein. beta -ARRESTIN-DEPENDENT ENDOCYTOSIS OF A PROTEINASE RECEPTOR
J. Biol. Chem., June 25, 1999; 274(26): 18524 - 18535.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. McConalogue, O. Dery, M. Lovett, H. Wong, J. H. Walsh, E. F. Grady, and N. W. Bunnett
Substance P-induced Trafficking of beta -Arrestins. THE ROLE OF beta -ARRESTINS IN ENDOCYTOSIS OF THE NEUROKININ-1 RECEPTOR
J. Biol. Chem., June 4, 1999; 274(23): 16257 - 16268.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Barlic, M. H. Khandaker, E. Mahon, J. Andrews, M. E. DeVries, G. B. Mitchell, R. Rahimpour, C. M. Tan, S. S. G. Ferguson, and D. J. Kelvin
beta -Arrestins Regulate Interleukin-8-induced CXCR1 Internalization
J. Biol. Chem., June 4, 1999; 274(23): 16287 - 16294.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Maamra, J. Finidori, S. Von Laue, S. Simon, S. Justice, J. Webster, S. Dower, and R. Ross
Studies with a Growth Hormone Antagonist and Dual-fluorescent Confocal Microscopy Demonstrate that the Full-length Human Growth Hormone Receptor, but Not the Truncated Isoform, Is Very Rapidly Internalized Independent of Jak2-Stat5 Signaling
J. Biol. Chem., May 21, 1999; 274(21): 14791 - 14798.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J.-G. Li, L.-Y. Luo, J. G. Krupnick, J. L. Benovic, and L.-Y. Liu-Chen
U50,488H-induced Internalization of the Human {kappa} Opioid Receptor Involves a {beta}-Arrestin- and Dynamin-dependent Mechanism. {kappa} RECEPTOR INTERNALIZATION IS NOT REQUIRED FOR MITOGEN-ACTIVATED PROTEIN KINASE ACTIVATION
J. Biol. Chem., April 23, 1999; 274(17): 12087 - 12094.
[Abstract] [Full Text] [PDF]


Home page
J Biomol ScreenHome page
B. R. Conway, L. K. Minor, J. Z. Xu, J. W. Gunnet, R. DeBiasio, M. R. D'Andrea, R. Rubin, R. DeBiasio, K. Giuliano, L. Zhou, et al.
Quantification of G-Protein Coupled Receptor Internalization Using G-Protein Coupled Receptor-Green Fluorescent Protein Conjugates with the ArrayScanTM High-Content Screening System
J Biomol Screen, April 1, 1999; 4(2): 75 - 86.
[Abstract] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
J. del Valle
CCK receptor trafficking: a novel paradigm of travel. Focus on "Regulation of lateral mobility and cellular trafficking of the CCK receptor by a partial agonist"
Am J Physiol Cell Physiol, March 1, 1999; 276(3): C537 - C538.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. J. Stefan and K. J. Blumer
A Syntaxin Homolog Encoded by VAM3 Mediates Down-regulation of a Yeast G Protein-coupled Receptor
J. Biol. Chem., January 15, 1999; 274(3): 1835 - 1841.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
R. Moore, A Tuffaha, E. Millman, W Dai, H. Hall, B. Dickey, and B. Knoll
Agonist-induced sorting of human beta2-adrenergic receptors to lysosomes during downregulation
J. Cell Sci., January 2, 1999; 112(3): 329 - 338.
[Abstract] [PDF]


Home page
J. Biol. Chem.Home page
R. E. Carter and A. Sorkin
Endocytosis of Functional Epidermal Growth Factor Receptor-Green Fluorescent Protein Chimera
J. Biol. Chem., December 25, 1998; 273(52): 35000 - 35007.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. J. Orsini and J. L. Benovic
Characterization of Dominant Negative Arrestins That Inhibit beta 2-Adrenergic Receptor Internalization by Distinct Mechanisms
J. Biol. Chem., December 18, 1998; 273(51): 34616 - 34622.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
A. E. Remmers, M. J. Clark, X. Y. Liu, and F. Medzihradsky
Delta Opioid Receptor Down-Regulation Is Independent of Functional G Protein yet Is Dependent on Agonist Efficacy
J. Pharmacol. Exp. Ther., November 1, 1998; 287(2): 625 - 632.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
M. J. Shapiro and S. R. Coughlin
Separate Signals for Agonist-independent and Agonist-triggered Trafficking of Protease-activated Receptor 1
J. Biol. Chem., October 30, 1998; 273(44): 29009 - 29014.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Drmota, G. W. Gould, and G. Milligan
Real Time Visualization of Agonist-mediated Redistribution and Internalization of a Green Fluorescent Protein-tagged Form of the Thyrotropin-releasing Hormone Receptor
J. Biol. Chem., September 11, 1998; 273(37): 24000 - 24008.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. B. Lee, R. Pals-Rylaarsdam, J. L. Benovic, and M. M. Hosey
Arrestin-independent Internalization of the m1, m3, and m4 Subtypes of Muscarinic Cholinergic Receptors
J. Biol. Chem., May 22, 1998; 273(21): 12967 - 12972.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. W. Gagnon, L. Kallal, and J. L. Benovic
Role of Clathrin-mediated Endocytosis in Agonist-induced Down-regulation of the beta 2-Adrenergic Receptor
J. Biol. Chem., March 20, 1998; 273(12): 6976 - 6981.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Kuwasako, Y. Shimekake, M. Masuda, K. Nakahara, T. Yoshida, M. Kitaura, K. Kitamura, T. Eto, and T. Sakata
Visualization of the Calcitonin Receptor-like Receptor and Its Receptor Activity-modifying Proteins during Internalization and Recycling
J. Biol. Chem., September 15, 2000; 275(38): 29602 - 29609.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. E. Hughes, H. Zhang, D. E. Logothetis, and C. H. Berlot
Visualization of a Functional Galpha q-Green Fluorescent Protein Fusion in Living Cells. ASSOCIATION WITH THE PLASMA MEMBRANE IS DISRUPTED BY MUTATIONAL ACTIVATION AND BY ELIMINATION OF PALMITOYLATION SITES, BUT NOT BY ACTIVATION MEDIATED BY RECEPTORS OR AlF4-
J. Biol. Chem., February 2, 2001; 276(6): 4227 - 4235.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Shiina, K. Arai, S. Tanabe, N. Yoshida, T. Haga, T. Nagao, and H. Kurose
Clathrin Box in G Protein-coupled Receptor Kinase 2
J. Biol. Chem., August 24, 2001; 276(35): 33019 - 33026.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. B. Penn, R. M. Pascual, Y.-M. Kim, S. J. Mundell, V. P. Krymskaya, R. A. Panettieri Jr., and J. L. Benovic
Arrestin Specificity for G Protein-coupled Receptors in Human Airway Smooth Muscle
J. Biol. Chem., August 24, 2001; 276(35): 32648 - 32656.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kallal, L.
Right arrow Articles by Benovic, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kallal, L.
Right arrow Articles by Benovic, J. L.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1998 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement