|
Vol. 273, Issue 1, 322-328, January 2, 1998
Visualization of Agonist-induced Sequestration and
Down-regulation of a Green Fluorescent Protein-tagged
2-Adrenergic Receptor*
Lorena
Kallal,
Alison W.
Gagnon,
Raymond B.
Penn, and
Jeffrey L.
Benovic
From the Department of Microbiology and Immunology, Kimmel Cancer
Institute, Thomas Jefferson University,
Philadelphia, Pennsylvania 19107
 |
ABSTRACT |
To date, the visualization of
2-adrenergic receptor ( 2AR)
trafficking has been largely limited to immunocytochemical analyses of
acute internalization events of epitope-tagged receptors in various
transfection systems. The development of a 2AR
conjugated with green fluorescent protein ( 2AR-GFP)
provides the opportunity for a more extensive optical analysis of
2AR sequestration, down-regulation, and recycling in
cells. Here we demonstrate that stable expression of
2AR-GFP in HeLa cells enables a detailed temporal and
spatial analysis of these events. Time-dependent
colocalization of 2AR-GFP with rhodamine-labeled
transferrin and rhodamine-labeled dextran following agonist exposure
demonstrates receptor distribution to early endosomes (sequestration)
and lysosomes (down-regulation), respectively. The observed temporal
distribution of 2AR-GFP was consistent with measures of
receptor sequestration and down-regulation generated by
radioligand-receptor binding assays. Cells stimulated with different
-agonists revealed time courses of 2AR-GFP
redistribution reflective of the intrinsic activity of each
agonist.
 |
INTRODUCTION |
Upon agonist stimulation, 2-adrenergic receptors
( 2ARs)1 are
rapidly desensitized by receptor phosphorylation (1). Receptor phosphorylation by G protein-coupled receptor kinases and subsequent binding of non-visual arrestins initiates the internalization of
2ARs via clathrin-coated pits (2, 3). Previous studies have demonstrated that internalized receptors have multiple potential fates. One such fate is the recycling of internalized receptors to the
plasma membrane, presumably completing an ill defined
"resensitization " process involving 2AR
dephosphorylation in an endosomal compartment (4, 5). Depending upon
the duration of agonist exposure, internalized 2ARs may
ultimately appear "lost" or destroyed (undetectable by radioligand
binding), ostensibly trafficking to lysosomes where they are degraded.
Previously, the analysis of these events has been heavily dependent on
biochemical and pharmacological approaches.
Agonist-mediated subcellular redistribution of 2ARs was
initially inferred from ligand binding studies (6, 7) and the coincident migration of 2ARs with enzyme markers (8, 9) or epidermal growth factor (10, 11) into subcellular fractions resolved
through centrifugation. However, direct visualization of
2AR trafficking events remained lacking until von
Zastrow and Kobilka (12) provided immunocytochemical evidence of rapid, agonist-induced redistribution of epitope-tagged 2ARs
into small, punctate accumulations within the cytoplasm. The time
course of 2AR redistribution assessed by confocal
microscopy paralleled that of 2AR sequestration measured
by radioligand binding. Importantly, internalized 2ARs
colocalized with transferrin receptors, suggesting that sequestered
2ARs undergo processing through endosomal compartments in a manner similar to that observed for constitutively internalized receptors.
Advances in the development of proteins conjugated with green
fluorescent protein (GFP) have since provided the opportunity for real
time optical analysis of protein trafficking events in individual cells
(13-15). Green fluorescent protein is a naturally occurring protein
isolated from several different species of jellyfish (Aequoria) and sea cucumbers (Renilla). When
expressed in cells, proteins conjugated with GFP may be visualized with
routine fluorescent microscopy without the need to fix cells. Recently,
Barak et al. (16) established the utility of a
2AR-GFP fusion protein in visualizing agonist-mediated
2AR internalization in HEK293 cells transiently
expressing the construct. This study also demonstrated that
2AR-GFP is fully functional with regard to ligand
binding and adenylyl cyclase stimulation and that it can undergo
agonist-dependent phosphorylation and sequestration. Here
we demonstrate that stable expression of 2AR-GFP in HeLa
cells enables a detailed temporal and spatial analysis of
2AR trafficking events associated with receptor
sequestration, down-regulation, and recycling. Colocalization of the
2AR-GFP with rhodamine-labeled transferrin and
rhodamine-labeled dextran during agonist treatment revealed sequential
localization of receptor in cellular compartments containing these
compounds. Moreover, this system appears capable of distinguishing the
differing effects of various -agonists (including the highly
hydrophobic ligand salmeterol) on 2AR trafficking,
overcoming some of the limitations in previous analyses of these
compounds.
 |
EXPERIMENTAL PROCEDURES |
Construction of a 2AR-GFP Fusion Expression
Construct--
To create a Flag-tagged 2AR-GFP fusion
protein, PCR was used to amplify both the 2AR and
Aequoria victoria GFP-S65T. An amino-terminal
2AR primer, TGCGCGCCATGGGGCAAC, was combined with a
primer designed against the carboxyl terminus,
GCTCTAGACAGCAGTGAGTCATTTGT, in which the stop codon is replaced by an
XbaI site that encodes two extra amino acids, serine and
arginine. Similarly, primers were designed to amplify GFP from the
phGFP-S65T template (CLONTECH) with an
XbaI site at the NH2 terminus,
GCTCTAGAATGGTGAGCAAGGGCGAG, and a SalI site at the COOH
terminus, AAGCTTGTCGACTTACTTGTACAGCTCGTC. The two PCR products were cut
with NcoI/XbaI for the 2AR or
XbaI/SalI for the GFP and subcloned into
NcoI/SalI digested pBCflag 2AR (provided by B. Kobilka). An NcoI/NcoI fragment
of the pBC backbone was recloned in, and to circumvent sequencing the
entire open reading frame of the 2AR, an
NcoI/EcoRV region was replaced with that portion
of the original pBCflag 2AR construct. The final ligated
product was sequenced through the regions that were generated by PCR.
This construct was further modified by exchanging a small HindIII/NcoI fragment containing the region
encoding the flag epitope with an identical fragment generated by PCR
that contains a Kozak consensus sequence for translation initiation
(ACCATGG). For the present studies, the region
encoding the entire Flag-tagged 2AR-GFP fusion was
removed with HindIII/SalI and cloned into the
BamHI site of pcDNA3 (Invitrogen) using BamHI
linkers. This final construct, pcDNA3- 2AR-GFP, was
used in transient transfections and for making the stable HeLa cell
line. A Flag-tagged 2AR construct in pcDNA3 was
created by digesting pBCflag 2AR with SalI
followed by Klenow to blunt the 3 end. The insert was excised with
HindIII and the ~2-kilobase fragment was ligated into
HindIII/EcoRV digested pcDNA3.
Transient and Stable Transfection of HeLa Cells--
HeLa cells
were maintained in Dulbecco's modified Eagle's medium (Life
Technologies, Inc.) supplemented with 10-15% fetal bovine serum, 100 units/ml penicillin G, and 100 µg/ml streptomycin sulfate at 37 °C
in a humidified atmosphere of 95% air/5% CO2. Cells grown
to 80-90% confluence were transfected with 10 µg of pcDNA3- 2AR-GFP using 65 µl of LipofectAMINE
reagent (Life Technologies, Inc.) per T75 flask, according to the
manufacturer's instructions. Briefly, HeLa cells were incubated with a
DNA/LipofectAMINE mixture for 3-4 h, the media were replaced, and the
cells were analyzed 48 h after transfection. For stable
transfections, 10 µg of PvuI linearized
pcDNA3- 2AR-GFP was used to transfect HeLa cells.
Three days after transfection, cells were trypsinized, diluted, and replated in media supplemented with 1 mg/ml Geneticin (Life
Technologies, Inc.). Media were subsequently replaced every 3 days with
complete media containing 0.5 mg/ml Geneticin. Stable transformants
were isolated approximately 2 weeks after transfection, and clonal expression was confirmed by examining cells grown on coverslips by
fluorescent microscopy.
cAMP Assays--
cAMP assays were performed using CHW cells
(provided by R. Lefkowitz), a hamster fibroblast line that does not
express endogenous 2ARs. CHW cells were transfected
using a modification of an adenovirus-assisted transfection procedure
(17). Briefly, harvested cells in Dulbecco's modified Eagle's medium
containing 2% fetal bovine serum were mixed with 40 µg/ml
DEAE-dextran, 100 µl of replication-defective adenovirus (GPT-Ad5; a
gift from P. Garcia), and 2 µg of plasmid DNA. Transfected cells were
passaged the next day onto 12-well plates, and experiments examining
agonist-mediated cAMP production were performed 5 days after
transfection. Cells were washed with phosphate-buffered saline (PBS)
and stimulated at 37 °C for 10 min with 500 µl of PBS containing
300 µM ascorbic acid, 1 mM
isobutylmethylxanthine, and no addition (basal),
10 11-10 4 M ( )-isoproterenol,
or 100 µM forskolin. Reactions were stopped by placing
the plates on ice, aspirating the media, and adding 500 µl of
ice-cold ethanol. The contents of each well were collected, lyophilized, resuspended, and assayed for cAMP content by
radioimmunoassay using [125I]cAMP (NEN Life Science
Products) and anti-cAMP antibody (a gift from M. Ascoli) as described
previously (18).
2AR Binding and Ligand Competition
Assays--
For determination of 2AR density in control
and transfected cells, whole cells were harvested with trypsin/EDTA, or
membranes were prepared (for competition binding assays). Whole cells
were incubated in PBS containing 200 pM
[125I]iodopindolol (NEN Life Science Products, 2200 Ci/mmol) ± 10 µM ( )-alprenolol at 37 °C for 1 h as described previously (18). Competition binding studies on cell
membranes were performed as described previously (18). Briefly, cells
were collected into cold homogenization buffer (25 mM Tris,
pH 7.5, 5 mM EDTA, 1 mM EGTA, 0.02 mg/ml
leupeptin, 0.2 mg/ml benzamidine, 0.5 mM
phenylmethylsulfonyl fluoride) and homogenized by Polytron disruption.
Homogenates were centrifuged, washed, resuspended, and assayed.
Approximately 5 µg (transfected cells) or 50 µg (untransfected
cells) of membrane protein were incubated at 37 °C for 1 h with
30 pM [125I]iodopindolol in the presence of
10 11-10 4 M ( )-isoproterenol.
For down-regulation studies, cells were treated with isoproterenol for
various times, washed, and homogenized in lysis buffer (20 mM Tris, pH 8, 5 mM EDTA, 2 mM
EGTA, 5 µg/ml leupeptin, 0.2 mg/ml benzamidine) using a Polytron
(2 × 30 s at 25,000 rpm), and approximately 50 µg of
lysate were incubated at 37 °C for 1 h with 1 nM
[125I]iodopindolol. All binding reactions were terminated
by the addition of 5 × 4 ml of ice-cold 25 mM Tris,
pH 7.5, 2 mM MgCl2 followed by filtration
through Whatman GF/C filters using a Brandel cell harvester.
2AR Sequestration Assays--
HeLa cells stably
expressing 2AR-GFP were grown to 80-90% confluence,
and internalization of receptor was assayed as described previously
using the hydrophilic ligand [3H]CGP-12177 (3). Briefly,
cells were harvested by trypsinization, resuspended in PBS, and
incubated at 37 °C for 0-60 min with 10 µM
( )-isoproterenol. Incubations were stopped by the addition of
ice-cold PBS, and cells were washed thoroughly with cold PBS. Cells
were resuspended in cold PBS, and cell surface 2AR
density was assessed in binding assays using 10-15 nM
[3H]CGP-12177 ± 10 µM ( )-alprenolol
at 14 °C for 3 h. For sequestration studies in transiently
transfected HeLa cells, cells were harvested 48 h after
transfection, incubated at 37 °C for 30 min with 1 µM
( )-isoproterenol, and then assayed for cell surface receptors using
[3H]CGP-12177 following a 0-, 20-, or 60-min agonist
washout.
Fluorescence Microscopy and Single Cell Time
Courses--
Fluorescence microscopy was performed on a Bio-Rad
MRC-Zeiss Axiovert 100 confocal microscope (Hemmelholsteadt, UK), using a Zeiss Plan-Apo 63 × 1.40 NA oil immersion objective. Cells were grown on glass coverslips and mounted on an imaging chamber (Warner Instrument Corp) with an inlet port through which media and drugs could
be perfused. The media used for microscopy did not contain phenol red
or antibiotics. For time course studies, the temperature was maintained
at 37 ± 1 °C using an adjustable warm air flow and digital
temperature probe (Yellow Springs Instrument Co., Inc.). For labeling
of the lysosomal compartments, cells were incubated overnight with 1 mg/ml rhodamine-labeled dextran (Molecular Probes, Eugene, OR) on glass
coverslips. The dextran was washed out of cells by rinsing once with
media and then placing fresh media on cells 1.5 h before imaging.
Agonists were added to the media and/or rhodamine-dextran mixes,
depending on the treatment. For the transferrin experiments, the cells
were incubated in media lacking serum for 30 min, followed by
incubation with 20 or 200 µg/ml rhodamine-labeled transferrin for
30-60 min at 37 °C before imaging. The rhodamine-transferrin was
only briefly rinsed off of cells three times with PBS before imaging.
Incubations were timed so that agonist exposure end points coincided
with the rhodamine-dextran or -transferrin loading and washing
procedure end points. Cells for the rhodamine colocalization studies
were rinsed quickly three times with PBS, incubated for 10 min at room
temperature in 3.7% formaldehyde to fix, rinsed again in PBS, and
mounted on a microscope slide with SlowfadeTM mounting medium
(Molecular Probes) before imaging by confocal microscopy.
 |
RESULTS AND DISCUSSION |
Pharmacological and Functional Properties of
2AR-GFP--
The complete GFP-S65T open reading frame
was directly fused to the carboxyl terminus of a flag-tagged
2AR. Preliminary experiments were then performed to
establish the suitability of 2AR-GFP as a model.
Radioligand binding experiments using HeLa cells transiently expressing
the receptor constructs demonstrated pharmacological properties of
2AR-GFP that were similar to those observed for the wild
type 2AR. Competition of
[125I]iodopindolol binding with isoproterenol revealed
comparable IC50 values (~50 nM) measured
using cells expressing either 2AR-GFP or wild type
2AR (Fig. 1A).
Similar results were also obtained by Barak et al. (16),
although calculated Ki values for both
2AR-GFP and wild type 2AR expressed in
HEK293 cells were considerably higher, perhaps reflecting differences
in receptor-G protein coupling between the respective model cells.

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 1.
A, competition binding in transiently
transfected HeLa cells. Wild type 2AR and
2AR-GFP were expressed transiently in HeLa cells using
LipofectAMINE to levels of ~2 and 3.5 pmol/mg membrane protein,
respectively (25-40-fold above endogenous 2AR levels in
HeLa cells). Binding experiments contained 30 pM
[125I]iodopindolol, which was competed with the indicated
concentrations of isoproterenol. Results represent duplicate binding
assays. B, cyclic AMP generation in CHW cells. Receptors
were expressed transiently in CHW cells as described under
"Experimental Procedures," and the cells were then treated with
various concentrations of isoproterenol for 10 min at 37 °C. cAMP
was assayed by radioimmunoassay and was compared with
receptor-independent cAMP levels generated by incubation with 10 µM forskolin. Results represent the means ± S.E. of
two experiments performed in duplicate. The wild type 2AR and 2AR-GFP were expressed at ~600
and 500 fmol/mg protein, respectively, likely accounting for the
slightly higher response of the wild type receptor. C,
agonist-promoted sequestration of 2AR-GFP. HeLa cells
stably expressing 2AR-GFP (~200 fmol/mg protein) were
treated for the indicated times with 10 µM isoproterenol, and binding to the hydrophilic ligand [3H]CGP-12177 was
assessed. Binding at various time points was compared with the
unstimulated cells. Results represent the the means ± S.E. of
four experiments performed in triplicate. D, down-regulation in HeLa cells stably expressing 2AR-GFP. HeLa cells
stably expressing 2AR-GFP (~200 fmol/mg protein) were
treated for the indicated times with 10 µM isoproterenol,
the cells were washed and lysed in a hypotonic buffer, and binding to
the hydrophobic antagonist [125I]iodopindolol was
assessed. Results represent the the means ± S.E. of three to six
experiments performed in triplicate.
|
|
The capacity of 2AR-GFP to promote agonist-mediated cAMP
production was also examined (Fig. 1B). CHW cells, which
lack endogenous 2ARs, were transiently transfected with
either wild type 2AR or 2AR-GFP, and the
dose-dependent response to isoproterenol was examined.
Isoproterenol was both efficacious (maximal cAMP reached approximately
2.5-fold basal) and potent (EC50 = ~1-2 nM)
in stimulating cAMP production in cells expressing
2AR-GFP. Moreover, 2AR-GFP responsiveness
was similar to that observed for the wild type 2AR.
Collectively, these data suggest that fusion of the 238-amino acid GFP
protein to the carboxyl terminus of the 2AR does not
alter the salient pharmacological or functional properties of the
receptor.
Assessment of agonist-mediated internalization of
2AR-GFP was performed in HeLa cells stably expressing
2AR-GFP at ~200 fmol/mg protein (Fig. 1C).
Cells were pretreated with 10 µM isoproterenol for 0-60
min, and cell surface 2AR density was subsequently
assessed using the hydrophilic -antagonist
[3H]CGP-12177. The results demonstrate a classical
time-dependent sequestration of 2ARs. Within
15 min of agonist treatment an ~30% loss of cell surface receptors
was observed, reaching ~50% by 60 min. These results are also
comparable with those observed by Barak et al., in which
flow cytometry was used to measure agonist-mediated sequestration (16).
In addition, these results imply that mechanisms involving the acute
trafficking events of the wild type 2AR (3) appear
applicable to 2AR-GFP. Indeed when transiently expressed in COS-1 cells, agonist-mediated 2AR-GFP internalization
was enhanced by co-expression of -arrestin (data not shown). These results suggest that -arrestin is capable of binding to the
2AR-GFP and mediating its internalization, as has been
observed with the wild type 2AR (2, 3).
Alterations in cellular 2AR content following chronic
exposure to -agonist were subsequently determined in HeLa cells
(Fig. 1D). Cells were treated with 10 µM
isoproterenol for 0-24 h, and total 2AR density was
measured in crude cell lysates by radioligand binding using the
hydrophobic -antagonist [125I]iodopindolol. As with
the sequestration data, the temporal profile of 2AR-GFP
down-regulation was typical of that observed for wild type
2AR expressed in various cell systems (19, 20).
Visualization of Time-dependent Trafficking of
2AR-GFP--
Having established 2AR-GFP
as an appropriate model of 2AR function and trafficking,
we subsequently performed experiments designed to visualize the
subcellular distribution of 2AR-GFP following acute and
chronic exposure to -agonist. These experiments were performed using
HeLa cells in which stable transfection of 2AR-GFP
resulted in expression levels of 200-700 fmol/mg protein. Examination
of numerous cells suggests that the 2AR-GFP is diffusely distributed on the cell surface before agonist treatment (seen in Fig.
2, left panels in
top and bottom rows). However, significant perinuclear staining was also visible in some cells (e.g.
Fig. 2, bottom row). Cyclohexamide treatment reveals that
although some of the perinuclear staining is likely due to Golgi
localization of receptors, some receptors are also in a presently
unknown cellular compartment.

View larger version (89K):
[in this window]
[in a new window]
|
Fig. 2.
Visualization of receptor internalization and
recycling. HeLa cells stably expressing 2AR-GFP
were observed using fluorescence confocal microscopy during stimulation
with the agonist isoproterenol. Top row, single cell before
treatment and after 5, 10, and 20 min of exposure to 10 µM isoproterenol. Bottom row, single cell
before treatment, after 10 min of exposure to isoproterenol, and 10 and
20 min after replacement of the isoproterenol with 10 µM
alprenolol.
|
|
Initial studies examined the rapid internalization of
2AR-GFP following exposure of HeLa cells to 10 µM isoproterenol (Fig. 2). Fluorescent images obtained
from single cells using confocal microscopy demonstrate the rapid
appearance of a punctate staining pattern with accumulations that
become progressively larger and more numerous over a 20-min course of
agonist exposure (Fig. 2, top row). These images are
consistent with the time course of sequestration suggested by our
radioligand binding data (Fig. 1C) as well as with those
studies utilizing immunocytochemistry of fixed and permeabilized cells
to visualize internalization of epitope-tagged 2ARs (3,
21).
We then observed cells in which a 10-min agonist treatment was followed
by media washout and exposure to the 2AR antagonist alprenolol (Fig. 2, lower panels). Antagonist was included
in the wash to prevent agonist rebinding during the washes. The
punctate localization pattern of the receptor was shown to revert to a more diffuse pattern within 20 min of agonist removal, suggesting that
receptors are recycling back to the plasma membrane. Radioligand binding experiments in transiently transfected HeLa cells indicate that
the return of the 2AR-GFP to the cell surface after
agonist removal is temporally and quantitatively similar to that of the wild type 2AR (Fig. 3).
However, complete recycling of internalized receptor was not observed
until 60 min after agonist washout. Our findings agree with other
pharmacological studies, suggesting that the receptor relocalizes to
the plasma membrane upon removal of agonist (7), and with results from
immunocytochemistry experiments using fixed cells (21). The ability to
observe this process in live cells should provide unique insight into
receptor recycling, and what signals, if any, affect this dynamic
process.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 3.
Sequestration and recycling of receptors as
assessed by radioligand binding. HeLa cells transiently expressing
2AR or 2AR-GFP (2-5 pmol/mg protein)
were treated with agonist only or agonist followed by a wash period
with warm media. Cells were then harvested by trypsinization and washed
in PBS, and cell surface receptor levels were assessed using
[3H]CGP-12177. The level of cell surface receptor loss
was calculated by comparison with untreated cells. Results represent
the means ± S.E. of three experiments performed in duplicate.
iso, isoproterenol.
|
|
We next examined the localization patterns of 2AR-GFP
induced by exposure to -agonists of differing pharmacological
properties (Fig. 4). We hypothesized that
the rate of observable punctate pattern formation would correlate with
the intrinsic activity and/or onset of action of the various
-agonists tested. The effect of formoterol, a long acting
-agonist of high intrinsic activity and rapid onset of action, on
2AR-GFP redistribution is depicted in Fig.
4A. The rate and pattern of vesicular formation were
comparable with that induced by isoproterenol. Conversely, albuterol, a
short acting agonist with moderate intrinsic activity, exhibited a
slightly slower rate of receptor relocalization than that
observed with either isoproterenol or formoterol (Fig. 4B).
Multiple experiments suggest that cells exposed to albuterol required
approximately 25-30 min to reach a pattern of 2AR-GFP
distribution caused by a 20-min exposure to isoproterenol (Figs. 2 and
4 and data not shown).

View larger version (78K):
[in this window]
[in a new window]
|
Fig. 4.
Observation of single cells during
stimulation with 10 µM RRSS-formoterol (A,
for), 100 µM R-albuterol (B,
alb), and 10 µM R-salmeterol
(C, sal). Numbers above each photo
indicate the length of treatment in min. Photographs represent typical responses observed.
|
|
Most striking, however, were the data obtained using salmeterol, a long
acting -agonist with low instrinsic activity and a very slow rate of
onset of action, characteristics determined in part by the very
hydrophobic nature of the compound (22, 23). Cells exposed to
salmeterol (Fig. 4C) required ~70 min of treatment to
exhibit a level of receptor internalization comparable with that
observed at the 20-min isoproterenol time point. Yet it was possible to
show that salmeterol clearly caused relocalization of receptors to
intracellular vesicles, providing evidence of salmeterol-induced
sequestration not obtainable in previous studies (23, 24). Because
treatment of cells with salmeterol causes stable activation of adenylyl
cyclase that survives extensive wash procedures and sucrose-gradient
purification of plasma membrane fractions (23), radioligand binding is
rendered an unreliable tool for the analysis of salmeterol effects on
2AR trafficking. Here we demonstrate that direct
visualization of 2AR-GFP distribution circumvents the
limitations conferred by salmeterol retention and represents an
important tool in future analyses of this compound.
Colocalization of 2AR-GFP with Rhodamine-labeled
Transferrin and Dextran--
To assess differences in subcellular
localization of 2AR-GFP following acute (sequestration)
versus chronic (associated with down-regulation) exposure to
-agonists, we examined the time-dependent colocalization
of 2AR-GFP with additional fluorescent compounds (rhodamine-labeled transferrin and dextran) known to accumulate in
distinct subcellular compartments. Transferrin primarily internalizes with transferrin receptors and constitutively recycles with the receptors through early endosomes to a recycling compartment and then
back to the cell surface (25). Conversely, dextran has been shown to
specifically accumulate in late endosomes and lysosomes (26). Previous
studies have demonstrated co-localization of transferrin receptors and
an epitope-tagged 2AR following -agonist treatment
(21), whereas dextran has recently been used to demonstrate lysosomal
localization of the thyrotropin-releasing hormone receptor (27). Fig.
5A demonstrates that in
unstimulated cells, the 2AR-GFP distribution displays a
relatively diffuse membrane localization pattern, whereas 20-min
incubation of these cells with transferrin results in accumulation of
transferrin in small vesicles. 30 min after treatment with
isoproterenol, a significant portion of 2AR-GFP is seen
to distribute into early endosomal compartments coincident with the
presence of transferrin (Fig. 5B, colocalization shown in
yellow). In contrast, when cells are exposed to
isoproterenol for 3.5 h followed by a 1-h treatment with
transferrin in the absence of -agonist, minimal co-localization of
2AR-GFP and transferrin is evident (Fig. 5C).
These results demonstrate that under such conditions a large fraction
of the 2AR-GFPs remain in internal vesicles that lack
transferrin receptors, possibly in late endosomes and/or lysosomes.

View larger version (52K):
[in this window]
[in a new window]
|
Fig. 5.
Colocalization of the 2AR-GFP
with transferrin during isoproterenol treatment. HeLa cells stably
expressing the 2AR-GFP were grown onto coverslips,
incubated with rhodamine-labeled transferrin, and treated with 10 µM isoproterenol for the times indicated above each
photograph. A, 20 min of incubation with 20 µg/ml
transferrin only. B, 30 min of incubation with isoproterenol
and 20 µg/ml transferrin. C, 3.5 h of incubation with
isoproterenol followed by 1 h of incubation with 200 µg/ml
transferrin in the absence of isoproterenol. The cells shown were fixed
in formaldehyde and imaged using both fluorescein isothiocyanate and
rhodamine filter sets on a confocal microscope. Images were overlaid
using Photoshop software.
|
|
The agonist- and time-dependent localization of
2AR-GFP with lysosomes is revealed in cells loaded with
rhodamine-labeled dextran. Cells were incubated with 1 mg/ml
rhodamine-labeled dextran for 24 h and then washed for 1.5 h
in the absence of dextran to remove any accumulation in early
endosomes. During the latter portion of these incubations the cells
were also incubated with 10 µM isoproterenol for 30 min,
1 h, 3.5 h, or 24 h prior to fixing the cells.
Unstimulated cells display dextran localized to large vesicles typical
of lysosomes, many of which are centrally located in the cells (Fig.
6, upper left). Following 30 min of isoproterenol exposure, the 2AR-GFP has moved
into early endosomes and shows minimal co-localization with dextran.
After 1 h of isoproterenol treatment, the 2AR-GFP
exhibits significant co-localization with dextran, with this
colocalization increasing somewhat at the 3.5- and 24-h time points.
Cells treated in a time-dependent manner with salmeterol
displayed a similar pattern, although the progression of colocalization
of 2AR-GFP with dextran was slower. Although salmeterol
treatment for 24 h results in images similar to those obtained
with isoproterenol treatment, colocalization of dextran with
2AR-GFP was not evident until after 3 h of
treatment with salmeterol (data not shown), suggesting that the
relatively slow kinetics of salmeterol binding/activation of the
2AR translate into attenuated rates of
2AR sequestration and down-regulation.

View larger version (136K):
[in this window]
[in a new window]
|
Fig. 6.
Colocalization of the 2AR-GFP
with dextran during -agonist treatment. HeLa cells stably
expressing 2AR-GFP were grown onto coverslips, incubated
with 1 mg/ml rhodamine-labeled dextran for 24 h, and then washed
in media without dextran for 1.5 h. During the latter portion of
this incubation period, the cells were incubated with 10 µM isoproterenol or salmeterol for the times indicated
above each photograph. Cells were fixed and imaged as described in the
legend to Fig. 4.
|
|
In conclusion, we have utilized 2AR-GFP to visualize
real time cellular redistribution of 2ARs in live cells
responding to agonists. We have demonstrated the rapid colocalization
of the 2AR in transferrin-containing endosomes following
acute -agonist exposure. Following prolonged (but not acute)
exposure to -agonists, 2AR-GFP is shown to colocalize
with dextran in lysosomes. Experiments examining the effects of various
-agonists suggest that 2AR distribution,
sequestration, and down-regulation are regulated by the intrinsic
activity and onset of action of a ligand. In this regard, the
2AR-GFP was especially advantageous for the examination
of the lipophilic compound salmeterol. Our results suggest that GFP
conjugated G protein-coupled receptors are powerful tools for
visualizing the dynamics of receptor trafficking in living cells.
 |
ACKNOWLEDGEMENTS |
We thank Drs. J. Keen and C. Schmutte and
members of the Benovic and Keen labs for helpful discussions, J. Dispoto and P. Hingorani for confocal microscopy, and H. Alder and the
Kimmel Nucleic Acids facility for DNA synthesis and sequencing. We also thank Dr. B. Kobilka for the Flag tagged 2AR construct,
Dr. R. Lefkowitz for CHW cells, Dr. M. Ascoli for the cAMP antibody, Dr. P. Garcia for the GPT-Ad5, and Sepracor Inc. for providing formoterol, albuterol, and salmeterol.
 |
FOOTNOTES |
*
This work was supported in part by National Institutes of
Health Grants GM44944 and GM47417.The costs of publication of this article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Established investigator of the American Heart Association. To
whom correspondence should be addressed: Kimmel Cancer Inst., Thomas
Jefferson University, 233 South 10th St., Philadelphia, PA 19107. Tel.:
215-503-4607; Fax: 215-923-1098; E-mail:
benovic{at}lac.jci.tju.edu.
1
The abbreviations used are: 2AR,
2-adrenergic receptor; GFP, green fluorescent protein;
PCR, polymerase chain reaction; PBS, phosphate-buffered saline.
 |
REFERENCES |
-
Sterne-Marr, R.,
and Benovic, J. L.
(1995)
in
Vitamins and Hormones (Litwack, G., ed), pp. 193-234, Academic Press, New York
-
Ferguson, S. S. G.,
Downey, W. E., III,
Colapietro, A. M.,
Barak, L. S.,
Menard, L.,
Caron, M. G.
(1996)
Science
271,
363-365[Abstract]
-
Goodman, O. B. J.,
Krupnick, J. G.,
Santini, F.,
Gurevich, V. V.,
Penn, R. B.,
Gagnon, A. W.,
Keen, J. H.,
Benovic, J. L.
(1996)
Nature
383,
447-450[CrossRef][Medline]
[Order article via Infotrieve]
-
Pippig, S.,
Andexinger, S.,
and Lohse, M.
(1995)
Mol. Pharmacol.
47,
666-676[Abstract]
-
Krueger, K. M.,
Daaka, Y.,
Pitcher, J. A.,
Lefkowitz, R. J.
(1997)
J. Biol. Chem.
272,
5-8[Abstract/Free Full Text]
-
Toews, M. L.,
Liang, M.,
and Perkins, J. P.
(1987)
Mol. Pharmacol.
32,
737-742[Abstract]
-
Kurz, J. B.,
and Perkins, J. P.
(1992)
Mol. Pharmacol.
41,
375-381[Abstract]
-
Chuang, D. M.
(1982)
Biochem. Biophys. Res. Commun.
105,
1466-1472[CrossRef][Medline]
[Order article via Infotrieve]
-
Waldo, G. L.,
Northup, J. K.,
Perkins, J. P.,
Harden, T. K.
(1983)
J. Biol. Chem.
258,
13900-13908[Abstract/Free Full Text]
-
Wakshull, E.,
Hertel, C.,
O'Keefe, E. J.,
Perkins, J. P.
(1985)
J. Cell. Biochem.
29,
127-141[CrossRef][Medline]
[Order article via Infotrieve]
-
Liao, J.-F.,
and Perkins, J. P.
(1993)
Mol. Pharmacol.
44,
364-370[Abstract]
-
von Zastrow, M.,
and Kobilka, B. K.
(1992)
J. Biol. Chem.
267,
3530-3538[Abstract/Free Full Text]
-
Prasher, D. C.,
Eckenrode, V. K.,
Ward, W. W.,
Prendergast, F. G.,
Cormier, M. J.
(1992)
Gene (Amst.)
111,
229-233[CrossRef][Medline]
[Order article via Infotrieve]
-
Kain, S. R.,
Adams, M.,
Kondepudi, A.,
Yang, T.-T.,
Ward, W. W.,
Kitts, P.
(1995)
BioTechniques
19,
650-654 [Medline]
[Order article via Infotrieve]
-
Inouye, S.,
and Tsuji, F. I.
(1994)
FEBS Lett.
341,
277-280[CrossRef][Medline]
[Order article via Infotrieve]
-
Barak, L. S.,
Ferguson, S. S. G.,
Zhang, J.,
Martenson, C.,
Meyer, T.,
and Caron, M. G.
(1997)
Mol. Pharmacol.
51,
177-184[Abstract/Free Full Text]
-
Forsayeth, J. R.,
and Garcia, P. D.
(1994)
BioTechniques
17,
354-358 [Medline]
[Order article via Infotrieve]
-
Penn, R. B.,
Kelsen, S. G.,
and Benovic, J. L.
(1994)
Am. J. Respir. Cell Mol. Biol.
11,
496-505[Abstract]
-
Hausdorff, W. P.,
Campbell, P. T.,
Ostrowski, J.,
Yu, S. S.,
Caron, M. G.,
Lefkowitz, R. J.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
2979-2983[Abstract/Free Full Text]
-
Valiquette, M.,
Bonin, H.,
Hnatowich, M.,
Caron, M. G.,
Lefkowitz, R. J.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
5089-5093[Abstract/Free Full Text]
-
von Zastrow, M.,
and Kobilka, B. K.
(1994)
J. Biol. Chem.
269,
18448-18452[Abstract/Free Full Text]
-
Linden, A.,
Rabe, K. G.,
and Lofdahl, C.-G.
(1996)
Lung
174,
1-22[Medline]
[Order article via Infotrieve]
-
Clark, R. B.,
Allal, C.,
Friedman, J.,
Johnson, M.,
and Barber, R.
(1996)
Mol. Pharmacol.
49,
182-189[Abstract]
-
Green, S. A.,
Spasoff, A. P.,
Coleman, R. A.,
Johnson, M.,
Liggett, S. B.
(1996)
J. Biol. Chem.
271,
24029-24035[Abstract/Free Full Text]
-
Schmid, S. L.,
Fuchs, R.,
Male, P.,
and Mellman, I.
(1988)
Cell
52,
73-83[CrossRef][Medline]
[Order article via Infotrieve]
-
Ohkuma, S.,
and Poole, B.
(1978)
Proc. Natl. Acad. Sci. U. S. A.
75,
3327-3331[Abstract/Free Full Text]
-
Petrou, C.,
Chen, L.,
and Tashjian, A. H., Jr.
(1997)
J. Biol. Chem.
272,
2326-2333[Abstract/Free Full Text]
Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
M. Scarselli and J. G. Donaldson
Constitutive Internalization of G Protein-coupled Receptors and G Proteins via Clathrin-independent Endocytosis
J. Biol. Chem.,
February 6, 2009;
284(6):
3577 - 3585.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Adachi, T. Nagao, S. To, A. K. Joe, M. Shimizu, R. Matsushima-Nishiwaki, O. Kozawa, H. Moriwaki, F. R. Maxfield, and I.B. Weinstein
(-)-Epigallocatechin gallate causes internalization of the epidermal growth factor receptor in human colon cancer cells
Carcinogenesis,
October 1, 2008;
29(10):
1986 - 1993.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Stanasila, L. Abuin, J. Dey, and S. Cotecchia
Different Internalization Properties of the {alpha}1a- and {alpha}1b-Adrenergic Receptor Subtypes: The Potential Role of Receptor Interaction with {beta}-Arrestins and AP50
Mol. Pharmacol.,
September 1, 2008;
74(3):
562 - 573.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. M. Awumey, A. C. Howlett, J. W. Putney Jr., D. I. Diz, and R. D. Bukoski
Ca2+ mobilization through dorsal root ganglion Ca2+-sensing receptor stably expressed in HEK293 cells
Am J Physiol Cell Physiol,
May 1, 2007;
292(5):
C1895 - C1905.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Kilianova, N. Basora, P. Kilian, M. D. Payet, and N. Gallo-Payet
Human Melanocortin Receptor 2 Expression and Functionality: Effects of Protein Kinase A and Protein Kinase C on Desensitization and Internalization
Endocrinology,
May 1, 2006;
147(5):
2325 - 2337.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Lamian, A. Rich, Z. Ma, J. Li, R. Seethala, D. Gordon, and Y. Dubaquie
Characterization of Agonist-Induced Motilin Receptor Trafficking and Its Implications for Tachyphylaxis
Mol. Pharmacol.,
January 1, 2006;
69(1):
109 - 118.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Osawa, M. Kajimura, S. Yamamoto, M. Ikuma, C. Mochizuki, H. Iwasaki, A. Hishida, and S. Terakawa
Alteration of intracellular histamine H2 receptor cycling precedes antagonist-induced upregulation
Am J Physiol Gastrointest Liver Physiol,
November 1, 2005;
289(5):
G880 - G889.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Krasel, M. Bunemann, K. Lorenz, and M. J. Lohse
{beta}-Arrestin Binding to the {beta}2-Adrenergic Receptor Requires Both Receptor Phosphorylation and Receptor Activation
J. Biol. Chem.,
March 11, 2005;
280(10):
9528 - 9535.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. H. Moore, E. E. Millman, E. Alpizar-Foster, W. Dai, and B. J. Knoll
Rab11 regulates the recycling and lysosome targeting of {beta}2-adrenergic receptors
J. Cell Sci.,
July 1, 2004;
117(15):
3107 - 3117.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-G. Chen, S. Pandey, J. Huang, J. M. Alonso, J. R. Ecker, S. M. Assmann, and A. M. Jones
GCR1 Can Act Independently of Heterotrimeric G-Protein in Response to Brassinosteroids and Gibberellins in Arabidopsis Seed Germination
Plant Physiology,
June 1, 2004;
135(2):
907 - 915.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Wiejak, L. Surmacz, and E. Wyroba
Dynamin-association with agonist-mediated sequestration of beta-adrenergic receptor in single-cell eukaryote Paramecium
J. Exp. Biol.,
April 15, 2004;
207(10):
1625 - 1632.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Liang, P. K. Curran, Q. Hoang, R. T. Moreland, and P. H. Fishman
Differences in endosomal targeting of human {beta}1- and {beta}2-adrenergic receptors following clathrin-mediated endocytosis
J. Cell Sci.,
February 15, 2004;
117(5):
723 - 734.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. P. Singh, D. McDonald, T. J. Hope, and B. S. Prabhakar
Upon Thyrotropin Binding the Thyrotropin Receptor Is Internalized and Localized to Endosome
Endocrinology,
February 1, 2004;
145(2):
1003 - 1010.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Ott, R. Frischknecht, and A. Pluckthun
Construction and characterization of a kappa opioid receptor devoid of all free cysteines
Protein Eng. Des. Sel.,
January 1, 2004;
17(1):
37 - 48.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Gao, D. Lei, J. Welch, K. Le, J. Lin, S. Leng, and D. Duhl
Agonist-Dependent Internalization of the Human Melanocortin-4 Receptors in Human Embryonic Kidney 293 Cells
J. Pharmacol. Exp. Ther.,
December 1, 2003;
307(3):
870 - 877.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. J. Dupre, Z. Chen, C. Le Gouill, C. Theriault, J.-L. Parent, M. Rola-Pleszczynski, and J. Stankova
Trafficking, Ubiquitination, and Down-regulation of the Human Platelet-activating Factor Receptor
J. Biol. Chem.,
November 28, 2003;
278(48):
48228 - 48235.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Wu, G. Zhao, and Y. He
Distinct Pathways for the Trafficking of Angiotensin II and Adrenergic Receptors from the Endoplasmic Reticulum to the Cell Surface: Rab1-INDEPENDENT TRANSPORT OF A G PROTEIN-COUPLED RECEPTOR
J. Biol. Chem.,
November 21, 2003;
278(47):
47062 - 47069.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Lavine, N. Ethier, J. N. Oak, L. Pei, F. Liu, P. Trieu, R. V. Rebois, M. Bouvier, T. E. Hebert, and H. H. M. Van Tol
G Protein-coupled Receptors Form Stable Complexes with Inwardly Rectifying Potassium Channels and Adenylyl Cyclase
J. Biol. Chem.,
November 22, 2002;
277(48):
46010 - 46019.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Shumay, X. Song, H.-y. Wang, and C. C. Malbon
pp60Src Mediates Insulin-stimulated Sequestration of the beta 2-Adrenergic Receptor: Insulin Stimulates pp60Src Phosphorylation and Activation
Mol. Biol. Cell,
November 1, 2002;
13(11):
3943 - 3954.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Ohshima, S. Ishii, T. Izumi, and T. Shimizu
Receptor-dependent Metabolism of Platelet-activating Factor in Murine Macrophages
J. Biol. Chem.,
March 15, 2002;
277(12):
9722 - 9727.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Burke, K. Schooler, and H. S. Wiley
Regulation of Epidermal Growth Factor Receptor Signaling by Endocytosis and Intracellular Trafficking
Mol. Biol. Cell,
June 1, 2001;
12(6):
1897 - 1910.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Seibold, B. Williams, Z.-F. Huang, J. Friedman, R. H. Moore, B. J. Knoll, and R. B. Clark
Localization of the Sites Mediating Desensitization of the beta 2-Adrenergic Receptor by the GRK Pathway
Mol. Pharmacol.,
November 1, 2000;
58(5):
1162 - 1173.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
T. E. Hughes
Looking at Receptors: What Have Fluorescent Receptors and Channels Told Us?
Neuroscientist,
October 1, 2000;
6(5):
371 - 379.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-G. Li, J. L. Benovic, and L.-Y. Liu-Chen
Mechanisms of Agonist-Induced Down-Regulation of the Human kappa -Opioid Receptor: Internalization Is Required for Down-Regulation
Mol. Pharmacol.,
October 1, 2000;
58(4):
795 - 801.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
R. Chen, Y. V. Mukhin, M. N. Garnovskaya, T. E. Thielen, Y. Iijima, C. Huang, J. R. Raymond, M. E. Ullian, and R. V. Paul
A functional angiotensin II receptor-GFP fusion protein: evidence for agonist-dependent nuclear translocation
Am J Physiol Renal Physiol,
September 1, 2000;
279(3):
F440 - F448.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. I. Tsao and M. von Zastrow
Type-specific Sorting of G Protein-coupled Receptors after Endocytosis
J. Biol. Chem.,
April 6, 2000;
275(15):
11130 - 11140.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Wang, R. T. Windh, C. A. Chen, and D. R. Manning
N-Myristoylation and beta gamma Play Roles beyond Anchorage in the Palmitoylation of the G Protein alpha o Subunit
J. Biol. Chem.,
December 24, 1999;
274(52):
37435 - 37442.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. J. McLean, N. Bevan, S. Rees, and G. Milligan
Visualizing Differences in Ligand Regulation of Wild-Type and Constitutively Active Mutant beta 2-Adrenoceptor-Green Fluorescent Protein Fusion Proteins
Mol. Pharmacol.,
December 1, 1999;
56(6):
1182 - 1191.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
R. Jockers, S. Angers, A. Da Silva, P. Benaroch, A. D. Strosberg, M. Bouvier, and S. Marullo
beta 2-Adrenergic Receptor Down-regulation. EVIDENCE FOR A PATHWAY THAT DOES NOT REQUIRE ENDOCYTOSIS
J. Biol. Chem.,
October 8, 1999;
274(41):
28900 - 28908.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Dzimiri
Regulation of beta -Adrenoceptor Signaling in Cardiac Function and Disease
Pharmacol. Rev.,
September 1, 1999;
51(3):
465 - 502.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. B. Wheeler, R. W. Gelling, S. A. Hinke, B. Tu, R. A. Pederson, F. Lynn, J. Ehses, and C. H. S. McIntosh
Characterization of the Carboxyl-terminal Domain of the Rat Glucose-dependent Insulinotropic Polypeptide (GIP) Receptor. A ROLE FOR SERINES 426 AND 427 IN REGULATING THE RATE OF INTERNALIZATION
J. Biol. Chem.,
August 27, 1999;
274(35):
24593 - 24601.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. A. Groarke, S. Wilson, C. Krasel, and G. Milligan
Visualization of Agonist-induced Association and Trafficking of Green Fluorescent Protein-tagged Forms of Both beta -Arrestin-1 and the Thyrotropin-releasing Hormone Receptor-1
J. Biol. Chem.,
August 13, 1999;
274(33):
23263 - 23269.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Schwencke, M. Yamamoto, S. Okumura, Y. Toya, S.-J. Kim, and Y. Ishikawa
Compartmentation of Cyclic Adenosine 3',5'-Monophosphate Signaling in Caveolae
Mol. Endocrinol.,
July 1, 1999;
13(7):
1061 - 1070.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
O. Dery, M. S. Thoma, H. Wong, E. F. Grady, and N. W. Bunnett
Trafficking of Proteinase-activated Receptor-2 and beta -Arrestin-1 Tagged with Green Fluorescent Protein. beta -ARRESTIN-DEPENDENT ENDOCYTOSIS OF A PROTEINASE RECEPTOR
J. Biol. Chem.,
June 25, 1999;
274(26):
18524 - 18535.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. McConalogue, O. Dery, M. Lovett, H. Wong, J. H. Walsh, E. F. Grady, and N. W. Bunnett
Substance P-induced Trafficking of beta -Arrestins. THE ROLE OF beta -ARRESTINS IN ENDOCYTOSIS OF THE NEUROKININ-1 RECEPTOR
J. Biol. Chem.,
June 4, 1999;
274(23):
16257 - 16268.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Barlic, M. H. Khandaker, E. Mahon, J. Andrews, M. E. DeVries, G. B. Mitchell, R. Rahimpour, C. M. Tan, S. S. G. Ferguson, and D. J. Kelvin
beta -Arrestins Regulate Interleukin-8-induced CXCR1 Internalization
J. Biol. Chem.,
June 4, 1999;
274(23):
16287 - 16294.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Maamra, J. Finidori, S. Von Laue, S. Simon, S. Justice, J. Webster, S. Dower, and R. Ross
Studies with a Growth Hormone Antagonist and Dual-fluorescent Confocal Microscopy Demonstrate that the Full-length Human Growth Hormone Receptor, but Not the Truncated Isoform, Is Very Rapidly Internalized Independent of Jak2-Stat5 Signaling
J. Biol. Chem.,
May 21, 1999;
274(21):
14791 - 14798.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-G. Li, L.-Y. Luo, J. G. Krupnick, J. L. Benovic, and L.-Y. Liu-Chen
U50,488H-induced Internalization of the Human {kappa} Opioid Receptor Involves a {beta}-Arrestin- and Dynamin-dependent Mechanism. {kappa} RECEPTOR INTERNALIZATION IS NOT REQUIRED FOR MITOGEN-ACTIVATED PROTEIN KINASE ACTIVATION
J. Biol. Chem.,
April 23, 1999;
274(17):
12087 - 12094.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. R. Conway, L. K. Minor, J. Z. Xu, J. W. Gunnet, R. DeBiasio, M. R. D'Andrea, R. Rubin, R. DeBiasio, K. Giuliano, L. Zhou, et al.
Quantification of G-Protein Coupled Receptor Internalization Using G-Protein Coupled Receptor-Green Fluorescent Protein Conjugates with the ArrayScanTM High-Content Screening System
J Biomol Screen,
April 1, 1999;
4(2):
75 - 86.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
J. del Valle
CCK receptor trafficking: a novel paradigm of travel. Focus on "Regulation of lateral mobility and cellular trafficking of the CCK receptor by a partial agonist"
Am J Physiol Cell Physiol,
March 1, 1999;
276(3):
C537 - C538.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. J. Stefan and K. J. Blumer
A Syntaxin Homolog Encoded by VAM3 Mediates Down-regulation of a Yeast G Protein-coupled Receptor
J. Biol. Chem.,
January 15, 1999;
274(3):
1835 - 1841.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Moore, A Tuffaha, E. Millman, W Dai, H. Hall, B. Dickey, and B. Knoll
Agonist-induced sorting of human beta2-adrenergic receptors to lysosomes during downregulation
J. Cell Sci.,
January 2, 1999;
112(3):
329 - 338.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
R. E. Carter and A. Sorkin
Endocytosis of Functional Epidermal Growth Factor Receptor-Green Fluorescent Protein Chimera
J. Biol. Chem.,
December 25, 1998;
273(52):
35000 - 35007.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. Orsini and J. L. Benovic
Characterization of Dominant Negative Arrestins That Inhibit beta 2-Adrenergic Receptor Internalization by Distinct Mechanisms
J. Biol. Chem.,
December 18, 1998;
273(51):
34616 - 34622.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. E. Remmers, M. J. Clark, X. Y. Liu, and F. Medzihradsky
Delta Opioid Receptor Down-Regulation Is Independent of Functional G Protein yet Is Dependent on Agonist Efficacy
J. Pharmacol. Exp. Ther.,
November 1, 1998;
287(2):
625 - 632.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
M. J. Shapiro and S. R. Coughlin
Separate Signals for Agonist-independent and Agonist-triggered Trafficking of Protease-activated Receptor 1
J. Biol. Chem.,
October 30, 1998;
273(44):
29009 - 29014.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Drmota, G. W. Gould, and G. Milligan
Real Time Visualization of Agonist-mediated Redistribution and Internalization of a Green Fluorescent Protein-tagged Form of the Thyrotropin-releasing Hormone Receptor
J. Biol. Chem.,
September 11, 1998;
273(37):
24000 - 24008.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. B. Lee, R. Pals-Rylaarsdam, J. L. Benovic, and M. M. Hosey
Arrestin-independent Internalization of the m1, m3, and m4 Subtypes of Muscarinic Cholinergic Receptors
J. Biol. Chem.,
May 22, 1998;
273(21):
12967 - 12972.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. W. Gagnon, L. Kallal, and J. L. Benovic
Role of Clathrin-mediated Endocytosis in Agonist-induced Down-regulation of the beta 2-Adrenergic Receptor
J. Biol. Chem.,
March 20, 1998;
273(12):
6976 - 6981.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Kuwasako, Y. Shimekake, M. Masuda, K. Nakahara, T. Yoshida, M. Kitaura, K. Kitamura, T. Eto, and T. Sakata
Visualization of the Calcitonin Receptor-like Receptor and Its Receptor Activity-modifying Proteins during Internalization and Recycling
J. Biol. Chem.,
September 15, 2000;
275(38):
29602 - 29609.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. E. Hughes, H. Zhang, D. E. Logothetis, and C. H. Berlot
Visualization of a Functional Galpha q-Green Fluorescent Protein Fusion in Living Cells. ASSOCIATION WITH THE PLASMA MEMBRANE IS DISRUPTED BY MUTATIONAL ACTIVATION AND BY ELIMINATION OF PALMITOYLATION SITES, BUT NOT BY ACTIVATION MEDIATED BY RECEPTORS OR AlF4-
J. Biol. Chem.,
February 2, 2001;
276(6):
4227 - 4235.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Shiina, K. Arai, S. Tanabe, N. Yoshida, T. Haga, T. Nagao, and H. Kurose
Clathrin Box in G Protein-coupled Receptor Kinase 2
J. Biol. Chem.,
August 24, 2001;
276(35):
33019 - 33026.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. B. Penn, R. M. Pascual, Y.-M. Kim, S. J. Mundell, V. P. Krymskaya, R. A. Panettieri Jr., and J. L. Benovic
Arrestin Specificity for G Protein-coupled Receptors in Human Airway Smooth Muscle
J. Biol. Chem.,
August 24, 2001;
276(35):
32648 - 32656.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1998 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|