![]()
|
|
||||||||
Vol. 273, Issue 1, 618-626, January 2, 1998
From the Stromelysin-3 (STR-3) is a recently characterized
matrix metalloproteinase (MMP) with a unique pattern of expression and
substrate specificity. Unlike other MMPs, STR-3 is consistently and
dramatically overexpressed by multiple epithelial malignancies,
including carcinomas of the breast, lung, colon, head and neck, and
skin. Recent studies suggest that STR-3 promotes the local
establishment of epithelial malignancies, contributing to tumor cell
survival and implantation in host tissues; however, STR-3's mechanism
of action remains undefined. STR-3 is a stromal cell product, prompting
speculation that infiltrating stromal cells secrete STR-3 in response
to tumor-derived factors. To explore this possibility, we developed a
tumor/"stroma" coculture assay in which non-small cell lung cancer
(NSCLC) cell lines were grown on confluent monolayers of normal
pulmonary fibroblasts. In these tumor/stroma cocultures, NSCLCs
stimulate normal pulmonary fibroblasts to secrete STR-3 and release
extracellular basic fibroblast growth factor. Thereafter, STR-3 is
processed at a unique internal sequence via a basic fibroblast growth
factor- and MMP-dependent mechanism to a previously
unidentified 35-kDa protein that lacks enzymatic activity. 35-kDa STR-3
is the most abundant STR-3 protein in tumor/stroma cocultures and is
only detected when normal pulmonary fibroblasts are cultured with
malignant bronchial epithelial cells. Therefore, the tumor-specific
processing of STR-3 to the 35-kDa protein is likely to be an important
regulatory mechanism.
Matrix metalloproteinases
(MMP)1 are
zinc-dependent endopeptidases that promote the local
invasion and distant metastasis of epithelial malignancies and the
neovascularization of tumor cell deposits (1-5) and participate in
normal tissue remodeling (6). Currently recognized families of MMPs
include collagenases, gelatinases, stromelysins, membrane-type MMPs,
and additional single enzymes such as matrilysin and metalloelastase;
these enzymes differ in substrate specificity, regulation,
tissue-specific expression, and potential interactions with additional
MMP family members (2, 3).
Stromelysin-3 (STR-3) (MMP-11) is a recently characterized MMP with a
unique pattern of expression and substrate specificity (7, 8). The
enzyme was originally isolated on the basis of its overexpression in
primary breast cancers and identified as a MMP family member because of
its predicted amino acid (aa) sequence (7). Like other MMPs, STR-3 has
a highly conserved "pro" domain which is cleaved when the enzyme is
converted to its active form. STR-3 also contains a characteristic
catalytic domain with a zinc-binding consensus sequence and a
"hemopexin" domain with sequence similarity to the heme-binding
proteins. However, STR-3 differs from other previously characterized
MMPs that are secreted as inactive zymogens. The STR-3 pro domain
contains an additional recognition site for the Golgi-associated
pro-protein convertase, furin (9). Consequently, the ~60-kDa STR-3
proenzyme is processed within the constitutive secretory pathway and
released as a ~45-kDa active enzyme (9, 10).
The 45-kDa STR-3 protein is currently thought to be the major active
form of the enzyme (9). However, significant questions remain regarding
the biological activity of 45-kDa STR-3. Although STR-3 has the
characteristic structure of a MMP, its substrate specifically differs
markedly from that of other MMP family members (11). A fragment of
recombinant murine STR-3 which lacks the C-terminal hemopexin domain
displays the properties of a weak metalloproteinase (11). However, the
human 45-kDa STR-3 does not degrade classic MMP substrates such as
gelatin, casein, and elastin (8). Moreover, the human STR-3 protein
contains an amino acid substitution in the highly conserved MMP "met
turn" which may alter the activity of the enzyme (12).
To date, the only known substrates for STR-3 are the serine protease
inhibitors (serpins), STR-3 is expressed during normal embryogenesis and the remodeling of
certain adult tissues. In human embryos, STR-3 is expressed in
developing digits (15); in murine embryos, the enzyme is found during
limb, tail, and snout morphogenesis (16). The enzyme is expressed by
stromal elements in contact with epithelial cells in normal embryonic
and adult tissues. In certain settings, STR-3-positive stromal elements
are in contact with epithelial cells undergoing regional apoptosis and
selected cell survival. For example, during frog morphogenesis, STR-3
is specifically expressed in small intestine mesenchyme during a time
in which primary intestinal epithelial cells undergo apoptosis and
replacement by secondary epithelial cells (17). In humans and rodents,
STR-3 is expressed in tissues that undergo extensive remodeling such as
placenta, uterus, and post-lactation mammary glands (18, 19). For
example, female mice who have completed weaning express STR-3 in
involuting mammary glands (18). Taken together, these data suggest that
specific changes in the viability of normal epithelial cells affect the expression of STR-3 in adjacent stroma.
The settings in which STR-3 is normally expressed provide insights
regarding the role of the enzyme in primary tumors. Unlike other MMP
family members, STR-3 is consistently and dramatically overexpressed by
a variety of primary epithelial malignancies, including carcinomas of
the breast, lung, colon, head and neck, and skin (20-25). In our own
recent studies, virtually all newly diagnosed primary non-small cell
lung cancers (NSCLC) expressed significantly higher levels of STR-3
than adjacent normal lung specimens (22). Although STR-3 is
overexpressed in primary and metastatic carcinomas, the enzyme is
synthesized by interdigitating stromal cells (20-25). In primary and
metastatic tumors, STR-3 levels decline as a consequence of the
distance between malignant epithelial and normal stromal cells with the
highest levels of the enzyme at the tumor/stroma interface (7).
STR-3 has also been identified in stromal elements of in
situ carcinomas and precursor lesions and linked with the grade
and local invasiveness of early stage tumors (21, 25). In a series of
precancerous lesions of the respiratory tract, STR-3 was absent in
hyperplastic and metaplastic lesions; in contrast, the enzyme was
frequently expressed in preinvasive (dysplastic and in situ) lesions and uniformly identified in invasive carcinomas (26).
The fact that STR-3 is uniformly expressed by early stage tumors
suggests that the enzyme may participate in the initial development of
these malignancies. Consistent with this hypothesis, STR-3 was recently
shown to promote the establishment of local tumors in nude mice by
contributing to tumor cell implantation and survival in host tissues
(27). Although these recent studies (27) provide the first evidence
that STR-3 promotes local tumor development, the molecular mechanism by
which STR-3 exerts its effects is not yet known. STR-3 appears to be
expressed as a consequence of a specific interaction between malignant
epithelial cells and surrounding stromal elements, suggesting that the
enzyme may participate in the earliest stages of local tumor
development in which malignant epithelial cells traverse the basement
membrane, invade the surrounding stroma, and directly contact normal
stromal elements.
To explore these possibilities in a controlled and easily accessible
system, we developed a tumor/"stroma" coculture assay in which
NSCLC cells are grown on confluent monolayers of normal pulmonary
fibroblasts. In these tumor/stroma cocultures, NSCLC cells stimulate
pulmonary fibroblasts to secrete STR-3 and release bFGF. Following the
release of STR-3 and bFGF, the active 45-kDa STR-3 enzyme is processed
at a unique internal sequence via a bFGF- and MMP-dependent
mechanism to a major 35-kDa protein that lacks enzymatic activity.
Because 35-kDa STR-3 is the most abundant STR-3 protein in tumor/stroma
cocultures and is only detected when normal pulmonary fibroblasts are
cultured with malignant bronchial epithelial cells, these findings
provide additional insights into the regulation and role of STR-3 in
epithelial carcinomas.
Cell Lines--
The A549 and SL-6 human NSCLC cell lines were
maintained in Dulbecco's modified Eagle's medium, 10% FCS, and RPMI,
10% FCS as described previously (28). The SV40-transformed
non-tumorigenic human fetal tracheal epithelial cell line, 56 FHTE, was
cultured on fibronectin (1 mg/100 ml, Life Technologies, Inc.)-coated
plates in Dulbecco's modified Eagle's medium, 10% FCS (28). Normal human pulmonary fibroblasts derived from fetal (ATCC CCL-153) and adult
donors (ATCC CCL-210) were maintained in MEM, 10% FCS (22). All cell
lines were incubated at 37 °C with 5% CO2.
Coculture Assays: Direct Cocultures--
2 × 105 tumor cells (A549) or SV40-transformed non-tumorigenic
tracheal epithelial cells (56 FHTE) were added to confluent monolayers
of fetal (CCL-153) or adult (CCL-210) pulmonary fibroblasts in 6-well
Falcon plates (Becton Dickinson, Franklin Lakes, NJ). The cocultures
were initially incubated for 18 h in MEM, 10% FCS; thereafter,
cocultures were washed twice and incubated in serum-free MEM. In
selected experiments, the serum-free MEM contained PMA (10 µg/ml)
(Sigma), a neutralizing anti-human PDGF-AB polyclonal antibody (25 µg/ml) (UBI, Lake Placid, NY), anti-human bFGF mAb (5 µg/ml) (clone
FB-8, Sigma), anti-human EGF-R mAb (5 µg/ml) (C225, gift from J. Mendelsohn, Memorial Sloan Kettering Cancer Center, New York, NY (29)),
the reversible MMP inhibitor, BB94 (30-32) (British Biotech, Oxford,
UK) in 1% Me2SO, 1% Me2SO alone, or the
serine protease inhibitor aprotinin (33) (10 µg/ml) (Sigma).
Stromelysin-3 Is Induced in Tumor/Stroma Cocultures and
Inactivated via a Tumor-specific and Basic Fibroblast Growth
Factor-dependent Mechanism*
§,
,
,
,
**
Department of Adult Oncology, Dana-Farber
Cancer Institute, Harvard Medical School,
Boston, Massachusetts 02115, the ¶ Department of Environmental
Health, Harvard School of Public Health, Boston, Massachusetts 02115, and the
Institut de Génétique et de Biologie
Moléculaire et Cellulaire (IGBMC), CNRS/INSERM,
U184/Université Louis Pasteur, Strasbourg, 67404 France
![]()
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
1-proteinase inhibitor (
1-PI,
1-antitrypsin), and
2-antiplasmin (8). Because
1-PI is the major circulating inhibitor of elastase, the degradation of
1-PI by
STR-3 may increase elastase-mediated tissue damage. However, additional
MMPs including MMP-1 (tissue collagenase) and MMP-3 (stromelysin-1)
also hydrolyze
1-PI (13). Because STR-3 also degrades
2-antiplasmin, the enzyme could also indirectly increase local
plasmin levels and promote plasmin-mediated conversion of additional
pro-MMPs to their active forms (8). However, the unique aspects of
STR-3 regulation, structure, and function (8, 9, 11, 12, 14) suggest
that the protein has additional as yet undefined biological activities
in normal tissues and epithelial malignancies.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
Transwell Cocultures-- Confluent monolayers of pulmonary fibroblasts were plated in the lower chambers and NSCLC cells in the upper chambers of transwell apparatuses (0.4-µm pore size, Costar, Cambridge, MA). After an initial 18-h incubation in MEM, 10% FCS, the transwell tumor/stroma cocultures were washed, and serum-free media were added as described previously. At designated 24-72-h intervals, conditioned media were harvested, and cell lysates were prepared as indicated.
Western Blots-- Samples of conditioned media and cell lysates were size-fractionated on 10-12.5% SDS-PAGE gels under reducing conditions and transferred to Immobilon P membranes (Millipore, Bedford, MA). The membranes were preincubated for 2 h in blocking buffer (10 mM Tris, pH 7.4, 150 mM NaCl, 0.05% Tween 20, and 5% dry milk) and subsequently incubated for 18 h with selected STR-3 (5ST4A9 or 5ST4C10) (34) or bFGF (clone FB8, Sigma) monoclonal antibodies at final concentrations of 1 µg/ml. After three washes, membranes were incubated with peroxidase-conjugated anti-mouse IgG and developed using enhanced chemiluminescence (Amersham Corp.). Selected autoradiograms were subjected to densitometric analysis (G700 Imaging Densitometer, Bio-Rad).
Centrifugal Elutriation-- After A549 NSCLC cells and CCL-153 fibroblasts were directly cocultured as described above, the fibroblasts and tumor cells were separated by centrifugal elutriation (J.E-5.0 elutriation system, Beckman Instruments, Inc., Fullerton, CA). Cells from the cocultures were trypsinized and washed three times in RPMI 1640 medium containing 1% FCS, 10 mM HEPES, 0.3 mM EDTA, 50 units/ml penicillin, and 50 µg/ml streptomycin at 4 °C. Thereafter, cells were loaded into the elutriation chamber at a pump speed of 8 ml/min (rotor speed 2000 rpm/min) in the same medium. The pump speed was increased slowly to 15 ml/min to achieve an equal distribution of cells in the chamber. After equilibrium was achieved, the pump speed was increased from 20 to 120 ml/min in 5 ml/min increments and 20 sequential 100-ml cell fractions were collected. Collection was completed at a pump speed of 120 ml/min.
To assess the percentage of tumor cells and fibroblasts in each cell fraction, an aliquot of each fraction was added to an individual well of a multichamber glass slide (Lab-Tek chamber slides, Nunc, Naperville, IL); slides were air-dried and immunostained for keratin expression as described previously (22). Thereafter, the 20 individual 100-ml cell fractions were separately centrifuged and lysed for RNA extraction.RNA Preparation and Analysis-- Total RNAs from specific cell fractions were prepared and analyzed as described previously (35). In brief, total RNAs were isolated by acid guanidinium thiocyanate/phenol chloroform extraction (RNA STAT-60 kit, Tel-Test Inc., Friendswood, TX), size-fractionated on a 1% agarose gel under denaturing conditions, and transferred to a nylon membrane (Hybond N+, Amersham Corp.). The blot was then hybridized with a 32P-labeled STR-3 cDNA probe as described previously (22).
2-Macroglobulin Entrapment Assay--
2-Macroglobulin
entrapment was performed as described previously (8). In brief,
aliquots of STR-3-containing conditioned media were incubated with 10 µg of purified human
2-macroglobulin (Sigma) for 18 h at room
temperature in the absence or presence of 5 µm of the broad spectrum
MMP inhibitor, BB-94. Thereafter, samples were size-fractionated on
10% SDS-PAGE gels under non-reducing conditions, blotted, and probed
with the anti-STR-3 mAb 5ST4A9 as described above.
STR-3 Immunoprecipitation-- Antisera directed against the STR-3 C terminus (RAST Ig) was generated by immunizing two New Zealand rabbits with an ovalbumin-coupled peptide containing the 25 C-terminal STR-3 aa (aa 464-488) (7). Affinity-purified RAST Ig was used to immunoprecipitate STR-3 from the conditioned media of NSCLC (A549)/pulmonary fibroblast (CCL-153) cocultures. In brief, 100 µl of 15 × conditioned media was incubated for 2 h at 4 °C with or without 2 µg of affinity-purified RAST Ig; protein A-Sepharose (25 µg/ml) was added for an additional 30 min at 4 °C. Thereafter, samples were centrifuged at 10,000 × g for 2 min and corresponding immunoprecipitates and immunodepleted conditioned media samples were collected. Immunoprecipitates and aliquots of immunodepleted conditioned media were size-fractionated on 10% SDS-PAGE gels under reducing conditions, blotted, and analyzed with the 5ST4A9 STR-3 mAb as described above.
Purification of 35-kDa STR-3 and Identification of the 35-kDa STR-3 N-terminal Sequence-- Four liters of SL-6-conditioned serum-free media were collected and loaded on a 250-ml dextran sulfate (Sigma) column equilibrated in 20 mM Tris-HCl, pH 7.4, containing 140 mM NaCl, 1 mM CaCl2, and 0.02% Triton X-100. After extensive washing in the equilibration buffer, the column was eluted with ~400 ml of 20 mM Tris-HCl, pH 7.4, 2 M NaCl, 1 mM CaCl2, and 0.01% Triton X-100.
Thereafter, the STR-3-enriched eluate was dialyzed against 20 mM Tris-HCl, 1 mM CaCl2, 0.01% Triton X-100 and loaded on an anion exchange column (DEAE-BioGel A, Bio-Rad). After extensive washing in 20 mM Tris-HCl, 30 mM NaCl, 1 mM CaCl2, the column was sequentially eluted with the following: 1) 20 mM Tris-HCl, pH 7.4, 100 mM NaCl, 1 mM CaCl2; and 2) 20 mM Tris-HCl, pH 7.4, 300 mM NaCl, 1 mM CaCl2. 35-kDa STR-3 was primarily eluted with the 100 mM NaCl buffer (fraction 1), whereas 45-kDa STR-3 was mainly eluted with the 300 mM NaCl buffer (fraction 2). The 35-kDa STR-3-enriched fraction (fraction 1) was subsequently loaded on an immunoabsorbent column made by covalently coupling 1 mg of immunoaffinity purified RAST IgG to 1 ml of wet protein A beads (Pharmacia Biotech Inc.). After extensive washing in 20 mM Tris-HCl, pH 7.4, 1 M NaCl, 1 mM CaCl2, the RAST-Ig column was eluted with 0.1 M glycine HCl, pH 2.5. Eluted fractions were immediately adjusted to pH 7.4 and assayed for 35-kDa STR-3 by immunoblotting. 35-kDa STR-3-containing fractions were pooled and concentrated 20 × by ultrafiltration (Centricon-10, Amicon, Beverly, MA). The concentrated 35-kDa STR-3 sample was size-fractionated by SDS-PAGE, transferred to an Immobilon P membrane, and stained with Amido Black (Sigma). Thereafter, the ~35-kDa STR-3 band was excised and subjected to N-terminal sequence analysis (ABI model 492A, Worcester Foundation for Biomedical Research, Shrewsbury, MA).Expression and Purification of Recombinant 45- and 35-kDa
STR-3--
An STR-3 cDNA (F98-STR-3) encoding the 45-kDa active
enzyme (aa 98-489) was obtained from PMA-treated CCL-153 fibroblasts by reverse transcription-polymerase chain reaction using primers 1 (sense) and 2 (antisense) (primer 1 (sense), 5
AGAATTCTTCGTGCTTTCTGGCGGG 3
and primer 2 (antisense), 5
CGAATTCTCAGAGGAAAGTGTTGGC 3
), digested with
EcoRI, cloned into the PGEX-4T-1 vector (Pharmacia), and
sequenced. An STR-3 cDNA (Gly189-STR-3) encoding the
35-kDa STR-3 protein (aa 189-489) was amplified by polymerase chain
reaction from the first construct (Phe98-STR-3) using
primers 3 (sense) and 2 (antisense) (primer 3 (sense) 5
CGGGATCCGGGGATGTCCACTTCGAC 3
and primer 2 (antisense) as
noted above), digested with BamHI and EcoRI,
cloned into the PGEX-4T-1 vector, and sequenced. Escherichia
coli DH5-
were transformed with Phe98-STR-3 or
Gly189-STR-3 and subsequently grown in 2 × YT-G
medium containing 100 µg/ml ampicillin and 2% glucose at 37 °C
with shaking. When a cell density corresponding to an
A260 of 1.0 was reached, recombinant (r) 45-kDa
(F98-STR-3) or r35-kDa STR-3 (Gly189-STR-3) expression was
induced by adding 0.4 mM
isopropyl-1-thio-
-D-galactopyranoside, and the
incubation was continued for 18 h at 25 °C. Cells pellets from
a 1-liter bacterial culture were resuspended in 50 ml of cold PBS and
sonicated for 2 min at 4 °C. Proteins were then solubilized in PBS
containing 1% Triton X-100 for 30 min at 4 °C and centrifuged for
30 min at 10,000 × g. Thereafter, supernatants were
incubated with 250 µl of glutathione-Sepharose 4B (Pharmacia) for 30 min at room temperature. Gluathione-Sepharose 4B was subsequently washed 5 times in PBS, and the r45-kDa STR-3 and r35-kDa STR-3 glutathione S-transferase fusion proteins were cleaved with
0.5 NIH units of thrombin (Sigma T-6759) for 18 h at room
temperature. The cleaved r45-kDa STR-3 and r35-kDa STR-3 proteins were
then analyzed and quantified by SDS-PAGE electrophoresis and Western blot as described previously.
1-PI Degradation Assay--
1-PI degradation was performed
as described previously (8). In brief, 200 ng of r45-kDa STR-3 or
r35-kDa STR-3 was incubated with 2 µg of
1-PI (ART Biochemicals,
Athens, GA) for 18 h at 37 °C in 50 mM Tris, pH
7.4, 150 mM NaCl, 1 mM CaCl2 in the
presence or the absence of BB-94 (5 µM). Thereafter,
1-PI hydrolysis products were analyzed by SDS-PAGE on a 10%
polyacrylamide gel under reducing conditions. Proteins were visualized
by Coomassie Blue (Coomassie Brilliant Blue R250, Sigma) staining.
| |
RESULTS |
|---|
|
|
|---|
STR-3 Is Induced in Tumor/Stromal Cell Cocultures-- In previous studies, STR-3 was overexpressed by stromal cells in primary NSCLC of all stages and pathologic subtypes (22). To determine whether STR-3 was secreted by stromal cells in response to tumor-derived factors, an in vitro assay was developed in which NSCLC cell lines were cocultured with normal pulmonary fibroblasts for 1-3 days in serum-free media. Thereafter, conditioned media from the tumor/stroma cocultures were size-fractionated, immunoblotted, and analyzed for STR-3 (Fig. 1).
|
Fibroblasts Are the Primary Source of STR-3 in Tumor/Stroma Cocultures-- To determine which cells secreted STR-3 in the tumor/stroma cocultures, the CCL-153 fibroblasts were separated from A549 NSCLC cells after 24 h of coculture using centrifugal elutriation. The relative percentages of fibroblasts and tumor cells in the elutriated cell fractions were estimated by keratin immunostaining. Fraction 1 contained the lowest percentage of keratin-positive cells (18% positive) and fraction 20 the highest percentage of keratin-positive cells (88% positive), indicating that these two fractions represented excellent sources of fibroblast- and tumor cell-enriched RNAs.
For these reasons, RNAs from fibroblast- and tumor cell-enriched fractions (fractions 1 and 20, respectively) were prepared and analyzed by Northern blot for STR-3 (Fig. 2, lanes 4 and 5); RNAs from CCL-153 fibroblasts and A549 NSCLC cells cultured separately (Fig. 2, lanes 1 and 3) or directly cocultured and harvested together (Fig. 2, lane 2) were also analyzed. As expected, STR-3 transcripts were significantly more abundant in tumor/stroma cocultures than in fibroblasts or tumor cells cultured separately (Fig. 2, compare lane 2 with lanes 1 and 3). STR-3 transcripts were also significantly more abundant in the fibroblast-enriched fraction than in the tumor cell-enriched fraction of the separated coculture (Fig. 2, compare lanes 4 and 5). Taken together, these data identify the fibroblasts as the primary source of STR-3 in the tumor/stroma cocultures.
|
A Previously Unidentified 35-kDa STR-3 Protein Is the Major Form of STR-3 in Tumor/Stroma Cocultures-- Although the fibroblast-derived mature active 45-kDa STR-3 enzyme was present in conditioned media from tumor/stroma cocultures, the major form of STR-3 was a previously unidentified 35-kDa protein (Fig. 1, lanes 3 and 7). This 35-kDa STR-3 protein was of particular interest because it constituted ~70% of all STR-3 in conditioned media from prolonged (day 3) cocultures (Fig. 1, lane 7).
The 35-kDa STR-3 Protein Is Processed at the N Terminus and Lacks a Portion of the Catalytic Domain-- To determine whether the newly identified 35-kDa STR-3 protein was a processed form of the larger active enzyme, conditioned media from tumor/stroma cocultures were initially immunoprecipitated with an antiserum directed against the C-terminal STR-3 peptide (RAST). RAST-STR-3 immunoprecipitates were subsequently immunoblotted and analyzed with an antibody directed against the STR-3 hemopexin domain (5ST4A9).
Fig. 3A includes RAST-STR-3 (lane 2) and control immunoprecipitates (lane 1) and aliquots of conditioned media following immunodepletion with RAST (lane 4) or protein A alone (lane 3). The RAST antiserum removes the majority of 35-kDa STR-3 from tumor/stroma cell-conditioned media, indicating that 35-kDa STR-3 contains the full C terminus in addition to the 5ST4A9 epitope from the hemopexin domain (Fig. 3A, lanes 2 and 4).
|
35-kDa STR-3 Does Not Entrap
2 Macroglobulin--
Because
35-kDa STR-3 contains the C-terminal hemopexin domain but lacks a
portion of the N-terminal catalytic domain, we compared the biological
activity of 35-kDa STR-3 and the mature 45-kDa active enzyme using an
2-macroglobulin entrapment assay (8).
2-Macroglobulin is a broad
range protease inhibitor which complexes with all of the previously
characterized metalloproteinases, including 45-kDa STR-3 (8).
2-macroglobulin
at 37 °C (lane 3); or in combination with
2-macroglobulin and a competing broad-spectrum metalloproteinase
inhibitor (BB-94) at 37 °C (lane 4). There is a modest
decrease in 45-kDa STR-3 and no change in 35-kDa STR-3 when samples are
incubated at 37 °C rather than 4 °C (Fig. 3B, lanes 1 and 2). When samples are incubated with
2-macroglobulin at 37 °C, there is the expected decrease in 45-kDa STR-3 secondary to entrapment of the enzyme (Fig. 3B, lane 3); however,
incubation with
2-macroglobulin does not reduce the quantity of
35-kDa STR-3 (Fig. 3B, lane 3). Consistent with this
observation, BB-94 reverses the
2-macroglobulin entrapment of 45-kDa
STR-3 without affecting 35-kDa STR-3 (Fig. 3B, lane 4).
Taken together, these data provide preliminary functional evidence that
35-kDa STR-3 activity lacks the metalloproteinase activity of the
larger 45-kDa enzyme.
The Generation of 35-kDa STR-3 Requires Tumor-specific Interactions with Surrounding Stromal Cells-- To determine whether malignant epithelial cells are required for the generation of 35-kDa STR-3, we cocultured pulmonary fibroblasts with either NSCLC (Fig. 4, A and C, lanes 4-6) or SV40 immortalized non-tumorigenic tracheal epithelial cells (Fig. 4, A and C, lanes 1-3) and assayed STR-3 in the resulting conditioned media. As previously demonstrated (Fig. 1), CCL-153 fibroblasts constitutively secrete higher levels of STR-3 than the CCL-210 fibroblasts (compare Fig. 4, A, lanes 1 and 4 with C, lanes 1 and 4).
|
The Generation of 35-kDa STR-3 in Tumor/Stroma Cocultures Requires bFGF-- Because factors including PDGF, EGF, and bFGF increase STR-3 transcript abundance in normal pulmonary fibroblasts in vitro (7, 22), we evaluated the potential role of these factors in STR-3 induction and processing in the tumor/stroma cocultures. As indicated in Fig. 4 (A and C), tumor/stroma cocultures were performed in the presence or absence of neutralizing antibodies directed against PDGF, the EGF receptor, or bFGF. None of these neutralizing antibodies reduced the quantities of 45-kDa STR-3 in conditioned media from tumor/stroma cocultures (Fig. 4, A and C, compare lanes 5, 8, 11, and 14); PDGF and EGF receptor neutralizing antibodies also had no effect on the generation of 35-kDa STR-3 (Fig. 4, A and C, compare lanes 5, 8, and 11). In marked contrast, the neutralizing bFGF antibody decreased 35-kDa STR-3 levels by more than 90% (Fig. 4, A and C, compare lanes 5 and 14), indicating that released extracellular bFGF was required for the generation of 35-kDa STR-3.
Because extracellular bFGF was implicated in the generation of 35-kDa STR-3, additional aliquots of conditioned media from the day 3 tumor/stroma cocultures (Fig. 4A and C, NA) were also assayed for bFGF content (Fig. 4, B and D). Although neither fibroblasts nor NSCLC cells that were cultured alone released detectable quantities of bFGF (Fig. 4, B and D, lanes 1 and 3), tumor/stromal cocultures released readily detectable bFGF (Fig. 4, B and D, lane 2).The Generation of 35-kDa STR-3 and the Release of bFGF Do Not Require Direct Tumor/Stromal Cell Contact: Transwell Assays-- To determine whether bFGF induction/release and bFGF-mediated processing of STR-3 require physical contact between NSCLC cells and pulmonary fibroblasts, the two cell types were cocultured in a transwell apparatus which permits only the diffusion of soluble factors. As indicated in Fig. 5A (lanes 2 and 5), 35-kDa STR-3 and bFGF were equally abundant in conditioned media from transwell and direct tumor/stroma cocultures.
|
The Generation of the 35-kDa STR-3 Is Inhibited by BB-94--
bFGF
increases the expression of multiple proteinases including MMPs and
serine proteases of the plasmin activator/plasmin system (2, 36),
prompting speculation that bFGF-mediated processing of STR-3 might
require additional MMPs or plasmin. To assess this possibility, normal
pulmonary fibroblasts were cocultured with NSCLC cells in the presence
or absence of a broad spectrum MMP inhibitor (BB-94) (30-32) or the
serine protease inhibitor aprotinin (33) (Fig.
6). As indicated, BB-94 completely
inhibited the generation of 35-kDa STR-3 in tumor/stroma cocultures,
whereas aprotinin had no detectable effect (Fig. 6, A and
B, compare lanes 2, 5 and 8). In
additional experiments, neither the more specific plasmin inhibitor,
2AP, nor the specific inhibitor of urokinase-type plasmin activator,
PAI-1, reduced the generation of 35-kDa STR-3 (data not shown).
Therefore, bFGF-mediated processing of STR-3 to the major 35-kDa
protein is not dependent upon the plasmin activator/plasmin system but
does require MMP activity.
|
Generation and Processing of STR-3 in Tumor/Stroma Cocultures: Proposed Model-- Taken together, the data from the NSCLC/pulmonary fibroblast cocultures indicate that NSCLCs stimulate normal pulmonary fibroblasts to secrete STR-3 and release bFGF (Fig. 7). Thereafter, STR-3 is processed at the N terminus via a tumor-specific and bFGF- and MMP-dependent mechanism to a major previously undescribed 35-kDa protein which differs in biological activity from 45-kDa STR-3 (Fig. 7).
|
35-kDa STR-3 Purification and Analysis of N-terminal
Sequence--
Because the 35-kDa STR-3 lacks the 5ST4C10 epitope from
STR-3 catalytic domain and fails to entrap
2-macroglobulin (Fig. 3B), this major STR-3 protein is unlikely to have the
enzymatic activity of its 45-kDa precursor. To specifically compare
mature active 45-kDa STR-3 with the 35-kDa processed protein, we
purified 35-kDa STR-3 and identified its N terminus.
35-kDa STR-3 Purification--
An unusual NSCLC cell line, SL-6,
was used in the large scale purification of 35-kDa STR-3. Unlike the
majority of NSCLC cell lines that do not secrete STR-3, SL-6 cells
secrete STR-3 and process the mature active enzyme to 35-kDa protein in
absence of normal pulmonary fibroblasts (Fig.
8A, lane 1). In SL-6 cells, the processing of STR-3 to a 35-kDa protein is also bFGF- and MMP-dependent; 35-kDa STR-3 is less abundant when SL-6 is
cultured in presence of a neutralizing bFGF mAb (Fig. 8A, lane
2) or concentrations of
1 µM BB-94 (Fig. 8,
A and B). In SL-6 cells cultured with increasing
amounts of the MMP inhibitor (BB-94), the concentrations of both 60-kDa
pro-STR-3 and mature 45-kDa STR-3 increase as that of the 35-kDa STR-3
decreases, confirming the precursor/product relationship between the
larger and smaller STR-3 proteins (Fig. 8B).
|
N-terminal Sequence of 35-kDa STR-3-- To determine the N-terminal sequence of 35-kDa STR-3, the protein was purified from SL-6 conditioned media using a three-step procedure (see "Materials and Methods"). The highly purified STR-3 sample contained a single major ~35-kDa band after SDS-PAGE, transfer to an Immobilon membrane, and Amido Black staining (data not shown). This 35-kDa STR-3 band was excised and subjected to N-terminal sequencing. Three N-terminal sequences were identified in the broad ~35-kDa STR-3 band (Fig. 9). These N-terminal sequences, aa 190-195, 192-194, and 194-199 from full-length STR-3, yield a protein with the calculated mass of ~35-kDa.
|
35-kDa STR-3 Lacks Specific N-terminal Residues Required for MMP Enzymatic Activity-- Of note, 35-kDa STR-3 lacks specific N-terminal residues that have been implicated in MMP-mediated cleavage. These missing aa include a highly conserved Ala (Ala178 in STR-3) that plays an important role in the reaction mechanism and the secondary zinc ligands Asp164, Asp166, His179, and a calcium ligand Asp171 that contribute to the structural integrity of MMPs (40, 41). Taken together, the epitope mapping (Fig. 3A) and preliminary structural and functional analyses (Figs. 3B and 9) suggest that 35-kDa STR-3 lacks components of the catalytic domain necessary for enzymatic activity.
To assess directly the proteolytic activity of 35-kDa STR-3, recombinant 35- and 45-kDa STR-3 proteins were synthesized and compared in
1-PI degradation assays. As described previously (8, 12), 200 ng
of r45-kDa STR-3 cleaved
1-PI (2 µg), and this activity was
inhibited by the addition of BB-94 (Fig.
10, compare lanes 1, 3, and
4). In marked contrast, 200 ng of r35-kDa STR-3 did not
cleave
1-PI (Fig. 10, lane 6); increased amounts of
r35-kDa STR-3 (up to 2 µg) also had no effect (data not shown). These
data provide further direct evidence that the major 35-kDa STR-3
protein lacks the proteolytic activity of the mature active 45-kDa
enzyme.
|
| |
DISCUSSION |
|---|
|
|
|---|
We have developed a tumor/stroma coculture assay in which NSCLC cells stimulate normal pulmonary fibroblasts to release STR-3 and the potent angiogenic peptide, bFGF (Fig. 7). In these cocultures, STR-3 is processed via a tumor-specific and bFGF-dependent mechanism to yield a major 35-kDa protein that lacks enzymatic activity (Fig. 7). Because 35-kDa STR-3 is the most abundant STR-3 protein in tumor/stroma cocultures and is only detected when normal pulmonary fibroblasts are cultured with malignant bronchial epithelial cells, these findings provide additional insights into the regulation and potential role of STR-3 in epithelial carcinomas.
STR-3 differs from other MMP family members in several key ways as
follows: 1) the mature enzyme does not degrade common MMP substrates
(8, 11); 2) the human STR-3 protein contains an amino acid substitution
in the highly conserved MMP met turn which may alter its enzymatic
activity (12); and 3) STR-3 undergoes tumor-specific processing at a
highly conserved sequence that is specific to STR-3 (Fig. 9). In
addition, large quantities of recombinant STR-3 are required to degrade
the only described native substrate,
1-PI (Ref. 8 and Fig. 10).
Taken together, these data suggest that STR-3 may not function in
a manner analogous to other previously characterized MMPs and that the
protein may have an as yet unidentified function.
The currently described coculture assays provide important additional clues regarding the unique nature of STR-3. In the tumor/stroma cocultures, tumor cells stimulate normal stromal cells to secrete STR-3 and mediate the processing of 35-kDa STR-3. Although 35-kDa STR-3 is the major form of the enzyme in conditioned media from tumor/stroma cocultures (Figs. 1 and 4), 35-kDa STR-3 was not previously detected in conditioned media from normal pulmonary fibroblasts or STR-3 Cos cell transfectants (8, 27). This is not surprising because the generation of 35-kDa STR-3 requires an interaction between tumor and stromal cells (Fig. 4). These observations underscore the utility of an in vitro assay which mimics the in vivo setting in which tumor cells invade the basement membrane and come into direct contact with normal stromal elements.
We performed the coculture assays with two types of normal pulmonary fibroblasts and either malignant bronchial epithelial cells or non-tumorigenic tracheal epithelial cells (Fig. 4). When normal pulmonary fibroblasts are cocultured with malignant bronchial epithelial cell lines, 45-kDa STR-3 is secreted and processed to the major 35-kDa protein. When fibroblasts are cocultured with non-tumorigenic tracheal epithelial cells, there is reduced but detectable secretion of 45-kDa STR-3; however, there is no detectable processing to 35-kDa STR-3 protein (Fig. 4, A and C, lane 2). The demonstrated enzymatic activity of STR-3 is so different from that of other MMPs that it remains to be determined whether 45-kDa STR-3 is functioning as a classic MMP in vivo. Furthermore, the unique nature of STR-3 processing and tumor-specific and bFGF-dependent generation of 35-kDa STR-3 prompt speculation regarding additional functions for the processed protein.
Our analyses of STR-3 induction and processing in tumor/stroma cocultures indicated that bFGF increased the processing but not the induction of STR-3. Although recombinant bFGF increased STR-3 transcript abundance in normal pulmonary fibroblasts in previous in vitro studies (7, 22), neutralizing bFGF antibodies did not inhibit the induction and secretion of STR-3 in tumor/stroma cocultures (Fig. 4, A and C, lane 14). However, neutralizing bFGF antibodies dramatically decreased the processing of STR-3 to the major 35-kDa protein in these assays (Fig. 4, A and C, lane 14). Because bFGF mediates the processing of STR-3 to the enzymatically inactive 35-kDa protein in tumor/stroma cocultures, we analyzed bFGF release in these conditions. As indicated in Figs. 4 and 5, tumor/stroma coculture increased the production and release of fibroblast-derived bFGF.
bFGF stimulates the growth and metastasis of many types of tumors (42-49) and promotes tumor angiogenesis (42, 50, 51). There are several alternatively spliced 18-23-kDa bFGF isoforms that are thought to have different mechanisms of action; the low molecular mass 18-kDa bFGF isoform is most likely to be released and to interact with high affinity cell-surface receptors (52, 53). Consistent with these observations, 18-kDa bFGF is the primary isoform detected in conditioned media from tumor/stroma cocultures (Fig. 5A). However, bFGF lacks a classical leader sequence and appears to be released by novel secretory mechanisms (50, 54). For these reasons, the tumor/stroma cocultures may represent a useful model system in which to analyze potential mechanisms of bFGF release.
Because bFGF stimulates the production of multiple proteinases including MMPs and serine proteases of the plasmin activator/plasmin system (2, 3, 36), we explored the possibility that bFGF-mediated STR-3 processing occurred via an additional MMP or plasmin. The broad spectrum MMP inhibitor (BB-94) inhibited the generation of 35-kDa STR-3 in tumor/stroma cocultures indicating that bFGF-mediated processing of 35-kDa requires additional MMP activity. In tumor/stroma cocultures, the major processed form of STR-3 occasionally appears as a ~37/35-kDa STR-3 doublet (Figs. 4 and 5), prompting speculation that STR-3 may undergo initial MMP-mediated cleavage and subsequent additional processing. The identification of three related 35-kDa STR-3 N-terminal amino acid sequences (Fig. 9) is also consistent with this observation. Recently, other MMP family members have also been reported to undergo initial MMP-mediated cleavage and subsequent autocatalytic processing (37, 38).
In summary, the data derived from the tumor/stroma coculture assay provide additional evidence regarding the unique nature of STR-3. STR-3 differs from other MMP family members in its initial activation (9), substrate specificity, and biological activity (9, 10) and near-uniform overexpression in epithelial malignancies (20-25). The current studies demonstrate that in tumor/stroma cocultures, STR-3 is also processed at a unique internal sequence via a tumor-specific and bFGF- and MMP-dependent mechanism to a major 35-kDa protein that lacks enzymatic activity. The regulatory nature of the major 35-kDa STR-3 protein and the relationship between bFGF and STR-3 in tumor/stroma cocultures and primary epithelial malignancies will be of further interest.
| |
ACKNOWLEDGEMENTS |
|---|
We thank P. Basset for thoughtful review of the manuscript; D. Favreau for manuscript preparation; and G. Shapiro, A. Astier, and P. Lecine for helpful discussions.
| |
FOOTNOTES |
|---|
* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§ Recipient of postdoctoral fellowships from the Association pour la Recherche sur le Cancer, the INSERM, and the Philip Foundation.
** To whom correspondence should be addressed: Dana-Farber Cancer Institute, 44 Binney St., Boston, MA 02115; Tel.: 617-632-3874; Fax: 617-632-4734; E-mail: margaret_shipp{at}dfci.harvard.edu.
1
The abbreviations used are: MMP, matrix
metalloproteinase; NSCLC, non-small cell lung cancer; STR-3,
stromelysin-3; bFGF, basic fibroblast growth factor;
1-PI,
1-proteinase inhibitor; PBS, phosphate-buffered saline; FCS, fetal
calf serum; PMA, phorbol 12-myristate 13-acetate; PDGF,
platelet-derived growth factor; PAGE, polyacrylamide gel
electrophoresis; mAb, monoclonal antibody; EGF, epidermal growth
factor; r, recombinant; aa, amino acid(s); MEM, minimum essential
medium.
| |
REFERENCES |
|---|
|
|
|---|