|
Vol. 273, Issue 1, 627-635, January 2, 1998
Negative Autoregulation of the Organizer-specific Homeobox
Gene goosecoid*
Vlatko
Danilov ,
Martin
Blum§,
Axel
Schweickert¶,
Marina
Campione, and
Herbert
Steinbeisser
From the Forschungszentrum Karlsruhe, Institute of Genetics,
P.O. Box 3640, D-76021 Karlsruhe and Department of Cell
Biology, Max Planck Institute for Developmental Biology,
P.O. Box 2109,
D-72011 Tübingen,Federal Republic of Germany
 |
ABSTRACT |
The homeobox gene goosecoid has been
implicated to play a central role in the Spemann organizer tissue of
the vertebrate embryo. Misexpression of goosecoid on the
ventral side of a Xenopus laevis gastrula embryo was shown
to result in a partial duplication of the primary body axis,
reminiscent of the Spemann organizer graft. Normal embryonic
development thus requires tight temporal and spatial control of genes
instrumental for organizer function. In the present study we
investigated the transcriptional control of goosecoid gene
expression. Sequence analysis of the mouse and human promoter region
revealed the presence of two palindromic binding elements for homeobox
genes of the prd type to which goosecoid belongs. We show that Goosecoid protein can bind to these sites in vitro. By using reporter gene constructs of the human
and mouse promoter, we demonstrate that Goosecoid can act as a
repressor of its own promoter activity in transient co-transfection
experiments in mouse P19 cells and in Xenopus embryos.
Autorepression depends on the presence of the homeodomain and is
mediated through the prd element more proximal to the
transcriptional start site. Our results suggest a role for
goosecoid in restricting organizer activity in the
vertebrate gastrula embryo.
 |
INTRODUCTION |
The most acclaimed classical experiment in embryology, the
organizer transplantation, was performed by Spemann and Mangold in the
1920s (1). Through this experiment a crucial role for the development
of the primary body axis was assigned to the dorsal lip of the early
newt gastrula embryo. When it was grafted to the ventral side of a
recipient newt gastrula, a twinned embryo developed, in which a
complete second body axis had formed. The dorsal lip was named the
organizer by Spemann and Mangold to reflect its ability to not only
autonomously differentiate into notochord but to change the fate of the
neighboring mesodermal cells into dorsal characteristics and to induce
a neural axis in the overlying ectoderm.
In an attempt to molecularly characterize the organizer phenomenon, the
homeobox gene goosecoid was cloned from a dorsal lip cDNA library made from Xenopus gastrulae (2). Homologous
goosecoid genes have been cloned in mouse (3), chick (4),
zebrafish (5, 6), human (7), and Drosophila (8, 9). In all vertebrate gastrula embryos goosecoid expressing cells mark
the equivalent of Spemann's organizer (10). Ectopic expression of synthetic goosecoid RNA in ventral blastomeres was able to
cause axis duplications in frogs (11), mimicking the organizer graft to
some extent. Further support for an essential role of
goosecoid in the organizer came from functional experiments
that implicated goosecoid in cell migration and
dorsalization of mesodermal cells at the gastrula stage (12, 13).
Surprisingly, goosecoid null mutations generated by gene
targeting (14, 15) displayed no obvious gastrulation defects in mouse
embryos, indicating that a related gene might provide a mechanism for a
functional complementation. Mutant mice died perinatally of
craniofacial defects related to the second phase of
goosecoid expression during organogenesis (16).1
Some aspects of the regulation of goosecoid expression have
been studied. In Xenopus and mouse it was shown that the
mesoderm-inducing growth factor Activin induced
goosecoid gene expression in Xenopus in the
absence of protein biosynthesis (3, 11). Two elements in the
Xenopus goosecoid promoter were identified that mediate the
induction by the Activin and Xwnt-8 growth factors through their
receptor-mediated signaling cascades (17). How gene expression is
maintained in the node region and the prechordal plate and excluded
from the more posteriorly located regions of the primitive streak has
not been addressed as yet.
In this study we have investigated autoregulation of
goosecoid. Our experiments were spurred by our finding that
two potential goosecoid binding sites were located in the
promoter region of the mouse and human goosecoid genes (18).
These elements are contained in the activin and wnt
response elements (17). We show that in vitro
translated full-length Goosecoid protein can bind to these sites. Our
experiments in Xenopus embryos and mouse P19 teratocarcinoma
cells show that Goosecoid regulates its own transcription by a negative
autoregulatory feedback loop. We demonstrate that autorepression is
exclusively mediated through the element proximal to the
transcriptional start site and that it is dependent on the presence of
the homeodomain. Our results suggest that goosecoid is
involved in the control and modulation of organizer activity both
spatially and temporally during embryogenesis in mouse and frog. ADMP,
a BMP2-3 related gene in
Xenopus, was recently cloned and shown to provide anti-organizer activity in the organizer itself (19). Taken together
this indicates that control mechanisms by which the vertebrate embryo
restricts the organizer activity temporally and spatially during
gastrulation are a function of the organizer itself.
 |
EXPERIMENTAL PROCEDURES |
Sequencing of the Mouse and Human Goosecoid Promoter and Cloning
of Reporter Gene Constructs--
Restriction fragments of genomic clones were subcloned and sequenced using standard procedures. Reporter
gene constructs were generated by subcloning genomic fragments or
fragments amplified by PCR into the luciferase vector pT81LUC (20),
which contains the minimal promoter of the thymidine kinase gene
(positions 81 to +52) linked to the firefly luciferase gene. Cloning
made use of a conserved SalI restriction site 7 bp upstream
of the TATA box in both human and mouse goosecoid (Fig.
1A). All PCR clones were verified by sequencing.
Cloning of Goosecoid cDNA Clones--
About 500 early mouse
egg cylinder stage embryos (E6.4-6.8) were isolated and frozen in
liquid nitrogen. Polyadenylated RNA was prepared using standard
procedures. cDNA synthesis and cloning into MOSSlox (21;
Amersham Corp.) followed the procedures suggested by the manufacturer.
The library was titrated and estimated to consist of about 500,000 independent clones with an average insert size of 1.3 kb. The
unamplified library was plated and screened with a 909-bp
PstI-HincII genomic goosecoid fragment
containing most of exon 2, intron 2, and exon 3 (probe 2 in Ref. 3).
After two rounds of rescreening, positive clones were subcloned and sequenced.
Determination of the Transcriptional Start Site of the Murine
goosecoid Gene--
The initiation site of transcription was
determined by 5 -RACE (rapid amplification of cDNA ends).
Polyadenylated RNA (2 µg), isolated from E12.5 mouse embryos using a
commercial kit (Life Technologies, Inc.), was hybridized with a
goosecoid-specific primer (5
AGAAGTCTCCAAGTGGTGTTGTTTGGGGTG), which was derived from a
sequence 234 bp downstream of the presumed TATA box (nucleotides 1173-1201 in Fig. 1C). Experimental conditions for RACE
were as published (22). RACE products were cloned using the TA cloning kit (Invitrogen) and sequenced.
Mobility Shift Assay--
Full-length Goosecoid protein was
synthesized from cDNA-E in vitro using a reticulocyte
lysate in vitro transcription and translation kit (Promega)
and verified by 10% SDS-polyacrylamide gel electrophoresis.
Oligonucleotides were annealed and radioactively labeled by fill-in
reaction with Klenow DNA polymerase, followed by purification through a
Sephadex G-50 column. Binding reactions (volume = 20 µl)
containing Goosecoid protein (2.5% of the in vitro
synthesis reaction), labeled double-stranded oligonucleotides (5 ng/reaction), poly(dI/dC) (Sigma; final concentration 50 µg/ml), 15 mM Tris-HCl (pH 7.5), 60 mM KCl, 0.5 mM dithiothreitol, 0.25 mg/ml bovine serum albumin, 0.05%
Nonidet P-40, 7.5% glycerol were incubated for 30 min at 25 °C and
electrophoresed on 4% acrylamide gels in 0.25 × TBE (22.5 mM Tris borate, 0.5 mM EDTA (pH 8.0)) at 150 V
for 1.5 h at room temperature. For competition experiments 100-fold molar excess of non-radioactive double-stranded
oligonucleotides were added to the binding reactions. Prior to loading
gels were prerun for 1 h. Gels were dried and exposed on x-ray
film. The sequences for the top strands of the probes were as
follows: consensus, TCGACTGAGTCTAATCCGATTACTGTACA; mouse DE,
TCGACAATAGTATTAATAAGATTAACCTG; mouse PE,
TCGAGATTAGGTTAATTTCATTAATTCTCAAT; and mouse mutated DE,
TCGACAATAGTATTGACAAGGTCAACCTG.
Transient Transfections and Luciferase Assay--
P19 cells were
cultured on gelatinized dishes in Dulbecco's modified Eagle's medium
supplemented with 10% fetal bovine serum. Cells (5 × 105 per 100-mm culture dish) were transfected with 1 nmol
of reporter plasmid (6.6 µg of mouse long reporter, 5.4 µg of human
long reporter, 4 µg of short reporter constructs), 1 µg of effector
plasmid (pRC/CMV-cDNA-E), and 1 µg RSV-LacZ plasmid, using the
calcium phosphate co-precipitation method. After 16 h the
precipitate was removed by washing the cells twice with
phosphate-buffered saline. Cells were harvested 40-46 h after
transfection. Following two rinses with
Ca2+-Mg2+-free phosphate-buffered saline, cells
were scraped off the dish in 0.5 ml of ice-cold lysis buffer (0.1 M Tris acetate (pH 7.5), 2 mM EDTA, 1% Triton
X-100). Cells were collected by centrifugation (10,000 × g, 4 °C, 5 min), and the protein concentration was
determined. Approximately 200 µg of protein were assayed for
luciferase reporter gene activity (23). To account for differences in
transfection efficiency between samples, values were corrected by
determining the -galactosidase activity (24). Each experiment was
repeated at least three times with at least three different
preparations of plasmid DNA. Point mutations in the Goosecoid effector
protein were introduced by site-directed mutagenesis of cDNA-E
using the PCR-based overlap extension protocol (25). Mutations were
verified by sequencing.
Injection Experiments in Xenopus Embryos--
Adult frogs were
purchased from the African Xenopus facility C. C. (South Africa). Eggs were obtained from females after injection of 500 units of human chorionic gonadotropin (Serva) into the dorsal lymph
sac. Eggs were fertilized in vitro with macerated testes.
After fertilization the jelly layers were removed by incubation in 2%
cysteine solution (pH 7.9). Embryos were injected with RNA or DNA
solutions (8-10 nl/embryo) at the 2-4-cell stage and cultured until
they reached the gastrula stage (NF stage 10; Ref. 26).
Capped Xenopus sense RNA was transcribed in vitro
from plasmid pspgsc linearized with EcoRI using SP6
Polymerase (13). Control goosecoid mRNA lacking the
homeobox was transcribed from plasmid p gsc linearized with
XhoI by using T7 RNA polymerase (11). For the synthesis of
full-length Xenopus goosecoid antisense T7 RNA polymerase
was used on plasmid pspgsc linearized with EcoRI (11). All
transcription reactions were performed with the message machine kit
(Ambion) according to the manufacturer's instructions.
Southern Blot Analysis--
Genomic DNA (10 µg/reaction) was
digested with various restriction enzymes, electrophoresed on a 0.8%
agarose gel, and transferred to a nylon membrane (Hybond; Amersham
Corp.). The blot was first hybridized with random-labeled probe 2 (GC
content 62%) in 1 M NaCl, 10% dextran sulfate, 1% SDS, 1 mg/ml yeast tRNA at 65 °C; final wash: 1 × SSC, 1% SDS at
65 °C for 30 min. After obtaining several exposures the blot was
stripped by boiling in 5 mM EDTA for 30 min. No signal was
detectable after overnight exposure of the stripped membrane.
Subsequent hybridization with random-primed probe 1 (71% GC content)
was performed under identical conditions, except that hybridization and
wash temperatures were raised to 67 °C. Probe 1 was a 582-bp
SalI-ApaI fragment corresponding to nucleotides
1-582 in the mouse goosecoid sequence deposited in the data
base (accession number M85271). This fragment contained 295 bp upstream
of the putative initiator methionine and 287 bp of exon 1 coding
sequence. Probe 2 was a 909-bp PstI-HincII
restriction fragment, corresponding to nucleotides 1248-2157
(accession number M85271); it contained sequences derived from exon 2, intron 2, and exon 3.
 |
RESULTS |
Sequence Analysis of the Mouse and Human Goosecoid Promoter Reveals
the Presence of Potential Goosecoid Binding Sites--
As a first step
to investigate transcriptional regulation of goosecoid, we
subcloned and sequenced genomic DNA fragments upstream of the
translational start site of the human and mouse goosecoid genes (3, 7). Fig. 1A shows a
schematic representation of the two genes. In the case of both the
mouse and human gene more than 1 kb were sequenced. The start site of
transcription of the murine goosecoid gene was mapped by
5 -RACE using RNA from E12.5 mouse embryos. It is indicated in the
alignment of the promoter sequences which is depicted in Fig.
1C. The two sequences are highly similar to each other, with
an identity of 75.1% in the stretch of 1276 bp shown in Fig.
1C.

View larger version (60K):
[in this window]
[in a new window]
|
Fig. 1.
The goosecoid promoter contains
two palindromic binding sites for homeobox proteins of the
prd type that are highly conserved between human and mouse.
A, restriction maps of the mouse and human
goosecoid genes. The coding sequences are indicated as
closed boxes. The promoter fragments sequenced are indicated below the maps. A, ApaI; H,
HindIII; K, KpnI; N,
NotI; P, PstI; R,
EcoRI; S, SmaI; Sac,
SacI; Sal, SalI. B,
alignment of highly conserved prd elements in the
goosecoid promoter of mouse, human, and Xenopus.
Capital letters characterize positions identical to and
small letters identify positions different from the
consensus sequence (CONS) identified by Wilson et
al. (18). Y = C or T; R = G or A;
N = A or T or G or C. C, alignment of human
(top) and mouse (bottom) goosecoid
promoter and 5 leader sequences. The palindromic prd
elements are shaded. Additional potential binding sites for
homeobox proteins (TAAT or ATTA) are underlined. Double-headed arrows indicate Activin and Wnt response
elements identified by Watabe et al. (17). The
prd site contained within the Activin response element
(ARE) represents the distal element (DE), and the
one in the Wnt response element (WRE) represents the
proximal element (PE). TATA box and translation start codon are marked by boxes. The start site of transcription and the
5 ends of cDNA-D and cDNA-E are indicated below the
murine sequence.
|
|
The most striking feature of the two sequences was the presence of two
palindromic motifs of the type TAATNNNATTA (Fig. 1B), which
are also present in the published partial promoter sequence of
Xenopus goosecoid (17). These palindromes were contained within sequences identified by Watabe et al. (17) as
responsible for mediating the Activin and Wnt signals that induce
goosecoid gene expression in Xenopus (see Fig.
1C and "Discussion"). In accordance with the
nomenclature proposed by Watabe et al. (17) these elements
will be addressed as distal element (DE) and proximal element (PE).
Palindromes of this type were previously identified as binding sites
for homeobox proteins of the so-called prd type, named after
the Drosophila homeobox gene paired (27). The
homeobox proteins in this class are the only ones known to bind as
homo- or heterodimers to palindromic binding sites (18). It has been shown by Wilson et al. (18) that the amino acid residue in
position 50 of the homeodomain plays the decisive role for the type of palindrome that was preferred by the different proteins. In case of a
serine at this position a palindrome with a 2-bp spacing was found,
whereas a 3-bp spacing was identified for lysine and glutamine.
Examples of genes of the glutamine group are rpx/hesx1 (28,
29), mhox (30), mix-1 (31), and
orthopedia (32); the serine group contains paired
and the pax genes pax-3, pax-6, and
pax-7 (33) (among others), and the most prominent members of
the lysine group are represented by otx-1 and
otx-2 (34) and, most notably, goosecoid itself.
Fig. 1B shows an alignment of the palindromic prd
sites in the goosecoid promoter of human, mouse, and
Xenopus together with the consensus sequence identified for
goosecoid by Wilson et al. (18). The presence of
these two sites prompted us to study a possible autoregulatory feedback loop as one component of goosecoid gene regulation.
Isolation of Mouse Goosecoid cDNA Clones--
To study
autoregulation in the mouse system we cloned a mouse
goosecoid cDNA to use as effector in DNA binding and
gene regulation studies. A cDNA library was constructed from mouse
gastrula egg cylinder embryos (E6.4-6.8) and screened with a genomic
goosecoid fragment (see "Experimental Procedures" for
details). Five positive clones were recovered after the second
rescreen. Sequence analysis revealed that the two clones designated
cDNA-D and cDNA-E (Fig. 2)
contained the complete coding sequence as predicted from the genomic
sequence (3). The other three represented truncated clones and one
partial clone fused to an unrelated cDNA (not shown). For further
studies, mouse goosecoid cDNA was subcloned into the eukaryotic expression vector pRC/CMV which allows expression of genes
under the control of the cytomegalovirus promoter.

View larger version (85K):
[in this window]
[in a new window]
|
Fig. 2.
Sequence of mouse goosecoid
cDNA clones. The start nucleotides for cDNA-D and
cDNA-E are circled and marked by arrows. The
translation is indicated below the sequence in
one-letter code. A stretch of seven amino acids that is
highly conserved between all goosecoid genes and homeobox
genes of the engrailed, msh, and NK
families is shown by a shaded box. The amino acid sequence
of the homeodomain and the polyadenylation signal (AATAAA) are
underlined. The lysine residue in position 50 of the
homeodomain is highlighted by shading.
|
|
Binding of the Mouse Goosecoid Protein to prd Sites in Its Own
Promoter--
To test if the full-length mouse Goosecoid protein can
bind to the prd sites in its own promoter, we performed
in vitro binding studies. Wilson et al. (18) have
previously shown that a peptide containing the Xenopus
Goosecoid homeodomain fused to the glutathione S-transferase
protein can bind to the consensus palindromic sequence TAATCCGATTA as a
homodimer in gel mobility shift assays. A full-length Goosecoid protein
was synthesized by in vitro transcription and translation of
clone cDNA-E and verified by SDS-polyacrylamide gel
electrophoresis, which resulted in a band of the expected size of 28 kDa. Gel shift assays were performed with different templates. Specific
binding was obvious in reactions using the consensus sequence (Fig.
3, lane 2), DE (Fig. 3,
lane 5), and PE (Fig. 3, lane 8). Binding was
abolished upon addition of 100-fold excess of nonradioactive template
(Fig. 3, lanes 3, 6, and 9). The specificity of
this binding was further tested by using a mutated binding site (mDE)
as template (Fig. 4F). In such
reactions no specific mobility shift was observed (Fig. 3, lane
10). In addition, binding to the consensus site, PE, and DE could
not be competed by the addition of 100-fold molar excess of non-labeled mDE (Fig. 3, lanes 11-13). These experiments demonstrate
that in vitro a full-length mouse Goosecoid protein can bind
to the two palindromic prd type elements present in its own
promoter.

View larger version (81K):
[in this window]
[in a new window]
|
Fig. 3.
Goosecoid protein binds to the
prd sites in its own promoter in vitro.
Mobility shift assay of full-length Goosecoid protein (synthesized by
in vitro transcription and translation of cDNA-E) on the
consensus element (lanes 1-3 and 11), DE
(lanes 4-6 and 12), PE (lanes 7-9
and 13), and mutated DE (mDE; lane 10). In
lanes 1, 4, and 7 binding reactions were
performed with the reticulocyte extract without Goosecoid; lanes
3, 6, and 9 show binding reactions that were competed
by the addition of 100-fold molar excess the of non-radioactive binding
sites, and in the reactions in lanes 11-13 100-fold molar
excess of mDE was used as competitor. Note that Goosecoid specifically
binds to PE, DE, and the consensus element, but not to mDE, and that
mDE cannot compete the specific binding.
|
|

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 4.
Autorepression of goosecoid in
mouse P19 cells is mediated through PE and dependent on DNA binding.
A-D, transient co-transfection experiments of luciferase
reporter gene constructs and goosecoid cDNA-E under the
control of the CMV promoter (pRC/CMV-cDNA-E). Error bars show standard deviation; experiments were
repeated at least three times. A and B, long
promoter fragments of mouse (A) and human (B)
goosecoid conferred reporter gene activity in P19 cells,
which was repressed by mouse (mgsc) and Xenopus
(Xgsc) goosecoid. A Xenopus goosecoid
effector plasmid in which the homeodomain was deleted
(xgsc HD) and a point mutation in the homeodomain of mouse
Goosecoid that abolishes DNA binding (mgscN210G) did not
show repression. Mutations of amino acids 28 (mgscV187R) and 50 (mgscK209Q) of the homeodomain, which affect cooperative
dimerization and DNA binding specificity (35), showed reduced
repression as compared with wild-type Goosecoid. The homeobox gene
mix-1 did not repress the long human reporter. Deletion of
the first 12 (mgsc 12) or 23 (mgsc 23) amino
acids of the Goosecoid protein did not abolish repression. The basal
activity of the empty luciferase vector pT81LUC was not affected by
co-transfection of mouse goosecoid (A).
C and D, short promoter fragments of mouse (142 bp; A) and human (139 bp; B) goosecoid
conferred reporter gene activity in P19 cells, which was repressed by
mouse Goosecoid. Repression was not affected by a mutation of DE
(mDE), whereas a mutated PE (mPE) abolished
repression. A double mutant of DE and PE resulted in loss of reporter
activity. TATA, TATA box; ATG, initiator codon. E, concentration dependence of repression. Constant amounts
(5 µg) of the long human reporter gene construct were co-transfected with increasing amounts of effector plasmid (pRC/CMV-cDNA-E). Note
that a more than 3-fold repression was obtained at 1 µg of effector
plasmid which was used in the experiments presented in A-D. F, sequences of wild-type and
mutated DE and PE in mouse and Xenopus.
|
|
Goosecoid Acts as a Repressor of Its Own Transcription in Mouse P19
Cells--
To analyze the goosecoid promoter activity
in vitro, a series of reporter gene constructs were
generated. Promoter sequences from the mouse and human
goosecoid genes were cloned in front of the minimal promoter
of the thymidine kinase gene linked to the firefly luciferase reporter
gene (vector pT81Luc; Ref. 20). A reporter construct containing the
endogenous mouse goosecoid promoter up to the translational
start site, which was cloned into the promoterless luciferase vector
pXP2, behaved in an identical manner to the thymidine kinase-Luciferase
constructs.1 Therefore, the heterologous thymidine kinase
promoter was used throughout this study.
In a first set of experiments 4.2 kb of mouse and 2.3 kb of human
5 -flanking sequences were cloned into the reporter plasmid pT81LUC and
analyzed in transient co-transfections with goosecoid cDNA-E as effector plasmid. Originally, based on experiments by Niehrs et al. (13), we expected positive autoregulation and therefore performed our experiments in cell lines that showed low basal
activities of the reporter plasmids. Niehrs et al. (13) had
shown induction of goosecoid expression in ventral marginal zone explant cultures of Xenopus gastrula embryos upon
injection of synthetic goosecoid mRNA. Induction of
reporter genes was never observed following co-transfection of
goosecoid cDNA-E in several cell lines tested. However,
we noticed a further reduction of the already low reporter activities
in the presence of the effector plasmid (data not shown). These
experiments indicated a negative autoregulatory effect of
goosecoid on its own transcription.
To test this option we screened mouse cell lines for high reporter
activity levels under conditions of transient transfections without
co-transfection of the goosecoid effector plasmid. The mouse
teratocarcinoma cell line P19 (35) proved to be most efficient in this
respect. In four experiments average induction factors of 7-fold were
observed for the 4.2-kb mouse long reporter construct and of 9.8-fold
for the 2.3-kb human long reporter, as compared with transfection of
the empty reporter plasmid pT81LUC (Fig. 4A). When
cDNA-E or a full-length Xenopus cDNA clone was
co-transfected, this activity was repressed for both the mouse and
human long reporters (Fig. 4, A and C). The
dependence of this repression effect of the human long reporter on the
concentration of the effector plasmid pRC/CMV-cDNA-E is shown in
Fig. 4E. A more than 3-fold repression was observed with 1 µg of effector plasmid (Fig. 4, A and E). In
another titration experiment we tested the influence of the CMV
promoter on the activity of the reporter plasmids. Lower reporter
levels due to squelching effects started to become evident at
concentrations of >2 µg/per dish of the CMV effector plasmid (not
shown). All transient transfection experiments reported here were
therefore performed with 5 µg of reporter and 1 µg of effector
plasmid per 100-mm culture dish. From this set of experiments we
conclude that Goosecoid can efficiently repress its own promoter activity in mouse P19 cells.
To determine which parts of the Goosecoid protein were required for
autorepression, we tested a Xenopus goosecoid cDNA clone which was truncated before the homeodomain and which was shown to be
inactive in the axis duplication assay (11). No repression of the long
human and mouse reporters was found when this plasmid was
co-transfected (Fig. 4, A and C), suggesting that
repression was dependent on the presence of the homeodomain. A number
of amino acids in homeodomains of the prd type have been
shown to be critical for DNA binding (invariant Asp in position 51;
Ref. 36), cooperative dimerization on palindromic binding sites
(hydrophobic residue in position 28; Ref. 36), and DNA binding
specificity (Lys, Gln, or Ser in position 50; Refs. 36-38). To test
the involvement of specific residues in autorepression, we constructed
a series of point mutations in cDNA-E. When the asparagine in
position 51 of the homeodomain (position 210 of the protein) was
changed into glycine, autorepression was abolished (mutant mgscN210G in Fig. 4B). Repression levels were reduced by mutating valine
in position 28 of the homeodomain into asparagine (4.3-fold as compared with 9.8-fold for the wild-type Goosecoid protein; mutant mgscV187R in
Fig. 4B). These mutants demonstrate the dependence of
autorepression on DNA binding, although cooperative dimerization seemed
to be involved but not essential for autorepression under the
experimental conditions of transient co-transfections. When the lysine
in position 50 of the Goosecoid homeodomain was mutated into a
glutamine, the repression effect was still significant but markedly
reduced (3.8-fold as compared with 9.8-fold for the wild-type Goosecoid protein; mutant mgscK209Q in Fig. 4B). Co-transfection of
the homeobox gene mix-1, however, which belongs to the
prd class like goosecoid and which has a
glutamine in position 50 of the homeodomain, showed no repression
effect (Fig. 4B). mix-1 was shown to bind to the
consensus prd type binding element TAATTGAATTA in
vitro (18). These results suggested that residues outside of the
homeodomain might contribute to the observed autorepression.
A recent publication reported the presence of a highly conserved region
of seven amino acids, shared between the homeoproteins Engrailed,
Goosecoid, NK1, NK2, and MSH (39). This sequence motif is located in
the amino-terminal part of the Goosecoid protein and is indicated in
Fig. 2. In in vivo experiments in Drosophila it
was shown that this domain was essential for the repressor function of
Engrailed (39). To test a possible involvement of this motif in
autorepression, we constructed two amino-terminal truncations of
cDNA-E which lacked the first 12 (mgsc 12) and 23 (mgsc 23)
amino acids, respectively. Although repression was virtually unaffected
with mgsc 12, it was reduced to 4.1-fold with mgsc 23. Taken
together, our experiments with mutated Goosecoid proteins demonstrate
the requirement of DNA binding for autorepression and suggest an
involvement of cooperative dimerization, whereas the suspected
repression domain was not essential.
To determine the role of the prd type binding sites in the
goosecoid promoter, we constructed short reporter plasmids
of 139 bp for human and 142 bp for mouse goosecoid that
consisted of DE and PE and the intervening sequences (Fig.
1C). Although the basal activity of these constructs was
about 4-fold below that of the respective long reporters,
co-transfection of mouse goosecoid cDNA-E resulted in
repression close to background levels (Fig. 4B). These
experiments indicated that while sequences upstream of the
prd sites contribute to the basal activity of the promoter in P19 cells, repression was mediated through fragments harboring just
the two palindromic binding sites. As DE and PE in mouse and human are
quite similar, and Goosecoid can bind to both elements equally well
(Fig. 3), we investigated whether both contributed equally to the
observed repression effect. Multiple point mutations were introduced in
either element changing pyrimidine into purine residues (Fig.
4F). Co-transfection experiments of mutated elements in the
context of the 142-bp fragments together with mouse
goosecoid cDNA-E showed that while a mutation of DE did
not alter the repression pattern, it was completely abolished by
mutating PE (Fig. 4, B and D). The basal activity
of a double mutant was not elevated in comparison to pT81LUC (Fig.
4D). From this set of experiments we conclude that
autorepression was mediated via PE, and that one of the elements has to
be functional for the basal activity of the short promoter fragment.
Taken together the experiments in P19 cells show that Goosecoid can
efficiently autorepress its own transcription and that this activity is
dependent on binding of the homeodomain to the proximal prd
type element (PE).
Autorepression of Goosecoid in Xenopus Embryos--
In the
following experiment we asked whether the autorepression of
goosecoid which was seen in P19 cells could also be observed in Xenopus embryos. The regulation of goosecoid
during the gastrulation process is important for the correct
establishment of the anterior posterior body axis, and autorepression
could be needed to spatially restrict the expression domain of
goosecoid. Two luciferase reporter constructs containing a
2.3-kb or a 279-bp human goosecoid promoter fragment were
injected into Xenopus embryos at the 2-4-cell stage. The
embryos were cultured until early gastrula stage (NF stage 10), and
luciferase activity was measured in embryo extracts. As an internal
standard constant amounts of -galactosidase mRNA were
co-injected, and the enzyme activity was quantitated in the embryonic
extracts and used for normalization of luciferase activity.
The long as well as the short human reporter construct showed activity
in Xenopus in contrast to the empty luciferase vector which
remained inactive (Fig. 5). When high
amounts of synthetic goosecoid mRNA (180 pg/embryo) were
co-injected with the reporter plasmids, the activity of the reporter
constructs was reduced by over 90%. The same amount of antisense
goosecoid RNA did not significantly alter the activity of
the human reporter constructs. In agreement with the previous finding
that the homeobox of Goosecoid was required for autorepression of the
goosecoid promoter in mouse P19 cells, we found no or only
weak repression in Xenopus embryos when mRNA for a
truncated protein lacking the homeodomain was co-injected with the
human reporter constructs. When mutant reporters mDE and mPE were
co-injected with wild-type goosecoid RNA repression was seen
with mDE and abolished with mPE (data not shown). As in P19 cells a
double mutant of DE and PE was reduced to background levels (not
shown). The experiments in frog embryos corroborate the results
obtained in the mouse system, demonstrating that the homeobox of the
Goosecoid protein is able to interact with its own promoter resulting
in a repression of goosecoid transcription.

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 5.
Goosecoid represses the activity of human
goosecoid reporter genes in Xenopus
embryos. The procedure of the injection experiments is
schematically shown in A. B, luciferase reporter constructs containing the 2.3-kb or a short 279-bp human
goosecoid promoter fragment were injected into 2-4-cell
embryos (100 pg/embryo). The empty luciferase vector
(pT81LUC) was injected as control. As effectors synthetic
Xenopus goosecoid mRNA (xgsc(s)),
mRNA for a truncated Goosecoid protein
(xgsc HD), or goosecoid antisense RNA (xgsc(as); 160 pg/embryo) were co-injected
with the reporter constructs. -Galactosidase mRNA (40 pg/embryo)
was injected as an internal control for the quantitation of the
luciferase activity in extracts of early gastrula embryos (NF stage
10).
|
|
Goosecoid-related Sequences in Mouse Genomic DNA--
The
experiments described so far clearly demonstrate that Goosecoid can act
as a strong transcriptional repressor. In the light of this finding the
lack of a gastrula phenotype of goosecoid knock-out mice
(14, 15) suggests that another homeobox gene with similar DNA binding
specificity, which is also able to act as a repressor, can complement
the loss of goosecoid function. Many vertebrate homeobox
genes outside of the Hox clusters exist in two or more related copies.
In the mouse there are, for example, two engrailed-like
genes, en-1 and en-2 (40), two
evenskipped-like genes, evx1 and evx2
(41, 42), and two each of the orthodenticle (otx1
and otx2; Ref. 34) and empty spiracle class
(emx1 and emx2, Ref. 34). To test if a gene
related to goosecoid was present in the mouse genome, we
performed a detailed analysis. Genomic DNA was digested with a series
of restriction enzymes and analyzed on a Southern blot by sequential
hybridization under reduced stringency conditions with two
non-overlapping genomic goosecoid probes (Fig. 6A). Probe 1 was derived from
exon 1 and contained the engrailed homology domain, whereas
probe 2, derived from exon 2, intron 2, and exon 3, contained the
homeobox. All radioactive label was removed after the first round of
hybridization.

View larger version (69K):
[in this window]
[in a new window]
|
Fig. 6.
goosecoid-related sequences in the
mouse genome. A, restriction map of the murine
goosecoid locus. A 2.4-kb SalI-HindIII fragment containing the goosecoid gene is shown in a larger
scale above the map. Exons are indicated by
boxes. Darker shading marks the homeobox; the
engrailed homology domain is shown in black. Probes 1 and 2 are indicated. B and C, Southern
blot analysis. Genomic mouse DNA (10 µg) was digested to completion
with the restriction enzymes indicated and hybridized successively with probe 1 (B) and probe 2 (C) under reduced
stringency conditions (see "Experimental Procedures" for details).
Additional fragments to the ones expected from the genomic map
(A) which cross-hybridized with the two probes are indicated
with small arrowheads in digests with HindIII,
NcoI, PstI, SalI, and SmaI.
Numbers indicate marker bands in kilobases.
|
|
The two probes detected fragments of the expected sizes, as deduced
from the genomic map of goosecoid shown in Fig.
6A. Hybridization with probes 1 and 2 is shown in Fig. 6,
B and C, respectively. Both probes detected
fragments of 12.5 kb in digests with BamHI, 17.5 kb with
EcoRI, 14.8 kb with EcoRV, 6.5 kb with
HindIII, 11.7 kb with KpnI, 15.8 kb with
NcoI, 11.0 kb with SalI, and 3.2 kb with
SmaI. The expected different sized fragments were detected in digests using ApaI (3.0 kb with probe 1, 4.7 kb with
probe 2) and PstI (2.8 kb with probe 1, 4.7 kb with probe
2). In addition to the expected fragments, both probes recognized
multiple further bands. In many digests these additional bands were
identical with both probes. This may be best seen with
HindIII (9.1-kb fragment, additional fragment(s) marked with
arrowheads), NcoI (5.4 kb), PstI
(fragments of 7.7 and 5.6 kb), SalI (6.1 kb), and
SmaI (8.2 and 4.9 kb). This result strongly suggests the
presence of at least one additional goosecoid-related gene
in the mouse genome.
 |
DISCUSSION |
The Goosecoid Promoter--
The most striking feature of
goosecoid promoter sequences of the mouse and human genes
are two palindromic elements, DE and PE, reminiscent of the P3 element
identified as binding site for homeobox proteins of the prd
type such as goosecoid (18). An aspect of the two elements
that deserves to be mentioned is that one of the half-sites overlaps
with a second canonical homeobox binding site TAAT (Fig.
1C). The sequence ATTAAT ... ATTA as such can be read
as a palindrome of the prd type, TAAT ... ATTA, or as a
direct repeat, ATTA... . .ATTA, with a 5-bp spacing. The
significance of this arrangement has not been addressed in the present
study; however, it indicates the possibility of a complex regulation of
the goosecoid promoter through homeobox proteins. Other
typical promoter elements were not identified in the sequenced
stretches of more than 1 kb of mouse and human 5 -flanking sequences,
except for several SP1 sites in a region of about 300 bp upstream of the TATA box (not highlighted in Fig. 1C). The presence of
the prd elements prompted us to study autoregulation, an
idea that was supported by the in vitro binding of
full-length Goosecoid protein in gel mobility shift assays (Fig. 3). We
therefore designed in vivo experiments to study the
physiological relevance of this interaction.
Goosecoid Acts as a Transcriptional Repressor of Its Own
Promoter--
The experiments in both mouse P19 cells and in
Xenopus embryos argue that Goosecoid acts as a repressor of
its own transcription, an effect that was dependent on the presence of
the homeodomain, and was mediated through DNA binding to the proximal
prd element PE. Our preliminary analysis of the Goosecoid
effector protein shows that DNA binding is a prerequisite, and
cooperative dimerization may add to the observed autorepression. The
homology region to the homeobox protein Engrailed, however, which
comprises seven amino acids in the amino-terminal part of the protein
and which in case of Engrailed was shown to mediate repression function in vivo (39), was dispensable for autorepression of
goosecoid. We are presently mapping the domain responsible
for autorepression further by deletion and mutation analysis of
Goosecoid.
Not much is known to date with respect to target genes of
goosecoid. Experiments in Xenopus have suggested
that ectopic goosecoid expression could result in activation
or repression of other genes. Transcription of bmp-4 and the
two ventral homeobox genes xvent-1 and xvent-2
were shown to be down-regulated upon ectopic goosecoid expression (43-45), whereas expression of chordin was
induced in Xenopus embryos. To reconcile these conflicting
results two possibilities can be considered.
First, as was argued for engrailed (39), activation of
target genes might be a consequence of the inactivation of a repressor. Second, interaction with an as yet unidentified co-factor may inhibit
goosecoid's repressor activity and lead to increased
transcription, or, third, may be able to switch goosecoid to
an activator of transcription. The demonstration of cooperative
interactions of several of the Hox proteins with the divergent homeobox
protein Extradenticle/PBX1 provides a precedent for modulation of
transcriptional activity of homeobox proteins through co-factors (46,
47), and in the case of the Drosophila homeobox gene
deformed it has been recently suggested that these
co-factors are necessary for transcriptional activation of target genes
(48). It remains to be seen if the homology region to
engrailed and several other homeobox genes (39), which plays
no role for autorepression, may have a function in modulating the
activity of the transcription factor goosecoid.
Goosecoid and the Organizer: A Model--
In Xenopus
and mouse it was shown that the mesoderm-inducing growth factors
Activin, a member of the transforming growth factor- family, and
Xwnt8, a member of the wnt family of secreted
factors, can induce zygotic goosecoid transcription (3, 11).
Response elements in the goosecoid promoter were identified
that mediate this response (17). Most interestingly, the two
palindromes that were the subject of the present study are located
within these regions (Fig. 1C; Ref. 17). It was shown
previously that point mutations of the homeobox binding sites abolished
activation through Activin and Wnt8. Factors through which the
downstream signaling cascades of Activin and Wnt exert their effects
therefore may include homeobox proteins, possibly of the prd
type. This interpretation is supported by our finding that mutations of
both DE and PE led to a decrease of reporter gene activity to
background levels in both P19 cells and Xenopus embryos
(Fig. 4B and data not shown). Candidate genes for positive
regulators that might mediate the induction of zygotic
goosecoid transcription through these regulatory elements
include siamois (49), otx-2 (34), and
xlim-1 (50).
Once goosecoid expression during gastrulation is induced and
Goosecoid protein is translated, the autorepression described in this
study becomes relevant. Repression may involve a competition mechanism
with transcriptional activators like otx-2 for DE and PE.
Autorepression seems to be a mechanism to keep goosecoid
expression at a moderate level. In chick and mouse embryos the
strongest goosecoid mRNA expression was seen at a stage
when the primitive streak was fully extended. At later stages signals
in in situ hybridization experiments became weaker, probably
reflecting the onset of autorepression of transcription (3, 4). In
Xenopus embryos it was shown that overexpression of
goosecoid mRNA in dorsal cells, where the gene is
normally expressed, altered cell fate and migration behavior during
gastrulation such that injected cells ended up in more anterior
positions (12). This experiment reflects a situation in which
autorepression of goosecoid was overcome. The phenotypic
consequences of misdirecting small groups of dorsal cells by
microinjection of goosecoid into single blastomeres of the
32-cell embryo were not addressed in detail. However, one can assume
that proper development of the prechordal plate mesoderm would be
grossly affected if all of the goosecoid positive cells of
the organizer would undergo such changes in cell fate and migration. Severe phenotypes were reported for several knock-out mutants in the
mouse that affected the region of the prechordal plate, i.e.
hnf3 (51, 52), lim-1 (53), and sonic hedgehog
(54). Taken together, this suggests a physiological role for the
observed autorepression of goosecoid.
The recently cloned secreted growth factor ADMP, a BMP-3 related
protein of the transforming growth factor- family, is expressed in
the dorsal lip and behaves like a typical dorsal gene in
Xenopus gastrula embryos but provides potent
anti-dorsalizing activity (19). The organizer tissue thus synthesizes
transcription and growth factors that counteract its own activity
locally. This might represent a regulatory mechanism by which the
organizer activity is modulated and balanced for proper embryonic
development to occur. Our results suggest that goosecoid has
a dual function in the organizer. It can promote organizer function via
repression of the ventral genes xvent-1, xvent-2, and
bmp-4, and by inducing chordin, directly or
indirectly. On the other hand these functions can be counteracted in
the embryo by the autorepression described here, providing a means for
negative regulation of the organizer.
The scenario presented above describing the potency of
goosecoid in gain-of-function studies contrasts sharply with
the apparent ease with which the embryo deals with loss of
goosecoid in the mouse (14, 15). Together with experiments
in which the organizer region was ablated in Xenopus, chick,
and zebrafish (55-57), without affecting normal embryogenesis, they
demonstrate the plasticity of early vertebrate embryos and their
regulative potential. In molecular terms other genes must be able to
compensate for the loss of goosecoid function and must be
able to reset gastrulation in the absence of the primary organizer. We
have presented evidence that at least one gene related to
goosecoid exists in the mouse genome. Recently, a
goosecoid-related gene was described in the chick (58). This
gene shows high homology to goosecoid in the homeobox and in
the engrailed homology region and an initially overlapping
expression pattern in Koller's sickle (58). The cloning of the
homologous gene in the mouse, which is presently underway in our
laboratory, and genetic analysis in knock-out and double knock-out mice
will clarify the role of goosecoid genes during vertebrate
gastrulation.
 |
ACKNOWLEDGEMENTS |
Juan-Carlos Izpisúa-Belmonte helped
with the construction of the mouse gastrula cDNA library at the lab
of Eddy M. De Robertis at UCLA. Anke Zimmermann helped with the cloning
of reporter constructs. We thank Changqi Zhu for help with transfection
experiments and valuable discussions and our colleagues Andy Cato,
Ralph Rupp, and Sally Mitchell for critical comments on the manuscript.
We are particularly grateful to Michael Kessel for communicating the
results on the goosecoid-related gene in chick prior to
publication.
 |
FOOTNOTES |
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) Y13149 (cDNA-D), Y13150 (cDNA-E), Y13151 (mouse
goosecoid promoter), and Y13152 (human goosecoid promoter).
Recipient of a predoctoral fellowship of the Boehringer Ingelheim
Fond.
§
Performed part of this work as a postdoctoral fellow in the lab of
Eddy M. De Robertis at UCLA. To whom correspondence should be
addressed: Karlsruhe Research Center, Institute of Genetics, P.O. Box
3640, D-76021 Karlsruhe, Germany. Phone: 49-7247-823394; Fax:
49-7247-823354; E-mail: Martin.Blum@IGEN.FZK.DE.
¶
Supported by a grant of the Volkswagen Stiftung.
1
C. Zhu and M. Blum, unpublished
observations.
2
The abbreviations used are: BMP, bone
morphogenetic protein; CMV, cytomegalovirus; DE, distal element; E,
embryonic day (days post-coitum); NF stage, stage of Xenopus
embryonic development according to the table of Nieuwkoop and Faber
(26); PCR, polymerase chain reaction; PE, proximal element;
prd, paired; RACE, rapid amplification of cDNA ends; bp,
base pair(s); kb, kilobase pair(s).
 |
REFERENCES |
-
Spemann, H.,
and Mangold, H.
(1924)
Roux' Arch. f. Entw. Mech.
100,
599-638
-
Blumberg, B.,
Wright, C. V. E.,
De Robertis, E. M.,
Cho, K. W. Y.
(1991)
Science
253,
194-196[Abstract/Free Full Text]
-
Blum, M.,
Gaunt, S. J.,
Cho, K. W. Y.,
Steinbeisser, H.,
Blumberg, B.,
Bittner, D.,
De Robertis, E. M.
(1992)
Cell
69,
1097-1106[CrossRef][Medline]
[Order article via Infotrieve]
-
Izpisua-Belmonte, J.-C.,
De Robertis, E. M.,
Storey, K. G.,
Stern, C. D.
(1993)
Cell
74,
645-659[CrossRef][Medline]
[Order article via Infotrieve]
-
Stachel, S. E.,
Grunwald, D. J.,
and Myers, P. Z.
(1993)
Development
117,
1261-1274[Abstract]
-
Schulte-Merker, S.,
Hammerschmidt, M.,
Beuchle, D.,
Cho, K. W. Y.,
De Robertis, E. M.,
Nüsslein-Volhardt, C.
(1994)
Development
120,
843-852[Abstract]
-
Blum, M.,
DeRobertis, E. M.,
Kojis, T.,
Heinzmann, C.,
Klisak, I.,
Geissert, D.,
and Sparkes, R. S.
(1994)
Genomics
21,
388-393[CrossRef][Medline]
[Order article via Infotrieve]
-
Goriely, A.,
Stella, M.,
Coffinier, C.,
Kessler, D.,
Mailhos, C.,
Dessain, S.,
and Desplan, C.
(1996)
Development
122,
1641-1650[Abstract]
-
Hahn, M.,
and Jäckle, H.
(1996)
EMBO J.
15,
3077-3084[Medline]
[Order article via Infotrieve]
-
De Robertis, E. M., Fainsod, A., Gont, L. K., and
Steinbeisser, H. (1994) Development (suppl.) 117-124
-
Cho, K. W. Y.,
Blumberg, B.,
Steinbeisser, H.,
and De Robertis, E. M.
(1991)
Cell
67,
1111-1120[CrossRef][Medline]
[Order article via Infotrieve]
-
Niehrs, C.,
Keller, R.,
Cho, K. W. Y.,
De Robertis, E. M.
(1993)
Cell
72,
491-503[CrossRef][Medline]
[Order article via Infotrieve]
-
Niehrs, C.,
Steinbeisser, H.,
and De Robertis, E. M.
(1994)
Science
263,
817-819[Abstract/Free Full Text]
-
Yamada, G.,
Mansouri, A.,
Torres, M.,
Blum, M.,
Stuart, E. T.,
Schultz, M.,
De Robertis, E. M.,
Gruss, P.
(1995)
Development
121,
2917-2922[Abstract]
-
Rivera-Perez, J. A.,
Mallo, M.,
Gendron-Maguire, M.,
Gridley, T.,
and Behringer, R. R.
(1995)
Development
121,
3005-3012[Abstract]
-
Gaunt, S. J.,
Blum, M.,
and De Robertis, E. M.
(1993)
Development
117,
769-778[Abstract]
-
Watabe, T.,
Kim, S.,
Candia, A.,
Rothbächer, U.,
Hashimoto, C.,
Inoue, K.,
and Cho, K. W. Y.
(1995)
Genes Dev.
9,
3038-3050[Abstract/Free Full Text]
-
Wilson, D.,
Sheng, G.,
Lecuit, T.,
Dostatni, N.,
and Desplan, C.
(1993)
Genes Dev.
7,
2120-2134[Abstract/Free Full Text]
-
Moos, M.,
Wang, S.,
and Krinks, M.
(1995)
Development
121,
4293-4301[Abstract]
-
Nordeen, S. K.
(1988)
BioTechniques
6,
454-457 [Medline]
[Order article via Infotrieve]
-
Palazzolo, M. J.,
Hamilton, B. A.,
Ding, D.,
Martin, C. H.,
Mead, D. A.,
Mierendorf, R. C.,
Raghavan, K. V.,
Meyerowitz, E. M.,
Lipshitz, H. D.
(1990)
Gene (Amst.)
88,
25-36[CrossRef][Medline]
[Order article via Infotrieve]
-
Dieffenbach, C. W., and Dveksler, G. S
(eds)
(1995)
PCR Primer: A Laboratory Manual, pp. 388-394, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
-
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K.
(eds)
(1987)
Current Protocols in Molecular Biology, p. 9.6.10, John Wiley & Sons, Inc., New York
-
Sambrook, J., Fritsch, E. F., and Maniatis, T.
(eds)
(1989)
Molecular Cloning, pp. 16.66-16.67, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
-
Dieffenbach, C. W., and Dveksler, S.
(eds)
(1995)
PCR Primer, pp. 604-611, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
-
Nieuwkoop, P. D.,
and Faber, J.
(1956)
Normal Tables of Xenopus laevis, Elsevier/North-Holland Biomedical Press, Amsterdam
-
Kilchherr, F.,
Baumgartner, S.,
Bopp, D.,
Frei, E.,
and Noll, M.
(1986)
Nature
321,
493-499[CrossRef]
-
Hermesz, E.,
Mackem, S.,
and Mahon, K.
(1996)
Development
122,
41-52[Abstract]
-
Thomas, P. Q.,
Johnson, B. V.,
Rathjen, J.,
and Rathjen, P. D.
(1995)
J. Biol. Chem.
270,
3869-3875[Abstract/Free Full Text]
-
Kern, M. J.,
Witte, D. P.,
Valerius, M. T.,
Aronow, B. J.,
Potter, S. S.
(1992)
Nucleic Acids Res.
20,
5189-5195[Abstract/Free Full Text]
-
Rosa, F.
(1989)
Cell
57,
965-974[CrossRef][Medline]
[Order article via Infotrieve]
-
Simeone, A.,
D'Apice, M. R.,
Nigro, V.,
Casanova, J.,
Graziani, F.,
Acampora, D.,
and Avantaggiato, V.
(1994)
Neuron
13,
83-101[CrossRef][Medline]
[Order article via Infotrieve]
-
Stuart, E. T.,
and Gruss, P.
(1996)
Cell Growth Differ.
7,
405-412[Medline]
[Order article via Infotrieve]
-
Simeone, A.,
Acampora, D.,
Gulisano, M.,
Stornaiuolo, A.,
and Boncinelli, E.
(1992)
Nature
358,
687-690[CrossRef][Medline]
[Order article via Infotrieve]
-
Rudnicki, M. A.,
and McBurney, M. W.
(1987)
in
Teratocarcinomas and Embryonic Stem Cell: A Practical Approach (Robertson, E. J., ed), pp. 19-49, IRL Press at Oxford University Press, Oxford
-
Wilson, D. S.,
Guenther, B.,
Desplan, C.,
and Kuriyan, J.
(1995)
Cell
82,
709-719[CrossRef][Medline]
[Order article via Infotrieve]
-
Treisman, J. P.,
Gönczy, M.,
Vashishtha, E. H.,
Harris, E.,
Desplan, C.
(1991)
Cell
59,
553-562
-
Hanes, S. D.,
and Brent, R.
(1989)
Cell
57,
1275-1283[CrossRef][Medline]
[Order article via Infotrieve]
-
Smith, S. T.,
and Jaynes, J. B.
(1996)
Development
122,
3141-3150[Abstract]
-
Joyner, A. L.,
and Martin, G. R.
(1987)
Genes Dev.
1,
29-38[Abstract/Free Full Text]
-
Bastian, H.,
and Gruss, P.
(1990)
EMBO J.
9,
1839-1852[Medline]
[Order article via Infotrieve]
-
Bastian, H.,
Gruss, P.,
Duboule, D.,
and Izpisua-Belmonte, J. C.
(1992)
Mamm. Genome
3,
241-243[CrossRef][Medline]
[Order article via Infotrieve]
-
Fainsod, A.,
Steinbeisser, H.,
and und De Robertis, E. M.
(1994)
EMBO J.
21,
5015-5025
-
Gawantka, V.,
Delius, H.,
Hirschfeld, K.,
Blumenstock, C.,
and Niehrs, C.
(1995)
EMBO J.
14,
6268-6279[Medline]
[Order article via Infotrieve]
-
Onichtchouk, D.,
Gawantka, V.,
Dosch, R.,
Delius, H.,
Hirschfeld, K.,
Blumenstock, C.,
and Niehrs, C.
(1996)
Development
122,
3045-3053[Abstract]
-
Mann, R. S.,
and Chan, S. K.
(1996)
Trends Genet.
12,
258-262[CrossRef][Medline]
[Order article via Infotrieve]
-
Wilson, D. S.,
and Desplan, C.
(1995)
Curr. Biol.
5,
32-34[CrossRef][Medline]
[Order article via Infotrieve]
-
Pinsonneault, J.,
Florence, B.,
Vaessin, H.,
and McGinnis, W.
(1997)
EMBO J.
16,
2032-2042[CrossRef][Medline]
[Order article via Infotrieve]
-
Lemaire, P.,
Garret, N.,
and Gurdon, J. B.
(1995)
Cell
81,
85-94[CrossRef][Medline]
[Order article via Infotrieve]
-
Taira, M.,
Jamrich, M.,
Good, P. J.,
Dawid, I. B.
(1992)
Genes Dev.
6,
356-366[Abstract/Free Full Text]
-
Ang, S.-L.,
and Rossant, J.
(1994)
Cell
78,
561-574[CrossRef][Medline]
[Order article via Infotrieve]
-
Weinstein, D. C.,
Altaba, A. R.,
Chen, W. S.,
Hoodless, P.,
Prezioso, V. R.,
Jessel, T. M.,
Darnell, J. E.
(1994)
Cell
78,
575-588[CrossRef][Medline]
[Order article via Infotrieve]
-
Shawlot, W.,
and Behringer, R. R.
(1995)
Nature
374,
425-430[CrossRef][Medline]
[Order article via Infotrieve]
-
Chiang, C.,
Litingtung, Y.,
Lee, E.,
Young, K. E.,
Corden, J. L.,
Westphal, H.,
Beachy, P. A.
(1996)
Nature
388,
407-413[CrossRef]
-
Gernhardt, J. C.
(1980)
in
Biological Regulation and Development (Goldberger, R. F., ed), Vol. 2, pp. 133-316, Plenum Publishing Corp., New York
-
Psychoyos, D.,
and Stern, C. D.
(1996)
Development
122,
3263-3273[Abstract]
-
Shih, J.,
and Fraser, S. E.
(1996)
Development
122,
1313-1322[Abstract]
-
Lemaire, L.,
Roeser, T.,
Izpisua-Belmonte, J. C.,
Kessel, M.
(1997)
Development
124,
1443-1452[Abstract]
Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
M. Dixon Fox and A. E. E. Bruce
Short- and long-range functions of Goosecoid in zebrafish axis formation are independent of Chordin, Noggin 1 and Follistatin-like 1b
Development,
May 15, 2009;
136(10):
1675 - 1685.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Lim, L. Pereira, M. S. Wong, C. E. Hirst, B. E. Van Vranken, M. Pick, A. Trounson, A. G. Elefanty, and E. G. Stanley
Enforced Expression of Mixl1 During Mouse ES Cell Differentiation Suppresses Hematopoietic Mesoderm and Promotes Endoderm Formation
Stem Cells,
February 1, 2009;
27(2):
363 - 374.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. L. Garaulet, D. Foronda, M. Calleja, and E. Sanchez-Herrero
Polycomb-dependent Ultrabithorax Hox gene silencing induced by high Ultrabithorax levels in Drosophila
Development,
October 1, 2008;
135(19):
3219 - 3228.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. A. Hartwell, B. Muir, F. Reinhardt, A. E. Carpenter, D. C. Sgroi, and R. A. Weinberg
The Spemann organizer gene, Goosecoid, promotes tumor metastasis
PNAS,
December 12, 2006;
103(50):
18969 - 18974.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Ku, S. Y. Sokol, J. Wu, M. I. Tussie-Luna, A. L. Roy, and A. Hata
Positive and Negative Regulation of the Transforming Growth Factor {beta}/Activin Target Gene goosecoid by the TFII-I Family of Transcription Factors
Mol. Cell. Biol.,
August 15, 2005;
25(16):
7144 - 7157.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Koide, T. Hayata, and K. W. Y. Cho
Gene Regulatory Networks Special Feature: Xenopus as a model system to study transcriptional regulatory networks
PNAS,
April 5, 2005;
102(14):
4943 - 4948.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. T. Miller, L. Maves, and C. B. Kimmel
moz regulates Hox expression and pharyngeal segmental identity in zebrafish
Development,
May 15, 2004;
131(10):
2443 - 2461.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Simon and T. Lufkin
Postnatal Lethality in Mice Lacking the Sax2 Homeobox Gene Homologous to Drosophila S59/slouch: Evidence for Positive and Negative Autoregulation
Mol. Cell. Biol.,
December 15, 2003;
23(24):
9046 - 9060.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. C. Zhu, M. A. Dyer, M. Uchikawa, H. Kondoh, O. V. Lagutin, and G. Oliver
Six3-mediated auto repression and eye development requires its interaction with members of the Groucho-related family of co-repressors
Development,
March 8, 2003;
129(12):
2835 - 2849.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Ring, S. Ogata, L. Meek, J. Song, T. Ohta, K. Miyazono, and K. W.Y. Cho
The role of a Williams-Beuren syndrome-associated helix-loop-helix domain-containing transcription factor in activin/nodal signaling
Genes & Dev.,
April 1, 2002;
16(7):
820 - 835.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Yasuo and P. Lemaire
Role of Goosecoid, Xnot and Wnt antagonists in the maintenance of the notochord genetic programme in Xenopus gastrulae
Development,
October 1, 2001;
128(19):
3783 - 3793.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K Sawada, Y Konishi, M Tominaga, Y Watanabe, J Hirano, S Inoue, R Kageyama, M Blum, and A Tominaga
Goosecoid suppresses cell growth and enhances neuronal differentiation of PC12 cells
J. Cell Sci.,
January 8, 2000;
113(15):
2705 - 2713.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Rivera-Perez, M Wakamiya, and R. Behringer
Goosecoid acts cell autonomously in mesenchyme-derived tissues during craniofacial development
Development,
January 9, 1999;
126(17):
3811 - 3821.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
S Qu, S. Tucker, Q Zhao, B deCrombrugghe, and R Wisdom
Physical and genetic interactions between Alx4 and Cart1
Development,
January 1, 1999;
126(2):
359 - 369.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
S. B. Smith, H. Watada, D. W. Scheel, C. Mrejen, and M. S. German
Autoregulation and Maturity Onset Diabetes of the Young Transcription Factors Control the Human PAX4 Promoter
J. Biol. Chem.,
November 17, 2000;
275(47):
36910 - 36919.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1998 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|