![]()
|
|
||||||||
J Biol Chem, Vol. 273, Issue 10, 5468-5477, March 6, 1998
,From the Howard Hughes Medical Institute, Departments of Medicine and Biochemistry, and Regional Primate Research Center, University of Washington, Seattle, Washington 98195-7370
| |
ABSTRACT |
|---|
|
|
|---|
We report the molecular cloning and expression of a phosphatidic acid-preferring phospholipase A1 from bovine testis. The open reading frame encoded an 875-amino acid protein with a calculated molecular mass of 97,576 daltons and a pI of 5.61. The sequence included a region similar to a lipase consensus sequence containing the putative active site serine and also included a potential, coiled-coil-forming region. Expression of the open reading frame in COS1 cells resulted in a 20-44-fold increase in phosphatidic acid phospholipase A1 activity over that of control cells. Mutation of the putative active site serine (amino acid 540) demonstrated that it was essential for this increase in enzyme activity. Northern blot analysis revealed at least five different messages with the highest overall message levels in mature testis, but detectable message in all tissues examined. Two possible alternately spliced regions in the open reading frame also were identified. Finally, a search of the data base identified six related proteins: a potential counterpart of the phospholipase A1 in Caenorhabditis elegans, two putative lipases in yeast, and three proteins separately encoded by the Drosophila retinal degeneration B gene and its mouse and human homologues.
| |
INTRODUCTION |
|---|
|
|
|---|
Cellular membranes are highly dynamic structures, and this dynamic nature plays a major role in cellular physiology. In response to extracellular or intracellular signals, a number of phospholipases can be activated, including phosphoinositide-specific phospholipase C, phosphatidylcholine-specific phospholipase C, phospholipase D, phosphatidic acid (PA)1 phosphohydrolase, phospholipase A2, and sphingomyelinase (1, 2). These enzymes produce second messengers that function in cellular regulation.
One second messenger that has received increasing attention is PA. This phospholipid can be produced either by the phospholipase D-catalyzed degradation of phosphatidylcholine or by a two-step pathway involving the phospholipase C-catalyzed degradation of phosphatidylinositol 4,5-bisphosphate to diacylglycerol and the subsequent, diacylglycerol kinase-catalyzed phosphorylation of this diacylglycerol (3). PA appears to function in a number of cellular processes, including superoxide production in neutrophils (4, 5) and actin polymerization (6). Other roles for PA are suggested by the facts that (a) mammalian tissues contain a large (10 isoforms) family of diacylglycerol kinases as well as several phospholipase D enzymes (7-9), and (b) phospholipase D activity can be activated by numerous factors, including phosphatidylinositol 4,5-bisphosphate, protein kinase C, p60src, and the low molecular weight GTP-binding proteins (ADP-ribosylation factor, cdc42, and Rho A) (9). Although much is known about how PA is produced in response to cell stimulation, little is known about how the PA signal functions or is attenuated.
We recently showed that bovine testis contains a phospholipase A1 (PLA1) that preferentially catalyzes the hydrolysis of PA in mixed micelle assay systems. The activity of this PA-preferring PLA1 (PA-PLA1) was present in high speed supernatant fractions from mature testis and brain, but not from newborn testis, liver, kidney, spleen, heart, or blood (10). This restricted localization implied that the PLA1 might be taking part in a signaling pathway in brain and testis. We subsequently purified the enzyme to the point where only one major band of 110 kDa was observed on silver-stained SDS-PAGE, found evidence that the enzyme was a homotetramer in solution, and studied its enzymology (11). Like the impure PA-PLA1, the purified enzyme catalyzed the preferential hydrolysis of PA. In addition, PA appeared to activate the PA-PLA1 reaction by promoting the enzyme's binding to micelles.
To learn more about the enzymology and physical role of PA-PLA1, we attempted to clone and sequence its cDNA. This paper describes the primary structure of PA-PLA1, identifies a serine residue that is critical for its activity, examines the expression pattern of its mRNA in mammalian tissues, explores the possibility that splice variants for the protein exist, and identifies six related protein sequences. With this information, a detailed study of PA-PLA1 function can be undertaken.
| |
EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Materials-- Oligonucleotides were synthesized by Life Technologies, Inc. or by DNA International, Inc. Lipids (sn-1-alkyl-2-oleoyl phosphatidylcholine, sn-1,2-dioleoyl PA, and oleoyl lysophosphatidic acid) were purchased from Avanti Polar Lipids. Organic solvents were from J. T. Baker and were American Chemical Society grade or better. All other reagents were from Sigma, except where indicated. Human infant brain library clone R13928, which corresponded to a human expressed sequence tag, was obtained from Genome Systems, Inc.
Generation and Sequencing of Proteolytic Peptides-- PA-PLA1 (35 µg), purified 2000-fold from bovine testis (11), was resolved further by 4-15% gradient SDS-PAGE, then transferred to a polyvinylidene difluoride membrane (Millipore). A major band that had an apparent mass of 110-kDa was identified by Amido Black staining, excised, and digested with either cyanogen bromide or Endo-Lys-C (Promega), as described (12). The resulting peptides were separated by C18 reversed phase high performance liquid chromatography and sequenced by Edman degradation (12).
cDNA Library Screening-- Degenerate oligonucleotides were designed from the following peptides: DWHSVDEV (23 bases, 288-fold degeneracy) and NHATHVEF (23 bases, 288-fold degeneracy). Total RNA was prepared from bovine testis using TRIzol Reagent (Life Technologies, Inc.), and poly(A)+ mRNA was prepared from total RNA using a Poly(A) Quick kit (Stratagene). cDNA from bovine testis mRNA was prepared by the Superscript II system (Life Technologies, Inc.). Polymerase chain reaction (PCR) using the above oligonucleotides and cDNA was carried out for 35 cycles of 60 s at 94 °C, 30 s at 55 °C, and 180 s at 72 °C using Taq polymerase (Perkin-Elmer). The resulting 303-base fragment was cloned into the pCR II plasmid using the TA cloning system (Invitrogen). The insert was cut out of the purified plasmid with EcoRI and labeled with [32P]dCTP by Random Priming (Boehringer Mannheim). This radiolabeled probe was used to screen a custom-made bovine testis cDNA library, produced with both oligo(dT) and random primers (Stratagene). The resulting 13 clones were sequenced.
5'-Rapid Amplification of cDNA Ends (5'-RACE)-- Two antisense oligonucleotide primers were designed: GCACACACACCCGCTCGATGTT and GGTCACATCCACCTCGTAGAGG. Single-stranded cDNA was prepared from bovine testis as above. A stretch of deoxyadenosines was added to the 3' end of the cDNA pool using terminal deoxynucleotide transferase (Life Technologies, Inc.). PCR was carried out using this modified cDNA template, a 30-residue oligo(dT) oligonucleotide, one of the above antisense oligonucleotides, and cloned Pfu polymerase (Life Technologies, Inc.) for 35 cycles of 98 °C for 30 s, 60 °C for 30 s, and 72 °C for 240 s. The resulting products were cloned directly into the PCR-Blunt plasmid using the Zero Blunt PCR cloning kit (Invitrogen). Three clones from the first oligonucleotide and six clones from the second ologonucleotide were fully sequenced.
DNA Sequencing-- Sequencing was carried out on ABI automated sequencers at the sequencing core facilities of the Department of Biochemistry or the Department of Pharmacology at the University of Washington.
Molecular Mass Determination of Purified PA-PLA1 by
Matrix-assisted Laser Desorption Ionization
(MALDI)--
PA-PLA1 (1 µg), purified from bovine testis
through the Superdex200 step (11), was precipitated with three volumes
of acetone for 1 h on ice, followed by centrifugation at
16,000 × g for 30 min at 4 °C. The resulting pellet
was resuspended in 10 µl of water, then analyzed with a Voyager Elite
Biospectrometry Research Station (PerSeptive Biosystems), following
established procedures for that instrument. Control proteins used were
bovine serum albumin and Escherichia coli
-galactosidase.
Expression of PA-PLA1 cDNA in COS1
Cells--
Oligonucleotides TTGGCGCGCACAGCATGAATTACCCGGGCCATGG and
GCTCTAGATCAGACTGGATCTAAACTGGGTTTCAC were designed on the basis of the
region including the putative initiation ATG and the antisense sequence
of the putative termination codon, respectively. The initiation
oligonucleotide also contained the five nucleotides 5' of the ATG, as
well as the mdulBssmdnmHII restriction site. The termination codon
included the XbaI restriction site 5' of the termination TGA
in the antisense direction. These two oligonucleotides were used along
with single-stranded cDNA from bovine testis to amplify the
PA-PLA1 open reading frame (ORF) using cloned
Pfu polymerase under the following conditions: 35 cycles of
98 °C for 30 s, 65 °C for 30 s, and 72 °C for 5 min.
Five 50-µl samples of the resulting reaction mix, each containing a
band of approximately 2700 bases, were precipitated with 0.1 volume of
5 M ammonium acetate, 2.5 volumes of ethanol. Each pellet
was resuspended in 50 µl of 1 × REact 3 containing 4 units of
BssHII and 10 units of XbaI (New England
Biolabs), then incubated overnight at 37 °C, followed by 2 h at
50 °C. The digested PCR reaction was resolved on a 0.8% agarose
gel, and the 2700-base band was cut out and purified using the Qiagen
gel extraction kit. A 10-µg sample of the pBK-CMV plasmid
(Stratagene) was digested and gel-purified in the same manner. The
plasmid (20 ng) and PCR product (50 ng) were ligated overnight at
16 °C using 20 units of T4 DNA ligase (New England Biolabs). A
2-µl sample of this ligation mix was transformed into Epicurian Coli
XL-1-Blue competent cells (Stratagene) in the absence of
isopropyl-1-thio-
-D-galactopyranoside, following the
manufacturer's instructions. The transformed bacteria were plated onto
agar plates containing Luria-Bertani broth and 50 µg/ml kanamycin.
Three of the resulting plasmids contained the 2700-base insert.
Plasmids were purified by the Qiagen Tip500 method. These plasmids were
sequenced on both strands and were found to contain identical
sequence.
PA-PLA Assay of the COS1 Cell Extracts-- PA-PLA1 activity in COS1 cells was determined using the Triton micelle assay, as described previously (10, 11). Briefly, the 100-µl assays contained 50 mM MOPS, pH 7.2, 100 mM KCl, 1 mM EGTA, 14.62 mM Triton X-100, 1.6 mM sn-1-alkyl-2-oleoyl PA, and 0.08 mM 32P-labeled sn-1,2-dioleoyl PA. The sn-1-alkyl-2-oleoyl PA and 32P-labeled sn-1,2-dioleoyl PA were synthesized as described (10, 11). Assays were conducted at 25 °C and were initiated by the addition of enzyme. After 20 min, the assays were terminated by the addition of 0.9 ml of 1:1 chloroform:methanol containing 1% v/v formic acid, 25 µg of oleoyl lysophosphatidic acid, 10 µg of egg PA, and 2 mg/ml butylated hydroxytoluene. The resulting single phase was split by the addition of 0.65 ml of water, the upper phase was removed, and the solvent was evaporated from the lower phase in vacuo (Savant). The pellet was dissolved in 50 µl of 75:25:2 chloroform:methanol:water, and 25 µl were spotted onto a reversed phase C18 thin layer chromatography plate (Whatman). The plate was developed in 98:2 methanol:4 M ammonium formate for 10 min, then exposed to x-ray film (Eastman Kodak Co.). The band migrating with authentic lysophosphatidic acid was scraped and quantitated by scintillation counting in 5 ml of Ecolume (ICN).
Antibody Generation-- A peptide, TKRRLREIEERLHGLKASS, corresponding to the region Thr589-Ser607 of the PA-PLA1 sequence, was synthesized, purified by high performance liquid chromatography, and coupled to keyhole limpet hemocyanin. Polyclonal antiserum to this conjugate was raised in rabbits (Research Genetics Inc.) and purified over an affinity column containing covalently bound peptide (made by Research Genetics Inc.), as described (14).
Site-directed Mutagenesis-- QuickChange site-directed mutagenesis kit (Stratagene) was used for point mutation of the putative active site serine 540 or serine 730 in the PA-PLA1 ORF. Sense and antisense oligonucleotides flanking the mutation site were used as primers. In the mutation involving serine 540, the original sequence TCC (serine) was changed to GCC (alanine); in that involving serine 730, the original sequence was changed from TCG (serine) to GCG (alanine). Native PA-PLA1 sequence was used as template. Mutants were generated by PCR using Pfu polymerase under the following conditions: 95 °C for 1 min, followed by 18 cycles at 95 °C for 30 s, 45 °C for 1 min, and 68 °C for 15 min. After amplification, the reaction mix was digested with restriction enzyme DpnI at 37 °C for 1 h to eliminate the parental plasmid. Mutant clones were then transformed in Epicurian Coli XL 1-Blue supercompetent cells (Stratagene). Plasmids were purified by the Qiagen Tip500 method. For each mutation, the mutagenized codon sequence was verified by ABI rhodamine dye sequencing.
Production and Evaluation of PA-PLA1 Mutants-- Wild type and mutant forms of PA-PLA1 were produced in the COS1 cell expression system as described above. Cells were harvested 48 h following transfection, and enzyme activity assays were carried out with the cell homogenates and supernatant and pellet fractions prepared by centrifugation for 30 min at 100,000 × g. The homogenates, supernatants, and pellets were analyzed for expressed protein by immunoblotting (15).
Northern Blot Analysis of PA-PLA1 Expression-- Human poly(A)+ RNAs were purchased from CLONTECH. Mature bovine testis and newborn calf testis poly(A)+ RNAs were prepared from fresh-frozen tissue as described above. Northern blots (1.2% agarose) were prepared as described (13). A 308-base fragment from base 1242 to 1550 of the cDNA in Fig. 1 was generated by PCR from one of the bovine clones, gel-purified (Qiagen), then randomly primed to about 109 cpm/µg (Boehringer Mannheim). The Northern blots were pre-hybridized for 3 h at 62 °C in 10 mM Tris, pH 7.5, 1 M NaCl, 10% dextran sulfate (Pharmacia Biotech Inc.), and 1% SDS. The probe (5 × 107 cpm) was mixed with 10 mg/ml sheared salmon sperm DNA (0.5 ml), boiled for 5 min, then put on ice for 5 min. This solution was mixed with 50 ml of prehybridization solution that had been previously equilibrated to 62 °C. The blots were transferred to this mixture and incubated at 62 °C overnight. They were then washed with 0.1 × SSC (5Prime-3Prime Inc.) plus 1% SDS three times for 20 min each at 25 °C, followed by two 20-min washes at 62 °C. The blots were then exposed to x-ray film (Kodak).
Other Methods-- DNA masses were estimated by absorption of 260 nm light, using the correction factor of 50 ng/µl per optical density unit. Homology searches were conducted using BLAST (National Center for Biotechnology Information). Alignments were made with CLUSTALW (16) and the program Align, adapted by W. R. Pearson from Ref. 17. Similar regions in sequences were identified with the help of Block Maker (18). The regions shown in Figs. 4-6 were those identified by both the MOTIF program and the GIBBS program. Coiled-coil-forming regions were predicted using the COILS program (19).2
| |
RESULTS |
|---|
|
|
|---|
Cloning of PA-PLA1 cDNA from Bovine Testis-- Material that had an apparent molecular mass of 110-kDa, prepared from 2000-fold purified bovine testis PA-PLA1, was used to obtain peptide sequences (see "Experimental Procedures"). Four peptides were obtained from Endo-Lys-C digestion and two from cyanogen bromide digestion. Two of the peptide sequences were used to design oligonucleotides, which were used in the amplification by PCR of a 300-base fragment from bovine testis. This fragment, which also contained the DNA sequence for a third peptide, was used to screen a bovine testis cDNA library. Thirteen clones were obtained and partially sequenced from the 5' and 3' ends. The two clones that contained the most sequence in the 5' and 3' directions, respectively, were fully sequenced to reveal an ORF of 2293 bases with 2496 bases of 3'-untranslated region (3'-UTR). Analysis of the other clones revealed one other with 2496 bases of 3'-UTR, three clones with only the first 800-900 bases of 3'-UTR, and four clones with fewer than 100 bases of 3'-UTR. All of the above clones contained 20-45 adenines at their 3' ends. The four additional clones did not contain poly(A) sequences, and thus were probably the results of random priming. Three clones contained identical 123-base deletions in the ORF (corresponding to His343-Ser382, Fig. 1).
|
Expression of PA-PLA1 in COS1 Cells-- The putative PA-PLA1 ORF was PCR-amplified from bovine testis cDNA. The PCR product was cloned into the pBK-CMV mammalian expression vector, which was then transfected into COS1 cells. Measurements of PA-PLA1 activity in homogenates of cells transfected with plasmid containing the putative PA-PLA1 ORF demonstrated that the homogenates contained 20-40-fold more PA-PLA activity than comparable homogenates of cells transfected with pBK-CMV alone (Fig. 2A), and over 90% of the PA-PLA1 activity was recovered in the supernatant after high speed centrifugation (data not shown). Consistent with the measurements of enzyme activity, analysis by SDS-PAGE and Western blotting of homogenates from cells transfected with the putative PA-PLA1 ORF revealed the presence of a band of 110 kDa apparent molecular mass, which was indistinguishable from the band of 110 kDa obtained with purified bovine testis PA-PLA1. In contrast, analysis of homogenates from mock-transfected cells revealed no immunochemically detectable band of 110 kDa (Fig. 2B). Taken together, these results provided strong evidence that the expressed ORF coded for PA-PLA1. The discrepancy between the value of 110 kDa, determined by SDS-PAGE analysis of the expressed PA-PLA1 or the purified bovine testis PA-PLA1, and the value of 97.6 kDa, calculated on the basis of the ORF-encoded polypeptide sequence or determined by MALDI for the purified bovine testis enzyme, most probably depended on the SDS-PAGE technique, which is well known to yield spurious values for some proteins.
|
Serine 540 Is Required for Catalysis-- Having found that the ORF for PA-PLA1 could be effectively expressed in COS1 cells, we used a similar approach to examine the possibility that serine 540 might be required for catalysis. It was important to do this because there is some evidence that the upstream glycine residue in the conserved GXSXG sequence in lipases may play a crucial role in catalysis (24), but a serine residue rather than a glycine residue is present in the corresponding position in PA-PLA1, as mentioned earlier. Accordingly, we constructed a S540A point mutant of PA-PLA1 and transfected it into COS1 cells. In addition, we did parallel experiments with a S730A point mutant and the wild type construct. The results of these experiments revealed that (a) cells that expressed the S540A mutant contained no more detectable PA-PLA1 activity than the mock-transfected cells, whereas cells that expressed wild type PA-PLA1 or the S730A construct contained high levels of PA-PLA1 activity (Fig. 2A); and (b) cells that separately expressed the three constructs produced similar levels of soluble PA-PLA1 protein, as determined by Western blotting (Fig. 2B). Comparable results have been reported for other lipases containing the conserved serine nucleophile in the GXSXG sequence (e.g. Refs. 25-27). Therefore, the data suggest that serine 540 is the active site nucleophile in PA-PLA1.
PA-PLA1 Expression in Human Tissues-- Northern blot analysis of poly(A)+ RNA from human tissues revealed five PA-PLA1 message lengths of approximately 2.8, 3.0, 3.6, 5.3, and >10 kb (Fig. 3, A-C). Overall expression was highest in testis, which was the only tissue in which the 2.8- and 3.0-kb messages were seen, but in which the >10-kb message was absent. Consistent with this finding, the 13 bovine testis clones contained 3'-untranslated regions of various lengths, predicted to correspond to mRNA lengths of the four smaller messages but not to the >10-kb message (data not shown). Moreover, mature bovine testis contained high PA-PLA1 message levels, whereas only trace amounts of message (5.3 kb) were present in newborn bovine testis (Fig. 3C) in agreement with our previous findings with regard to PA-PLA1 activity (10).
|
Possible PA-PLA1 Homologues-- When the translated PA-PLA1 ORF was used to search the non-redundant protein sequence data base, only six sequences with appreciable similarity to PA-PLA1 were identified; none of them corresponded to known lipases. Three of these sequences, CELG (ORF from Caenorhabditis elegans (C. elegans), accession no. 1208846); SPOMB (ORF from Schizosaccharomyces pombe, accession no. 2094857), and SCERV (ORF from Saccharomyces cerevisiae, accession no. 1078029) corresponded to unknown proteins identified during genome sequencing of the respective organisms. The three other sequences, RDGBd (accession no. Y08035), RDGBm (accession no. 2347141), and RDGBh (accession no. 2245317), corresponded to sequences encoded by a Drosophila gene, identified in a mutant screen for retinal degeneration (28), and its mouse and human homologues (29, 30).
The CELG sequence closely resembled the sequence of PA-PLA1, though it corresponded to a smaller protein (765 amino acids as compared with 875 amino acids). When the two protein sequences were compared with Align, they showed 29% identity and yielded a global alignment score of 945. When a BLAST search was done using the PA-PLA1 sequence, the CELG sequence yielded the highest score (P(N) = 1.6e
79). When
the two sequences were compared with Block Maker, eight regions of
sequence similarity were identified (Fig.
4, regions 1, 2, 3, 5, and 8-11).
Furthermore, each sequence contained a region of identity, not
identified by Block Maker (region 4); a lipase consensus region (region
6); and a probable, coiled-coil forming region (region 7). The probable
coiled-coil-forming region in CELG was found to have a COILS
probability score of 0.94, which compares well with the COILS score of
0.817 found with a similar approach for the corresponding region in the
PA-PLA1 sequence. The striking overall similarity between
the two sequences suggested that CELG might correspond to a C. elegans counterpart of PA-PLA1.
|
|
|
| |
DISCUSSION |
|---|
|
|
|---|
In this study, we cloned and sequenced the cDNA for bovine testis PA-PLA1. In support of this conclusion, the sequences of six regions in the putative ORF corresponded to those of peptides isolated from digests of the purified bovine testis enzyme, the calculated molecular mass of the ORF (97,576 daltons) agreed well with the molecular mass of purified bovine testis PA-PLA1 determined by MALDI, expression of the ORF in COS1 cells was accompanied by a 20-40-fold increase in PA-PLA1 activity, and serine 540, which is located in a region of the ORF that resembles a conserved sequence in lipases, was shown to be required for PA-PLA1 activity.
With knowledge of the sequence of PA-PLA1 in hand, several important questions can now be addressed. For example, one set of questions concerns the structural basis of PA-PLA1 activity. Are other specific amino acids in addition to serine 540 required for catalysis? What is the basis for the enzyme's substrate specificity? What regions of the PA-PLA1 sequence influence the enzyme's association with the membrane lipid bilayer? It may be possible to address these questions by taking advantage of some of the other observations made in the course of this study.
Catalysis by several known lipases has been shown to require the presence of a "catalytic triad" of amino acids: the conserved serine nucleophile, a histidine residue, and an aspartic acid residue (see, for example, Ref. 32). The results of the data base search with Block Maker that are shown in Fig. 5 may provide clues concerning the location of potential catalytic triad histidine and aspartic acid residues in PA-PLA1 and the putative lipases from C. elegans and yeast. Several of the regions of similarity that are shown contained aligned residues of histidine and aspartic acid that could be candidates for catalytic triad function, and it should be possible to examine the functional significance of these residues by experimentation with point mutants of PA-PLA1.
As mentioned earlier, experiments with mixed micelles have suggested that PA-PLA1 may have both a substrate-binding site for PA, involved in catalysis, and multiple binding sites for PA involved in enzyme activation (10, 11). Experiments with well defined, unilamellar liposomes, currently under way in our laboratory, have supported this possibility.3 However, the amino acids or domains that contribute to the PA-binding sites have yet to be identified. If expression studies of the ORFs from C. elegans and yeast confirm that they encode lipases, it might be possible to identify the relevant PA-binding sites in PA-PLA1 by carefully comparing the properties and sequences of the four enzymes.
The experiments with unilamellar liposomes that have done so far have also provided evidence that non-substrate lipids influence the ability of PA-PLA1 to interact with PA. Therefore, it is possible that the enzyme may bind to liposome surfaces in additional, yet-to-be-identified ways. Domains that might be responsible for this binding remain to be identified, but the regions of sequence similarity, regions 5 and 6, shown in Fig. 5, might be good candidates for study because of their similarity to two regions identified in the putative membrane association domains of the RDGB proteins (Fig. 6).
Another set of questions concerns the relation between PA-PLA1 and other lipases: Does PA-PLA1 belong to a special family of lipases? What defining structural and functional characteristics do members of this family share? How do members of the family differ from one another? Evidence related to the first of these questions is already beginning to accumulate.
The sequence of PA-PLA1 definitely differs from the sequences of many other lipases, even though the region that surrounds serine 540 in PA-PLA1 resembles a conserved region in many of these lipases. For example, PA-PLA1 lacks further sequence similarity to types I-IV phospholipase A2 (33, 34), a phosphatidylserine-specific PLA1 from rat platelets (35), lecithin:cholesterol acyltransferase (36), lysophospholipases (27, 37), and triacylglycerol lipases (38, 39). However, the sequence of PA-PLA1 does resemble that of CELG, SCERV, and SPOMB, as shown in Fig. 5; and SCERV and SPOMB appear to correspond to different, but closely related family members. We are currently attempting to prepare and express the cDNA that corresponds to SCERV to examine the catalytic properties of the putative SCERV lipase by direct experimentation.
If PA-PLA1 does indeed belong to a special family of lipases, splice variants of PA-PLA1 might well be included. The three bovine testis cDNAs that contained the 123-base deletion shown in Fig. 1 may correspond to such splice variants. The 40 amino acids that would be eliminated by the deletion would normally be located between regions 2 and 3 identified by Block Maker (Fig. 4), but their functional significance is unknown. We have also obtained evidence for the existence of a second type of PA-PLA1 splice variant.4 We sequenced a cDNA clone from human infant brain, which corresponded to an expressed sequence tag (accession no. R13928), and found that it contained a 64-base deletion in another region of the ORF. Further work with these variants might suggest functions for the deleted regions.
If splice variants of PA-PLA1 that have different substrate specificities are present in mammalian cells, an apparent discrepancy between the results of an earlier study (10) and the expression patterns of human PA-PLA1 mRNA that are shown in Fig. 3 (A and C) might conceivably be explained. We previously found high PA-PLA1 activity in high speed supernatant fractions from homogenates of mature bovine testis and brain, but little or no PA-PLA1 activity in corresponding fractions from newborn testis, liver, spleen, heart, kidney, and blood (10). In good agreement with the measurements of enzyme activity in bovine tissues, expression of PA-PLA1 mRNA was highest by far in human testis, strong in brain, and very low in liver. However, unexpectedly, there also appeared to be expression of human PA-PLA1 mRNA in the spleen and kidney (Fig. 3A) as well as in the heart (data not shown). One possible explanation of this unexpected result could be that the majority of the message detected in the spleen, kidney, and heart was due to PA-PLA1 splice variants, and that the enzymes that corresponded to these splice variants had substrate specificities that differed from that of PA-PLA1 and so escaped detection in our assay system.
The presence of splice variants of PA-PLA1 might also account, at least in part, for the multiple message sizes for PA-PLA1 observed in this study. The >10-kb message is of particular interest because it was absent from testis but strongly present in lung, spleen, cerebellum, and fetal brain (Fig. 3, A and B). Do these different transcripts correspond to particular splice variants, such as the ones described above? Another possibility, not mutually exclusive with the first, is that differences in message lengths depend on differences in the 3'-untranslated regions of the messages, which confer different properties to the transcripts, such as variations in RNA half-life, translational control, or cellular localization (40, 41).
A different set of questions concerns the possible biological functions of PA-PLA1 and its close relatives. Answers to many of these questions will have to await the accumulation of further information about the PA-PLA1 lipase family. However, it may be possible to address questions related to the biological function of PA-PLA1 itself in the near future. As mentioned earlier, we have been focusing attention on PA-PLA1 because experiments with mixed micelle systems and unilamellar liposomes have shown that it hydrolyzes and is activated by PA, and because it is present in high levels in the mature testis and brains. This has suggested that it may function in phospholipase D- or diacylglycerol kinase-dependent signaling systems required for spermatogenesis and neuronal interactions. Now that the bovine testis PA-PLA1 has been sequenced and an antibody to the enzyme has been prepared, it may be possible to obtain further clues concerning the biological role of the enzyme using the tools of molecular biology and immunocytochemistry.
In summary, this paper announces the cloning of the cDNA for a bovine testis PA-PLA1. Knowledge of the primary structure of PA-PLA1 will be of great utility in the characterization of its enzymatic properties and physiologic function. In addition, several different splice variants of the protein appear to exist, suggesting modulations of its function in different cells or sub-cellular regions. Finally, the PA-PLA1 ORF contains regions that are similar to regions in six other ORFs, suggesting interesting possibilities for further experimentation.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Rudi Aebersold, Santosh Kumar, and Ken Walsh for MALDI analysis of the purified protein and peptide sequencing and Rosa Suen and Laurie Aicher for advice on molecular biology.
| |
FOOTNOTES |
|---|
* This work was supported by the Howard Hughes Medical Institute and by National Institutes of Health Grant RR00166 to the Regional Primate Research Center at the University of Washington.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF045022.
Current address: The Salk Institute for Biological Studies, 10010 N. Torrey Pines Rd., La Jolla, CA 92037.
§ To whom correspondence should be addressed: Howard Hughes Medical Institute, Box 357370, University of Washington, Seattle, WA 98195. Fax: 206-543-0858.
1 The abbreviations used are: PA, phosphatidic acid; CELG, predicted sequence of an unknown protein from C. elegans; COS1 cells, SV40-transformed African Green monkey kidney cells; 5'-RACE, 5'-rapid amplification of cDNA ends; kb, kilobase pair(s); MALDI, matrix-assisted laser desorption ionization; MOPS, 3-(N-morpholino)propanesulfonic acid; ORF, open reading frame; PA-PLA1, phosphatidic acid-preferring phospholipase A1; PCR, polymerase chain reaction; PITP, phosphatidylinositol transfer protein; PLA1, phospholipase A1; RDGBd, RDGBh, and RDGBm: sequences encoded by the retinal degeneration B gene in Drosophila and the corresponding genes in humans and mice; SCERV, predicted sequence of an unknown protein from S. cerevisiae; SPOMB, predicted sequence of an unknown protein from S. pombe; PAGE, polyacrylamide gel electrophoresis; 3'-UTR, 3'-untranslated region.
2 BLAST software is available via the World Wide Web (http://www.ncbi.nlm.nih.gov/BLAST/). Block Maker is also available via the World Wide Web (http://blocks.fhcrc.org/). COILS is also available via the World Wide Web (http://ulrec3.unil.ch/software/COILS_form.html).
3 Q. Lin, unpublished experiments.
4 H. N. Higgs, M. H. Han, G. E. Johnson, and J. A. Glomset, unpublished results.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
T. Iinuma, A. Shiga, K. Nakamoto, M. B. O'Brien, M. Aridor, N. Arimitsu, M. Tagaya, and K. Tani Mammalian Sec16/p250 Plays a Role in Membrane Traffic from the Endoplasmic Reticulum J. Biol. Chem., June 15, 2007; 282(24): 17632 - 17639. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. L. Arrese, R. T. Patel, and J. L. Soulages The main triglyceride-lipase from the insect fat body is an active phospholipase A1: identification and characterization J. Lipid Res., December 1, 2006; 47(12): 2656 - 2667. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Shimoi, I. Ezawa, K. Nakamoto, S. Uesaki, G. Gabreski, M. Aridor, A. Yamamoto, M. Nagahama, M. Tagaya, and K. Tani p125 Is Localized in Endoplasmic Reticulum Exit Sites and Involved in Their Organization J. Biol. Chem., March 18, 2005; 280(11): 10141 - 10148. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hiramatsu, H. Sonoda, Y. Takanezawa, R. Morikawa, M. Ishida, K. Kasahara, Y. Sanai, R. Taguchi, J. Aoki, and H. Arai Biochemical and Molecular Characterization of Two Phosphatidic Acid-selective Phospholipase A1s, mPA-PLA1{alpha} and mPA-PLA1{beta} J. Biol. Chem., December 5, 2003; 278(49): 49438 - 49447. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ito, U. Tchoua, M. Okamoto, and H. Tojo Purification and Properties of a Phospholipase A2/Lipase Preferring Phosphatidic Acid, Bis(monoacylglycerol) Phosphate, and Monoacylglycerol from Rat Testis J. Biol. Chem., November 8, 2002; 277(46): 43674 - 43681. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-i. Nakajima, H. Sonoda, T. Mizoguchi, J. Aoki, H. Arai, M. Nagahama, M. Tagaya, and K. Tani A Novel Phospholipase A1 with Sequence Homology to a Mammalian Sec23p-interacting Protein, p125 J. Biol. Chem., March 22, 2002; 277(13): 11329 - 11335. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Eder, T. Sasagawa, M. Mao, J. Aoki, and G. B. Mills Constitutive and Lysophosphatidic Acid (LPA)-induced LPA Production: Role of Phospholipase D and Phospholipase A2 Clin. Cancer Res., June 1, 2000; 6(6): 2482 - 2491. [Abstract] [Full Text] |
||||
![]() |
C. Lu, T. S. Vihtelic, D. R. Hyde, and T. Li A Neuronal-specific Mammalian Homolog of the Drosophila Retinal Degeneration B Gene with Expression Restricted to the Retina and Dentate Gyrus J. Neurosci., September 1, 1999; 19(17): 7317 - 7325. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Tani, T. Mizoguchi, A. Iwamatsu, K. Hatsuzawa, and M. Tagaya p125 Is a Novel Mammalian Sec23p-interacting Protein with Structural Similarity to Phospholipid-modifying Proteins J. Biol. Chem., July 16, 1999; 274(29): 20505 - 20512. [Abstract] [Full Text] [PDF] |
||||
![]() |
|