INTRODUCTION

Top Abstract Introduction Procedures Results & Discussion References

The Bacillus subtilis pyrimidine biosynthetic (pyr) operon encodes all of the enzymes for the de novo biosynthesis of UMP and two additional cistrons encoding a uracil permease and the regulatory protein PyrR (1-4). On the basis of molecular genetic evidence it was proposed that PyrR regulates pyr expression through a transcriptional attenuation mechanism that acts at three separate sites within the operon, which are located in the 5'-untranslated leader, between the first (pyrR) and second (pyrP) genes, and between the second and third (pyrB) genes of the operon (3, 5). PyrR is proposed to regulate the ratio of terminated to readthrough transcripts at each attenuation site by permitting the formation of a -independent transcription terminator when exogenous pyrimidines are available. The binding of PyrR to pyr mRNA interferes with the formation of an alternative upstream stem-loop structure, the antiterminator, which is otherwise kinetically and thermodynamically favored. The presence of a conserved sequence within the 5'-stem of each antiterminator suggested a site within the pyr mRNA for interaction with PyrR (3); this site is the locus of several cis-acting mutants in the first pyr attenuator which are deficient in repression by pyrimidines (6).

In addition, PyrR functions as a novel uracil phosphoribosyltransferase (UPRTase),¹ catalyzing the formation of UMP and pyrophosphate from uracil and 5-phosphoribosyl -1-pyrophosphate (PRPP) despite its lack of primary sequence similarity to other known UPRTases (3, 7). The UPRTase activity of PyrR was first discovered by Ghim and Neuhard (8), who characterized the pyrR gene from Bacillus caldolyticus. The role of the enzymatic function of PyrR is not known; Bacillus subtilis possesses an additional UPRTase that has been shown to be quantitatively more important than PyrR (3, 7). It has been demonstrated that UMP and PRPP function as negative and positive regulators, respectively, of the pyr operon (3, 5, 9).

Direct biochemical characterization of this attenuation mechanism is required to test the above proposals. In this paper we describe the purification of PyrR. Physical and enzymatic properties of PyrR are described, and the ability of PyrR to bind specifically to pyr mRNA is demonstrated.

	EXPERIMENTAL PROCEDURES

Top Abstract Introduction Procedures Results & Discussion References

Bacterial Strains, Plasmids, Media, and Growth

Escherichia coli strains DH5 (Life Technologies, Inc.) and TG1 (10) were used for plasmid construction and plasmid propagation for purification. Luria broth (11) was used for the growth of cultures for plasmid purification and the purification of native PyrR. Media were supplemented with 100 µg/ml ampicillin when cells harboring plasmids were grown. All liquid cultures were grown aerobically at 37 °C.

Expression and Purification of PyrR

B. subtilis PyrR was expressed in E. coli from plasmid pTSROX3 (pUC18 (12) into which a 0.79-kilobase pair EcoRI-SphI fragment bearing the pyr promoter, 5'-leader, and pyrR from pTS185 (3) was inserted), in which PyrR expression was driven by tandem lac and pyr promoters. E. coli SØ408 (relA1 rpsL254 metB1 upp-11, from J. Neuhard, University of Copenhagen), a strain lacking endogenous UPRTase activity, bearing pTSROX3 was grown in 3 liters of Luria broth, supplemented with 97 µg of ticarcillin and 3 µg of clavulanic acid/ml of culture. The cells were harvested by centrifugation, washed in cold 0.9% NaCl, and stored at 80 °C.

All enzyme purification procedures were performed at 4 °C. The pH values for Tris buffers were determined at 25 °C. The cells were resuspended with 8 ml of 100 mM Tris acetate, pH 7.0, per g of cell paste, disrupted by sonication on ice, and cell debris removed by centrifugation.

Streptomycin sulfate (0.11 volume of a 10% solution freshly prepared in 100 mM Tris acetate, pH 7.0) was added, and the precipitate was removed by centrifugation. Further contaminants were precipitated with 0.538 volume of saturated ammonium sulfate, which was buffered with 100 mM Tris acetate, pH 7.0, and removed by centrifugation. PyrR was precipitated from the supernatant solution by the addition of 0.857 volume of buffered saturated ammonium sulfate and collected by centrifugation. The precipitate was resuspended in 4 ml of buffer R (100 mM Tris acetate, pH 7.0, 10 mM Na⁺P_i, 100 mM NaCl) for every g of the cell paste used. The solution was dialyzed against buffer R.

The entire sample was loaded onto a 2.2 × 21-cm Q-Sepharose Fast Flow (Pharmacia) column that had been equilibrated in buffer R. Buffer R (400 ml) was allowed to flow through the column, and PyrR was eluted using an 800-ml linear NaCl gradient, from 100 to 300 mM, in 100 mM Tris acetate, pH 7.0, 10 mM Na⁺P_i. Fractions from the trailing half of the PyrR peak, which eluted at a conductivity equivalent to 217-238 mM NaCl, were pooled. The pooled PyrR sample was then concentrated approximately 6-fold by pressure dialysis.

Additional impurities were precipitated with an equal volume of saturated ammonium sulfate and removed by centrifugation. PyrR was precipitated from the supernatant fluid by the addition of another equal volume of saturated ammonium sulfate, then collected by centrifugation. The precipitate was dissolved in 0.5 ml of 10 mM Tris acetate, pH 7.5, per g of cell paste used and dialyzed against 10 mM Tris acetate, pH 7.5. The dialyzed solution was divided into aliquots and stored at 80 °C.

UPRTase Assay

UPRTase activity was determined by measuring the conversion of [2-¹⁴C]uracil to [¹⁴C]UMP by modifications of the method of Rasmussen et al. (13).

Method 1-- Method 1 was used during development of the purification of PyrR. The assay conditions were pH 9.0 at 37 °C, 50 mM Tris acetate, 20 mM 2-mercaptoethanol, 5 mM MgCl₂, 1.2 mM PRPP, and 0.1 mM [¹⁴C]uracil (about 4.4 × 10⁴ dpm/assay). The assay mix (20 µl, containing all components but PRPP) was combined with 20 µl of enzyme, which was diluted in 0.1 M Tris acetate, pH 9.7, and 1 mg/ml BSA. Reactions were preheated for 1 min at 37 °C, initiated with 10 µl of 6 mM PRPP, and incubated for 5 min at 37 °C. (For purified PyrR after the Q-Sepharose step it was necessary to stabilize the enzyme by including 3 mM PRPP in the assay mix and initiating the reactions with 10 µl of 0.5 mM [¹⁴C]uracil.) The reactions were stopped by heating at 100 °C for 1 min. Separation of the product [¹⁴C]UMP from [¹⁴C]uracil on DEAE-cellulose paper was essentially as described for Method 2 below.

Method 2-- After purified PyrR was available the assay was further optimized, and Method 2 was used for kinetic characterization of the purified protein. Each assay contained 20 µl of 0.125 M buffer, 12.5 mM MgCl₂, and 2.5 times the desired final concentration of PRPP. PyrR was diluted into 100 mM buffer containing 1 mg/ml BSA immediately before assay, and 20 µl was mixed with 20 µl of assay mix and incubated at 37 °C for 5 min. Reactions were initiated by the addition of 10 µl of [¹⁴C]uracil at 5 × the desired final concentration (1.5-6 × 10⁵ cpm). Reactions occurred at 37 °C, and 5-µl samples taken at various reaction times were spotted onto 1-cm² squares of DEAE-cellulose paper (Whatman) and dried rapidly. The spotting was found to stop the reaction very quickly, so heating was not necessary. The DEAE-cellulose paper was washed four times for 20 min each with water and once for 15 min with methanol. To determine the total ¹⁴C counts in each reaction mixture duplicate 5-µl samples from each tube were spotted onto squares of DEAE-cellulose which were not washed. Radioactivity on the DEAE-cellulose paper squares was determined by liquid scintillation counting. Kinetic data were analyzed using the KinetAsyst (IntelliKinetics, State College, PA) computer program. At least five concentrations of each substrate were used at each pH value reported; the data fit well to a Ping Pong Bi Bi rate equation at all pH values.

Electrospray Ionization Mass Spectroscopic Analysis of PyrR

For ESI-MS, PyrR was dissolved in a 50% acetonitrile (v/v) and 0.1% formic acid (v/v) solution by repeated desalting using a Microcon^TM 10 concentrator (Amicon, Beverly, MA) until all salts were reduced to picomolar concentrations. The sample was submitted to the University of Illinois School of Chemical Sciences Mass Spectrometry Laboratory for ESI-MS analysis on a VG Quattro (quadrupole-hexapole-quadrupole) mass spectrometer system (Fisons Instruments, VG Analytical; Manchester, U. K.). Data acquisition and processing were controlled by the VG MassLynx (version 2.0) data system (Micromass, Manchester, U. K.). MaxEnt (maximum entropy) software (Micromass) was used for the processing and analysis of zero charge state electrospray data.

Sulfhydryl Group Titration

Cysteinyl sulfhydryl groups were titrated with 4 mM 5,5'-dithio-bis(2-nitrobenzoate), measuring the increase in absorbance at 412 nm as described by Ellman (14). The buffer used for titration of native PyrR was 0.1 M KP_i, pH 7.3, containing 1 mM EDTA; for denatured PyrR the buffer was 0.1 M Tris-Cl, 1 mM EDTA, 0.5% SDS, pH 8.4. The concentration of PyrR was determined from its extinction coefficient of 7,100 M¹ cm¹ at 275 nm.

Gel Filtration Analysis of PyrR

A column (1-cm diameter, 95-cm height, 75-ml bed volume) of Sephadex G-150 (Pharmacia Biotech Inc.) was used to determine the native molecular weight of PyrR. The buffer used was 50 mM Tris acetate, pH 7.5. The column was loaded with 0.6-1.0-ml samples of PyrR and eluted at 4 °C. Proteins used to construct a M_r standard curve for the column were myoglobin, chicken serum albumin, yeast hexokinase, and bovine -globulin. The protein concentrations in the eluted fractions were determined by their absorbance at 280 nm; when the protein was too dilute or the fractions contained UMP, the protein was determined using the Bradford method (15) with reagents purchased from Bio-Rad.

Preparation of Transcription Templates

A template for in vitro run-off transcription of pyr mRNA nucleotides +682 to +761, which correspond to the anti-antiterminator (or "binding loop") from the pyrR-pyrP intercistronic region, was created using PCR. The PCR was performed using the forward primer 5'-CGGAATTCTAATACGACTCACTATAGGGAGATATGAAAACGAATAATAGATCACCTTTTTAA-3' (where an EcoRI site is underlined and is immediately upstream of a bacteriophage T7 promoter in italics), the reverse primer 5'-CGGGATCCTTTTTGGGCCTTTGTTGTG-3' (where a BamHI site is underlined), and the pLS361 plasmid (5) as template. The purified PCR product was digested with EcoRI and BamHI and ligated into similarly digested pUC18 to create pBSBL2. This plasmid template was linearized with BamHI before its inclusion in the transcription reaction.

Similarly, templates for in vitro run-off transcription of pyr mRNA nucleotides +722 to +796 and +772 to +809, which correspond to the antiterminator and terminator, respectively, from the pyrR-pyrP intercistronic region, were created using PCR. The antiterminator template pBSAT2 was synthesized using the primers 5'-CGGAATTCTAATACGACTCACTATAGGGAGAGAGGTTGCAAAGAGGTG-3' (where an EcoRI site is underlined and is immediately upstream of a bacteriophage T7 promoter in italics), 5'-CGGGATCCACGCGTTTACGCAAAGAGGCATACAAAG-3' (where a BamHI site is underlined, and an MluI site is in italics), and pLS361 as template. The purified PCR product was digested with EcoRI and BamHI and ligated into similarly digested pUC18 to create pBSAT2. This plasmid template was linearized with MluI before its inclusion in the transcription reaction. The terminator template pBST2 was synthesized using the primers 5'-CGGAATTCTAATACGACTCACTATAGGGAGAGTCTTTGTATGCCTCTTTGC-3' (where an EcoRI site is underlined and is immediately upstream of a bacteriophage T7 promoter in italics), 5'-CGTCTAGACCTCTTTGCTTTTTTACGC-3' (where an XbaI site is underlined), and pLS361 as template. The purified PCR product was digested with EcoRI and XbaI and ligated into similarly digested pUC18 to create pBST2. This plasmid template was linearized with XbaI before its inclusion in the transcription reaction.

To create a template that contained the same pyr nucleotides as pBSBL2 but was designed to transcribe the antisense RNA strand corresponding to the anti-antiterminator, two synthetic DNA oligonucleotides were annealed and used as the template to produce run-off transcripts directly. The first oligonucleotide, or "top strand," corresponds to the core T7 promoter sequence (5'-TAATACGACTCACTATA-3'). The second oligonucleotide, or "bottom strand," has a sequence that anneals to the T7 promoter at one end and also nucleotides that are complementary to the desired pyr transcript (pyr mRNA nucleotides +761 to +682). The sequence of the bottom strand oligonucleotide was 5'-TATGAAAACGAATAATAGATCACCTTTTTAAGGGCAATCCAGAGAGGTTGCAAAGAGGTGCACAACAAAGGCCCAAAAAGTCTCCCTATAGTGAGTCGTATTA-3' (the sequence complementary to the T7 promoter oligonucleotide is underlined). The top strand (30 pmol) and bottom strand (25 pmol) oligonucleotides were annealed according to the procedure of Milligan and Uhlenbeck (16).

Preparation of pyr RNA

pyr RNA for use in the electrophoretic gel mobility shift assay was prepared by in vitro run-off transcription using the MEGAshortscript^TM kit from Ambion (Austin, TX) as described by the manufacturer, except that 1 µl of 75 mM ATP diluted 1:500 in RNase-free H₂O and 5 µl of [-³²P]ATP (3,000 Ci/mmol, 10 mCi/ml, ICN, Costa Mesa, CA) were added to each 20-µl reaction mixture. The full-length RNA product was purified by electrophoresis on a denaturing 20% polyacrylamide gel (19:1, acrylamide:bisacrylamide) containing 8 M urea. The RNA was visualized by autoradiography, excised, and eluted with 1 ml of 0.5 M ammonium acetate, 10 mM MgSO₄, 0.1% SDS, 1 mM EDTA in RNase-free H₂O at room temperature for at least 3 h. The elution solution was extracted twice with acid phenol:chloroform and precipitated with ethanol. The pellet was washed twice with cold absolute ethanol and air dried. The RNA was resuspended in RNase-free TE (10 mM Tris-HCl, 1 mM EDTA, pH 8.0, in RNase-free H₂O). The molar concentration of each RNA species was determined from the radioactivity of the full-length RNA, the specific radioactivity of the ATP in the transcription mixture, and the number of adenine residues in each transcript. Each RNA was diluted in RNase-free TE to a stock concentration of 500 pM.

Preparation of Nonspecific RNAs

Nonspecific RNA was prepared as above but using the plasmid templates as follows. An 18 S rRNA transcript was prepared using the template provided with the Ambion MEGAshortscript^TM kit; an actin transcript was prepared using the template provided with the Ambion MAXIscript^TM kit; and an RNA corresponding to multiple cloning site DNA was prepared using pSP72 (Promega, Madison, WI) linearized with HindIII.

Electrophoretic Mobility Shift Assay for RNA Binding

Gel shifts were performed using a Bio-Rad PROTEAN® IIxi electrophoresis apparatus with the core cooled to 2 °C and the buffer recirculating between the upper and lower reservoirs. All gel shifts were run on 6% native polyacrylamide (79:1, acrylamide:bisacrylamide) gels containing 12.5 mM Tris acetate, pH 7.5, and 2.5% glycerol (v/v), using 12.5 mM Tris acetate, pH 7.5, containing 1 mM magnesium acetate as running buffer. Gels were pre-run at 150 V for 90 min and then cooled by recirculation for 1 h. RNA-binding reaction mixtures were loaded onto the gel with tracking dyes in a separate lane. The gel was subjected to electrophoresis at 30 V for 15 min followed by 300 V for 3 h. The gel was blotted onto filter paper, dried, and radioactivity was visualized by exposing the gels to x-ray film. For quantitation of the binding data, the dried gel was exposed to a storage PhosphorImage screen (Molecular Dynamics, Sunnyvale, CA), after which the data were quantitated with a PhosphorImager using the ImageQuant software. Binding curves were fit to hyperbolae, and binding constants were calculated using the KinetAsyst computer program as described above.

RNA-binding reaction mixtures were assembled on ice. The binding conditions were modified from the procedure of Batey and Williamson (17). Each reaction contained 16 µl of binding mix, 2 µl of PyrR (diluted as described below), and 2 µl RNA (prepared as described below; final concentration of 50 pM RNA). The binding mix gave final assay concentrations of 10 mM HEPES-KOH (pH 7.5), 50 mM potassium acetate, UMP (when added), 1 mM magnesium acetate, 0.1 mM EDTA, 0.1 mg/ml yeast tRNA, 5 µg/ml heparin, 0.01% Igepal CA-630 (Sigma; Igepal CA-630 is an analog of Nonidet P-40), and 0.08 unit/µl placental RNase inhibitor (Ambion). PyrR was diluted using 12.5 mM Tris acetate buffer, pH 7.5, which contained 1 mg/ml RNase-free acetylated BSA (U. S. Biochemical Corp.). Because PyrR has poor thermostability at high dilution, the protein must be thawed on ice and diluted immediately before use. To minimize alternate RNA secondary structures, the RNA was heated to 75 °C for 15 min, slow cooled for 1 h, and cooled on ice for 5 min before its incorporation into the binding mixture. The completed binding reactions were incubated on ice for 1 h before loading on the gel. Immediately before loading them onto the gel, 2 µl of RNase-free 50% glycerol was added to the reaction mixtures.

	RESULTS AND DISCUSSION

Top Abstract Introduction Procedures Results & Discussion References

Overexpression and Purification of PyrR-- B. subtilis DNA specifying the pyr promoter, 5'-leader, and pyrR was cloned into pUC18 to generate plasmid pTSROX3, in which the expression of pyrR was driven from the tandem lac and pyr promoters. pTSROX3-encoded PyrR was expressed to about one-third of the total cell protein in E. coli strain SØ408. In other experiments (not shown) the addition of uracil to the growth medium did not reduce the amount of pTSROX3-encoded PyrR produced in a different strain of E. coli. Thus, although the PyrR protein regulates its own expression in B. subtilis (3), such regulation was not observed in an E. coli background. Because transcriptional attenuation of pyr genes can be demonstrated with purified PyrR and E. coli RNA polymerase in vitro (9), we suggest that the failure to see such attenuation in vivo might reflect significant differences in the intracellular concentrations of the regulatory metabolites UMP and PRPP in the two species.

Physical Characterization of PyrR-- Two preparations of purified PyrR were subjected to ESI-MS analysis. Three major components, comprising about 95% of the total protein, were resolved (results for one of the preparations are shown in Fig. 1). The mass of the most abundant component of each sample, approximately 70%, was 20,263 ± 2 Da. Another component, comprising approximately 10% of each preparation, had a mass of 131-132 Da smaller than the main component, which matches the change in mass expected for removal of the NH₂-terminal methionine that is known to be present on the bulk of PyrR produced in E. coli (3). The third major component, which comprised about 12% of the total protein, was 28 Da smaller than the most abundant component. This component and several other minor components were not identified.

View larger version (12K): [in this window] [in a new window]   Fig. 1.   ESI-MS analysis of purified PyrR. Peak heights are proportional to the relative abundance of the peaks. The masses determined for each significant peak are printed above the peak.

1

1

1

1

UPRTase Activity of PyrR-- The UPRTase activity of PyrR was first identified from the ability of the pyrR gene to complement the upp mutation in E. coli SØ408 and assays of UPRTase activity in SØ408 cells bearing a pyrR-encoding plasmid (3). This activity was confirmed by the very high levels of UPRTase activity in cells in which PyrR was overexpressed and by the increase in specific activity of UPRTase as PyrR was purified to homogeneity. Assays of the UPRTase activity of PyrR in crude extracts were initiated by the addition of PRPP because the presence of many other PRPP-consuming enzymes made preincubation of the crude extract with PRPP undesirable. When PyrR was purified, however, the high dilution of the protein needed to bring the assay into the linear range required preincubation of PyrR with Mg²⁺ ions and PRPP to obtain assays that were linear with time and to avoid inactivation of the enzyme at high dilution. This approach was suggested to us by the studies of Jensen and Mygind (18), who showed that the UPRTase from E. coli is converted to a more highly aggregated and more active form by incubation with Mg²⁺ and PRPP. In the case of PyrR, stabilization of the UPRTase activity by Mg²⁺ and PRPP was especially necessary when the protein was diluted and incubated at 37 °C instead of 0 °C. Dilution of PyrR into buffer containing 1 mg/ml BSA was also necessary to prevent losses of UPRTase activity.

View larger version (21K): [in this window] [in a new window]   Fig. 2.   pH-activity profile for the UPRTase activity of PyrR. Values of Vmax (panel A) and Michaelis constants (panel B) for uracil and PRPP are shown for the range from pH 7.7 to 9.7. Method 2 was used for the UPRTase assays. Buffers used were: pH 7.7, HEPES and Tris; pH 8.2, Tris; pH 8.7, Tris and Ser; pH 9.2, Ser and Gly; pH 9.7, Gly. Counterions were Na+ for HEPES, Gly, and Ser and acetate for Tris.

RNA Binding to PyrR-- The binding of ³²P-labeled RNA to PyrR was measured by an electrophoretic gel mobility shift assay as described under "Experimental Procedures." In most cases purified PyrR was used; the radioactive oligonucleotide used for most of the characterization of binding was an 80-nucleotide segment corresponding to residues +682 through +761 from the conserved sequence of the pyrR-pyrP intercistronic region, i.e. the anti-antiterminator of the second attenuation region (3, 5), which had been shown in preliminary studies to bind well to PyrR. The specificity of the interaction between PyrR and pyr mRNA was tested in two ways. First, to demonstrate that the RNA was bound specifically by PyrR, gel shift experiments were performed using the 80-nucleotide pyr RNA and crude extracts from either E. coli SØ408/pTSROX3, which overexpresses PyrR, or E. coli SØ408/pUC18, which carries the vector plasmid only. The crude extract containing overexpressed PyrR clearly contained a protein that binds RNA; increasing amounts of this extract increased the amount of RNA bound (Fig. 3). In contrast, the crude extract from cells that contained the vector only contained no protein that bound detectably to RNA; at the highest concentrations of such extracts tested some degradation of the RNA was evident. These results indicate that the PyrR protein binds to RNA and rules out the possibility that an impurity in the PyrR preparation binds to the RNA instead.

View larger version (55K): [in this window] [in a new window]   Fig. 3.   Binding of pyr mRNA by crude extracts of E. coli cells in which PyrR was overexpressed (SØ408/pTSROX3) and a control strain bearing the plasmid vector only (SØ408/pUC18). Electrophoretic gel mobility shift analysis was used. Approximately 50 pM pyr mRNA from pBSBL2/BamHI (nucleotides +682 to +761) and 500 µM UMP were included in all samples. Nucleotide numbers refer to the start of transcription of the B. subtilis pyr operon (2) as +1.

View larger version (84K): [in this window] [in a new window]   Fig. 4.   Specificity of binding of purified PyrR to various segments of pyr mRNA. Electrophoretic gel mobility shift analysis was used with 50 pM RNA, 500 µM UMP, and the concentrations of purified PyrR shown. The anti-antiterminator (binding loop) RNA is from the pBSBL2/BamHI template, the antiterminator RNA is from the pBSAT2/MluI template, the terminator RNA is from the pBST2/XbaI template, and the anti-antiterminator (binding loop) antisense RNA is from annealed synthetic oligonucleotides as described under "Experimental Procedures." Nucleotide numbers refer to the start of transcription of the B. subtilis pyr operon (2) as +1.

View larger version (20K): [in this window] [in a new window]   Fig. 5.   Dependence of PyrR binding to RNA on PyrR concentration and UMP. Electrophoretic gel mobility shift experiments were performed with purified PyrR as shown and 50 pM pyr RNA from the pBSBL2/BamHI template (nucleotides +682 to +761). UMP was at 500 µM when present. Each data point is the average of three independent trials, and the error bars indicate the S.D. of these determinations.

View larger version (15K): [in this window] [in a new window]   Fig. 6.   Concentration dependence of UMP stimulation of RNA binding by PyrR. Experimental conditions were as in Fig. 5, except that the concentration of purified PyrR was held constant at 80 nM. Each data point is the average of three independent trials.

Relationships between PyrR and other RNA-binding Attenuation Proteins-- Although our studies have concentrated on PyrR from B. subtilis, it has become clear that PyrR homologs are found in many species of bacteria in which they probably also regulate pyr gene expression; examples include B. caldolyticus (8), Enterococcus faecalis (21),³ Lactobacillus plantarum (22), and Lactococcus lactis (23). Recently, a Thermus species has been shown to encode a PyrR that probably binds to pyr mRNA but acts as a translational repressor (24). Genes with strong sequence similarity to pyrR have been found in two other species, but it is less clear whether they function as RNA-binding regulatory proteins in these cases (25, 26).