|
J Biol Chem, Vol. 273, Issue 11, 6402-6409, March 13, 1998
A Novel Site, Mt, in the Human Desmin Enhancer Is Necessary for
Maximal Expression in Skeletal Muscle*
Jie
Gao §,
Zhenlin
Li ¶ , and
Denise
Paulin ¶**
From the Laboratoire de Biologie Moléculaire de
la Différentiation Cellulaire, Université Paris VII and
¶ SCME Institut Pasteur, 25 rue du Dr. Roux,
Paris cedex 15, France
 |
ABSTRACT |
Previous investigations have shown that
expression of the muscle-specific intermediate filament desmin gene in
skeletal muscle is controlled in part by a 5' muscle-specific enhancer.
This enhancer activity can be divided into myoblast-specific and
myotube-specific activation domains. The myotube-specific region
contains a MyoD and MEF2 sites, whereas the myoblast-specific region
contains Sp1, Krox, and Mb sites. In the present study, we designed
mutations in the conserved portion of the myotube-specific region;
transfection analysis of these mutations showed that a novel site
located between the MyoD and MEF2 sites, named Mt (GGTATTT), is
required for full transcriptional activity of the desmin enhancer in
skeletal muscle. Although gel mobility shift assays demonstrate that
myotube, myoblast, fibroblast, and HeLa nuclear extracts contain a
nuclear factor that binds specifically to Mt, four copies of the Mt
site function as the native enhancer only in myotubes. Functional
synergism among the MyoD, MEF2, and Mt sites in myotubes has been
demonstrated. These results show that the novel Mt site cooperates with
MyoD and MEF2 to give maximal expression of the desmin gene.
 |
INTRODUCTION |
Skeletal muscle commitment, differentiation, and maturation are
largely controlled by the transcriptional regulation of a large battery
of unlinked muscle-specific genes. A variety of different DNA sequence
motifs that are required for muscle-specific gene transcription have
been identified in many genes. These include the E-box (CANNTG), MEF2
site (CTA(A/T)4TAG), M-CAT-box (CCATCCT), and CArG-box
(CC(A/T)4GG) that serve as binding sites for the myogenic
basic helix-loop-helix MyoD1 family proteins (1-5), MEF2 protein
(6-9), TEF1 (10-12), and serum response factor (13), respectively.
Other sequence elements required for the transcription of genes
expressed in skeletal muscle have been defined by mutational analysis
of promoter-reporter constructions, such as Trex (14), CCAC-box (15,
16), MEF3 (15, 17), Mb (18) etc., but their corresponding binding
factors await characterization. The aim of the present study is to find
new elements necessary for desmin gene expression in skeletal
muscle.
Desmin, a muscle-specific member of the intermediate filaments protein
multigene family, is encoded by a single gene (19, 20). Desmin is
located at the level of the Z-disc in striated muscles. It has been
proposed that desmin maintains the integrity of muscle tissues upon
stress. Cardiovascular lesions and skeletal myopathies have been found
in mice lacking desmin (21). Desmin is expressed at early stages of
myogenesis, such as in replicating myoblasts and satellite cells and at
high levels in differentiated myotubes (22-27). In a previous study,
we demonstrated that the sequence including 228 bp1 upstream of the
transcription initiation site is sufficient to confer low level
muscle-specific expression. A negative region was located between 693
and 228 bp. High level expression of the gene depends on a 280-bp
muscle-specific enhancer located between 693 and 973 bp (28). This
enhancer can activate either the desmin promoter or heterologous
promoters in myogenic cells and can function not only in myotubes but
also in myoblasts via the action of two independent activating regions
(18). In the myoblast-specific domain, four regions are protected by
nuclear factors from myogenic cells; three of these contain a GC-rich sequence sharing homology with the Krox binding site (29). Deletion and
site-directed mutation experiments demonstrated that at least two
Krox-like sequences are required for enhancer activity in myoblasts. In
addition, another GC-rich sequence, designated Mb, sharing some
homology with an Ets binding site, is also required for full enhancer
activity in myoblasts. In the myotube-specific region, one MyoD site
and one MEF2 site are necessary for full enhancer activity in
myotubes.
In the present study, we demonstrate that a novel site Mt (GGTATTT) is
necessary for maximal expression of desmin in myotubes. We show that
this novel Mt site cooperates with MyoD and MEF2 sites to give maximal
expression of desmin. Mutation of Mt in the myotube-specific enhancer
resulted in the decrease of the transactivation level by the MyoD
family in nonmyogenic cells in the cotransfection experiments. Four Mt
motifs arranged in a palindrome could function as a strong enhancer in
myotubes. Finally, gel shift experiments show that the Mt site could
specifically bind nuclear factors.
 |
EXPERIMENTAL PROCEDURES |
Mutagenesis of the Desmin Myotube-specific Enhancer and
Preparation of Constructions--
Site-directed mutagenesis of the
human desmin enhancer was performed according to the method described
by Kunkel (30). The oligonucleotide MuMyoD was used to change
the MyoD site from CAGCTG to aAtCTG, and oligonucleotide MuMt1 was used
to mutate the Mt site from GGTATTT to GGgATcc. Previous experiments
involving transfection of the deletion mutants in myotubes have
demonstrated that 70 bp ( 919 to 850) of the human desmin
myotube-specific enhancer gives an activity similar to that of the
complete enhancer in myotubes (18). We synthesized this 70-bp fragment
by polymerase chain reaction using oligonucleotide 1, with a
HindIII linker (5'-AAGCTTCTCCTCTATAAATACC-3') corresponding
to 919 to 901 bp, and oligonucleotide 2, with XbaI
linker (5'-TCTAGAGTCAACCCAACCATCT-3') corresponding to 834 to 850
bp. The polymerase chain reaction-amplified fragment was inserted into
the HindIII-XbaI sites of pBLCAT2, which
contains the herpes simplex virus thymidine kinase promotor and the
chloramphenicol acetyltransferase (CAT) gene (31). To obtain the
mutation in the MEF2 and Mt sites, the following oligonucleotides were
used, respectively, as primers in combination with oligonucleotide 2 in
a polymerase chain reaction: MuMEF2, 5'-GAAAGCTTCTCCTCgagAAATACC-3'; MuMEFMt*, 5'-GAAAGCTTCTCCTCTAggccTACCCGC-3'; MuMt*,
5'-GAAAGCTTCTCCTCTATAAATAggaGCTCTGG-3'; MuFL1,
5'-GAAAGCTTCTCCTCTATAAATACCCGCcgcGGTATTT-3'; MuMt2,
5'-GAAAGCTTCTCCTCTATAAATACCCGCTCTGGTAccTGGGG-3'; MuMt3,
5'-GAAAGCTTCTCCTCTATAAATACCCGCTCTGagATcTGGGG-3'; MuFL2, 5'-GAAAGCTTCTCCTCTATAAATACCCGCTCTGGTATTTaaaGTTGG-3'. Mutated
nucleotides are presented in lowercase letters. Mt* indicates a
sequence (AAATACC) complementary to the Mt site that overlaps with the
MEF2 site. FL indicates the flanking sequence around the Mt site. The
polymerase chain reaction products were inserted 5' to the tk-CAT in
the pBLCAT2 plasmid (31), and the resulting constructs are listed in Fig. 1. To study the transcriptional activity of the Mt motif, the
oligonucleotides Mt (sense,
5'-ATACCCGCTCTGGTATTTGGGGTTG-3'; antisense,
5'-CTGCCAACCCCAAATACCAGAGCGGG-3') and the oligonucleotides 2Mt, containing two palindromic Mt sites (sense,
5'-CTAGAGGAAATACCCGCTCTGGTATTTGGGGTT-3'; antisense,
5'-CTAGAACCCCAAATACCAGAGCGGGTATTTCCT-3') were
annealed and inserted into both the plasmid pBLCAT2 (31) and
pDes-237CAT containing the human desmin promoter and CAT gene (28). The constructs containing one, two, and four Mt motifs were obtained.
Cell Culture, Transfection, and CAT Assays--
Gene transfer
into C2,7 myogenic cells (32), NIH 3T3 fibroblasts, fibroblast
C3H10T1/2, and HeLa cells; harvesting of cell extracts; and CAT assays
were performed as described previously (28).
Preparation of Nuclear Extracts--
Preparation of nuclear
extracts from different cell lines was based on the methodology of
Hazan et al. (33).
Oligonucleotides--
Oligonucleotides used in gel mobility
shift assays were purchased from the Genset Company (Paris, France) and
are presented in Fig. 6.
Gel Mobility Shift Assays--
Gel mobility shift assays were
typically performed as described previously (28) in a 20-µl reaction
volume at room temperature. Each reaction mixture contained 1 µg of
double-stranded poly(dA-dT) or poly(dI-dC), 0.5-1 ng of labeled DNA
probe, and 4 µg of protein in crude nuclear extracts in 10 mM HEPES, pH 8.0, 0.1 mM EDTA, 0.5 mM dithiothreitol, 8% glycerol, 1 mM MgCl, and
60 mM KCl. For the supershift assay, 2 µl of antibody
against MEF-2 (Santa Cruz Biotechnology, Santa Cruz, CA) was added into
the mixture after the addition of probe and incubated for 30 min at
room temperature.
 |
RESULTS |
The Novel Mt Site Cooperates with MyoD and MEF2 Sites to Give
Maximal Expression in Differentiated Skeletal Muscle
Cells--
Previous studies involving transfecting the deletion
mutants in myotubes have demonstrated that 70 bp ( 919 to 850) of
the human desmin myotube-specific enhancer produces an activity similar to that of the full enhancer in myotubes (28). Nucleotide sequence comparisons of this enhancer region with hamster (34) and mouse enhancers (35) showed that this region has been conserved during mammalian evolution, suggesting that it may therefore be important for
enhancer function. Fig. 1A
shows an alignment of this sequence. Within these 70 bp, 90% are
conserved across the three species. Interestingly, a previous
footprinting experiment had demonstrated that 42 bp of this region were
protected by nuclear extracts from muscle cells (18). This 42-bp region
includes MEF2 and MyoD binding sites. Due to its high degree of
evolutionary conservation and its capacity to bind nuclear factors, we
decided to analyze this region in more detail for its transcriptional
activity.

View larger version (51K):
[in this window]
[in a new window]
|
Fig. 1.
Desmin gene enhancer and effects of mutations
in the myotube-specific enhancer region on reporter gene expression.
A, nucleotide sequence comparison of human (28), mouse (35), and hamster desmin enhancers (34). Residues are compared with the human
sequence, and identical nucleotides are indicated by a dot.
Nonconserved residues are indicated in lowercase letters. Gaps have been introduced to optimize the alignment. Known
MEF2 and MyoD regulatory sites are underlined. The Mt site
is shown by arrows. The palindromic sequence of Mt is
indicated as Mt*. The DNase I footprint region identified previously
(18) is boxed. B, schematic representation of the
1-kilobase pair human desmin regulatory region. Previous studies (18,
28) demonstrated two positive regions and one negative region; one
positive region is an enhancer containing two different regions, one
active in myotubes (in hatched box) and the other in
myoblasts (in waved box). Potential regulatory sites are
indicated. K1, K2, and K3 represent
Krox sites (29); NE2 is a negative element found in the
vimentin promoter (36). PR, promoter region; NR,
negative region; + and represent relative transcription
activity. C, constructs tested in mutational analysis and
relative CAT activity in myoblasts and myotubes. The 70-bp
myotube-specific sequence is presented. MEF2 and MyoD sites are
underlined, and palindromic Mt sites are indicated by
arrows. The mutated nucleotides are indicated by
lowercase letters. The efficiency of transfection was
controlled by cotransfection with pRSVLacZ vector. The relative CAT
activity of the mutants was normalized to that of the tk-CAT vector
without enhancer (pBLCAT2), which was assigned a value of 1 in
myoblasts and in myotubes. Data are presented as the mean ± S.D.
of four experiments. Note that mutation in the Mt site (constructs 3, 6, 7, and 8) resulted in a 60-80% decrease in CAT activity.
|
|
To investigate the cooperation between the sites present in this region
and the possibility that an additional regulatory site exists between
the MEF2 and MyoD sites, we introduced different mutations in this
42-bp region. These constructs were tested by transient transfection
assays in C2,7 myotubes and myoblasts, and the data are presented in
Fig. 1C. When linked to the tk promotor (construct 1), this
70 bp can increase expression about 33-fold compared with the tk
promoter alone in myotubes but not in myoblasts. Mutation of the MEF2
binding site resulted in a loss of 70-90% of the CAT activity in
myotubes according to the mutated nucleotides (constructs 2 and 3);
mutation of the MyoD site resulted in almost complete loss (95%) in
myotubes (construct 10). These results show that the MEF2 and MyoD1
sites are important for the gene expression in myotubes. The mutations
in constructs 6, 7, and 8 did not change gene expression in myoblasts
but resulted in a 60-80% loss of CAT activity (from 33 to 10, 13, and
7, respectively) in myotubes. These three mutations were located in a
GGTATTT sequence. Mutations in 6, 7, and 8 convert wild-type sequence
GGTATTT into GagATcT, GGTAccT, and GGgATcc, respectively. These
mutations abolished the binding activity to nuclear proteins (Fig. 5).
We designate this sequence (GGTATTT) as Mt (active in
myotubes). We found this sequence present as a
palindrome between the MEF2 and MyoD sites; one Mt* sequence, AAATACC
(complementary to the Mt site), overlaps with the MEF2 site. The
mutation in construct 3 that changes the MEF2 and Mt* site in the same
time reduced CAT activity by 70% in myotubes. Double mutations in the
MEF2 and Mt sites resulted in an almost complete loss of CAT activity
(constructs 11 and 12) in myotubes. The mutation in construct 9 that
changes the flanking sequence of the Mt site does not alter CAT
activity in myotubes or myoblasts. Mutations in constructs 4 and 5 give
rise to a 20% increase in CAT activity in myotubes and a slight
increase of CAT activity in myoblasts. The increase of CAT activity of mutant 4 in myotubes could be explained by the fact that this mutation
converted the imperfect (nonconsensus) desmin MEF2 site CTATAAATAcCC to a perfect MEF2 site
CTATAAATAGGA, which is 100% identical to the MEF2
consensus (6-9). It has been reported that the flanking sequences
modulate the cell specificity of the M-CAT regulatory site (37). The
increase in gene expression in myoblasts and myotubes for mutants 4 and
5 could also be related in that the flanking sequences around the MEF2
and Mt sites could have some negative effect, or mutations could create
new regulatory elements. These results demonstrated that the Mt
sequence is necessary for the maximal expression in myotubes, and
mutation of any one of the three sites (MEF2, Mt, and MyoD) results in
a dramatic loss of activity, suggesting a synergistic effect between
MEF2, Mt, and MyoD sites to give maximal expression in differentiated skeletal muscle cells.
Mutations of the Mt Site Diminish the Transactivation Effect of the
MyoD Family on the Desmin Enhancer in Nonmyogenic Cells--
The
discovery of the MyoD family of proteins provided the first information
about the molecular events that control myogenic commitment and muscle
fiber differentiation. When expressed in many nonmyogenic cell lines,
each member of the MyoD family is capable of converting the nonmyogenic
cells into cells capable of myotube formation and muscle-specific gene
expression (1, 38-41). The MyoD binding site alone is not sufficient
to direct high transcription and should cooperate with other sites
(42). To know if Mt site mutations influence MyoD transactivation on the desmin enhancer, the constructs containing the mutations either in
the Mt site or MyoD site linked to the desmin promoter or tk promoter
were carried out. These constructs were cotransfected with MyoD1 or
myogenin expression vectors in nonmyogenic cells C3H101/2. We have
found that both factors could greatly increase CAT activity when
wild-type desmin enhancer was present in C3H10T1/2 fibroblasts.
However, when the MyoD binding site was mutated, the transactivation
effect was diminished to the level obtained by the desmin promoter
without enhancer (Fig. 2). When the Mt site was mutated, the transactivation effect was diminished about 50%
compared with the wild-type enhancer. Similar results were obtained
when wild-type or mutated enhancer was linked to the tk promoter (Fig.
2). These results suggest that the novel Mt site is also necessary to
obtain the maximal transactivation effect by the MyoD family and that
there is a potential cooperation between Mt and MyoD sites.

View larger version (35K):
[in this window]
[in a new window]
|
Fig. 2.
Effects of Mt mutation on transactivation of
desmin enhancer by MyoD family proteins in nonmyogenic cells.
A, site-directed mutagenesis of the Mt and MyoD binding
sites and construction of expression vectors. The positions of
wild-type Mt and MyoD sites are indicated by open boxes, and
mutated sites are indicated by black boxes. The wild-type or
mutated desmin enhancers were linked to the desmin or tk promoter.
These constructs were cotransfected with the MyoD1 or myogenin
expression vectors in the nonmyogenic cells C3H10T1/2. Hatched
box, myotube-specific enhancer region; waved box,
myoblast-specific enhancer region. B, relative CAT activity
in fibroblast C3H10T1/2 cells. The efficiency of transfection was
controlled by cotransfection with pRSVLacZ vector. Data are plotted as
the mean ± S.D of three experiments. Note that when the MyoD
binding site was mutated, the transactivation effect was diminished to
about the level of the desmin-CAT (DES-CAT) or tk-CAT
constructs without an enhancer. When the Mt site was mutated, the CAT
activity was diminished to 50% of that obtained with wild-type
enhancer.
|
|
Four Mt Motifs in Palindromic Form Can Function as the Native
Enhancer in Myotubes--
To test the capacity of the Mt sequence to
direct gene expression, one, two, and four copies of the Mt site were
linked to either the tk promoter or desmin promoter. Because the Mt
site is present in a palindrome in the human desmin enhancer, two
copies and four copies of the Mt site were linked either in tandem or in palindrome fashion as indicated in Fig.
3. These constructs were transfected
transiently in HeLa cells, fibroblasts, myoblasts, and myotubes. The
results show that one copy of the Mt site linked to both tk and desmin
promoters cannot activate gene expression in these four cell types. Two
copies of the Mt site arranged in tandem or as a palindrome can give
rise to a slight increase in CAT activity (three times) only in
myotubes. Four Mt copies linked in tandem can increase about 9-fold the
expression in myotubes, but not in myoblasts, fibroblasts, and HeLa
cells. Interestingly, four Mt copies linked in palindromic fashion
function as native myotube-specific enhancers of desmin and can
increase 30 times the CAT expression in myotubes. However, in contrast
to the native desmin myotube-specific enhancer, these four copies of
palindromic Mt sequence give rise to a slight increase in CAT activity
(2-6 times) in myoblasts, fibroblasts, and HeLa cells. This suggests that sequences surrounding the Mt site in the myotube-specific enhancer
of the human desmin gene could function as negative elements in
undifferentiated muscle cells and nonmyogenic cells.

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 3.
Four Mt motifs in palindromic form can
function as a native enhancer in the myotubes. A, expression
vector bearing the Mt site. The monomer, dimers, and tetramers of the
Mt site were linked to either the tk promoter or the desmin promoter. Because the Mt sites are present in a palindrome in the human desmin
enhancer, dimers and tetramers of the Mt site were arranged either in
tandem or in palindromic fashion. These constructs were transfected
transiently in HeLa, fibroblasts, myoblasts, and myotubes. Hatched box, myotube-specific enhancer region; waved
box, myoblast-specific enhancer region. B, relative CAT
activity in four cell types. Note that four Mt copies linked in tandem
can increase gene expression about 9-fold in myotubes. Four Mt copies
linked in palindromic fashion, which function as a native
myotube-specific enhancer of desmin, can increase CAT expression
30-fold in myotubes. The efficiency of transfection was controlled by
cotransfection with pRSVLacZ vector. Data are expressed as the
mean ± S.D of five experiments.
|
|
The Mt Site Exhibits Specific Nuclear Protein
Binding--
DNA-protein binding experiments were performed to
characterize trans-acting factors that interact with the Mt site. A
26-bp oligonucleotide containing the Mt site was bound in gel mobility shift assays by nuclear proteins from HeLa cells, fibroblast 3T3, C2,7
myoblasts, and myotubes (Fig.
4A, lanes 1,
4, 7, and 10). The binding of nuclear
proteins was sequence-specific as assessed by competition with excess
unlabeled oligonucleotides bearing the wild-type Mt sequence (Fig.
4A, lanes 2, 5, 8, and
11) and the lack of competition by excess oligonucleotides
bearing the mutated Mt sequence (Fig. 4A, lanes
3, 6, 9, and 12). Since the Mt
binding complex migrated to approximately the same gel location irrespective of whether the nuclear extracts were derived from HeLa,
fibroblasts, myoblasts, or myotubes, it seems likely that the same or
similar Mt-binding protein, termed MtBF (Mt binding factor), is present
in these diverse cell types.

View larger version (108K):
[in this window]
[in a new window]
|
Fig. 4.
Panel A, specific binding of nuclear
factors to the Mt sequence. The end-labeled Mt oligonucleotide was
incubated with 4 µg of nuclear extract from HeLa cells (lanes
1-3), NIH3T3 fibroblasts (lanes 4-6), C2,7 myoblasts
(lanes 7-9), and C2,7 myotubes (lanes 10-12)
and analyzed on a 5% polyacrylamide gel. One DNA-protein complex was
observed in four cells. The Mt binding complex, indicated by an
arrow, is abolished by the addition of a 50-fold molar
excess of unlabeled Mt probe (lanes 2, 5,
8, and 11) but not by the addition of an
equivalent amount of mutated muMt1 (lanes 3, 6,
9, and 12). C, DNA-protein complex;
F, free probe. Panel B, gel supershift assay
shows that Mt-binding protein is different from MEF-2 factor. Labeled
Mt (lanes 1-8), MEF2 (Des) (lanes 9-13), and
MEF2 (MCK) (lanes 14-18) sequences, respectively, were
incubated with 4 µg of nuclear extract from C2,7 myotubes. Antibody
against MEF2 supershifted the MEF2-protein complex indicated by the
asterisk (lanes 10 and 15) but did not
change the Mt-protein complex (lane 2). The sequences containing MEF2 (MCK), Oct1, HMG, and GT-2 sites did not compete with
Mt (lanes 5-8 and 13). The Mt site cannot
compete with MEF2 site (lanes 11 and 16). The
MEF2 (Des) site containing a overlapping Mt site can form Mt- and
MEF2-protein complexes (lane 9). The Mt site is
underlined, and the MEF2 site is boxed;
nucleotides different from the consensus sequence are indicated by
lowercase letters. Panel C, effect on the binding
activity to nuclear protein of the mutation in the Mt site and
surrounding sequence. The different oligonucleotides were used as
unlabeled competitors with a 10- and 50-fold molar excess. Lane
1 indicates the complex formed with the nuclear extract of C2,7
myotubes without competitors. The following unlabeled oligonucleotides
can abolish the complex: Mt; A/T-rich sequence, MuFL1; MuFL2; MuMt4;
MEF2 (Des); and MuMyoD(Des). MuMt5 gives a slight competition. The
following oligonucleotides can not abolish the complex formation: MuMt;
MuMt2; MEF2 (MCK); MyoD1 (Des); MuMt3; MuMt6; and TATA.
|
|
The Effect of the Mutation within the Mt Site on the Binding
Activity to Nuclear Proteins--
To try to obtain a consensus
sequence for Mt, we tested the binding capacity of a series of
oligonucleotides containing different mutations in the Mt site and in
the surrounding sequences. Gel mobility shift assays showed that the
specific complex formed by Mt and nuclear proteins from the C2,7
myotubes was abolished by competition with unlabeled wild-type Mt
sequence (Fig. 4C, lanes 2 and 3),
A/T-rich sequence from myoglobin promoter (Fig. 4C,
lanes 4 and 5) (43), MuFL1 (Fig. 4C,
lanes 6 and 7), and MuFL2 (Fig. 4C,
lanes 8 and 9). MuFL1 and MuFL2 change only the flanking sequence around the GGTATTT sequence. The A/T-rich sequence contains a GCTATTT sequence. This complex is also abolished by the
unlabeled MEF2 oligonucleotide of the human desmin enhancer (Fig.
4C, lanes 18 and 19), which contains
an overlapping Mt sequence, GGTATTT, but is not abolished by the MEF2
site of the MCK enhancer, which contains a GTTATTT (Fig. 4C,
lanes 16 and 17). To show that MtBF is not
related to the MEF2 family, gel supershift analysis was performed, and
the results demonstrated that the antibody against MEF-2 did not change
the Mt binding activity (Fig. 4B, lane 2),
whereas this antibody can supershift the band formed by MEF-2 site from
the MCK and desmin enhancer (Fig. 4B, lanes 10 and 15). In addition, the Mt site cannot compete with the
MEF2 site of MCK and vice versa (Fig. 4B). The
MEF2 site of the desmin enhancer containing the GGTATTT sequence can
form both MEF-2 and Mt complexes (Fig. 4B, lane
9). These results demonstrated MtBF is different from MEF-2. The
Mt-protein complex is not abolished by a MyoD site of the human desmin
enhancer (Fig. 4C, lanes 20 and 21),
but surprisingly mutation of the MyoD site GGCAGCTG to GGAATCTG abolished the complex (Fig. 4C,
lanes 22 and 23). The mutations that transformed
GGTATTT to GGTAccT, GGgATcc, ccTATTT, and GagATcT (Fig. 4C,
lanes 9-12, 24, 25, 28,
and 29) cannot compete with the Mt sequence. The mutation
from GGTATTT to cGTATTT exhibits a slight competition with Mt (Fig.
4C, lanes 26 and 27). To show that the
Mt binding activity is different from TATA-box binding activity, an
oligonucleotide containing a potential TATA-box
(GGTATAAAAA) was used as competitor and shows no
competition with Mt (Fig. 4C, lanes 30 and
31). MtBF is also different from the HMG-box proteins and
Oct1-2 factors, because the oligonucleotides containing an HMG-box
binding site (TTCAAAG) and Oct binding site (ATGCAAAT) (44) cannot
compete with the Mt site (Fig. 4B). The Mt motif (GGTATTT)
differs in one nucleotide from the GT2-box (GGTAATT), which is present
in the promoter of phytochrome polypeptide-encoding gene A of rice. The
GT2 binding factor shares a trihelix motif (HLHLH,
helix-loop-helix-loop-helix) and might be representative of a new class
of DNA-binding proteins (45). But the competition assay showed that
MtBF is not related to the GT2 factor (Fig. 4B, lane
8). The oligonucleotides used in the gel mobility shift assays
were listed in the Fig. 5. A preliminary
consensus sequence (G(G/C)(T/A)AT(T/C)T) for the Mt site has been
deduced. No homology with Mt has been found within the known DNA
binding sequences (for a review, see Ref. 44). Using the preliminary
consensus, we were able to identify several potential Mt sites in other
muscle-specific control regions (Fig. 6).
These sites are located within regions that have been shown to be
functionally important for transcription of the associated genes, most
of them overlapped with a potential MEF2 site.

View larger version (50K):
[in this window]
[in a new window]
|
Fig. 5.
The oligonucleotides and their capacity to
bind nuclear proteins. The oligonucleotides used in the gel
mobility shift assays (Fig. 4) are listed. Only one strand of the
oligonucleotides is indicated, and the antisense strand of MEF2 (MCK),
MEF2 (DES), and A/T-rich sequence are shown to facilitate sequence
comparison. The capacity of each oligonucleotide to abolish the complex
formation in the gel mobility shift assays is indicated by a plus
symbol (competition) and minus symbol (no competition).
A preliminary consensus sequence (G(G/C)(T/A)AT(T/C)T) for the Mt site
has been deduced. Oligonucleotides MyoD (Des) and MyoDmut (Des)
correspond to a wild-type and a mutated MyoD binding site,
respectively, of the desmin enhancer. Oligonucleotides MEF2 (Des) and
MEF2 (MCK) represent the MEF2 binding sequences from the enhancer of
the desmin and the MCK gene (46), respectively. A/T-rich sequence is
from the myoglobin upstream region (43). The nucleotides different from
the Mt oligonucleotide are indicated by lowercase letters.
The Mt site and the mutated sequences within this Mt site are
underlined.
|
|

View larger version (60K):
[in this window]
[in a new window]
|
Fig. 6.
Potential Mt sites in other muscle-specific
control regions. Using the preliminary consensus
(G(G/C)(T/A)AT(T/C)T) deduced in Fig. 5, we were able to identify
several potential Mt sites in other muscle-specific control regions. To
facilitate sequence comparison, sometimes antisense sequences are shown
(*). Hu, human; Mo, mouse; Ham,
hamster; Ch, chicken. References for sequences are as
follows: mouse MCK first-intron enhancer (47); rat, mouse, human, and
chicken myosin light chain 1/3 locus (MLC1/3) promoter (48,
49); mouse fast skeletal muscle troponin C (sTnC) first
intron enhancer (50), mouse GLUT4 upstream region (51); human desmin
5'-enhancer (18); hamster desmin 5'-enhancer (34); mouse desmin
5'-enhancer (35); chicken cardiac troponin T 5'-enhancer and upstream
region (52); human muscle-specific phosphoglycerate mutase
(PGAM-M) upstream region (53); rat sTnI first intron enhancer (54); human, mouse, and seal myoglobin upstream region (43,
55); chicken MLC1f/3f 5'-upstream region (56); chicken cardiac/slow
skeletal alkali myosin light chain (MLC1c/1s) upstream region (57); human, mouse, and rat dystrophin upstream region (58);
mouse cardiac troponic C (cTnC) first intron enhancer (15);
human cardiac troponin C (cTnC) promoter and first intron enhancer (59, 60); mouse cardiac -actin enhancer (61); human sTnI
upstream region (62); human, mouse, and rat -enolase first intron
enhancer (63). Corresponding nucleotide position numbers in the
references are given.
|
|
 |
DISCUSSION |
A Novel Regulatory Element, Mt, Cooperates with MEF2 and MyoD
Sites--
This study has identified a novel cis-acting regulatory
element Mt, between the MEF2 and MyoD sites within the myotube-specific enhancer. Mutation analysis reveals that a sequence, GGTATTT, located
between the MyoD and MEF2 sites is required for full transcriptional activity of the desmin myotube-specific enhancer in myotubes; the
relative loss of transcriptional activity in myotubes due to Mt
mutations that abolished the Mt-protein complex formation is greater
than 60% compared with the 70-bp wild-type enhancer (Fig.
1C). The same Mt mutation neither decreases nor increases the low level of reporter gene expression in proliferating myoblasts or
NIH 3T3 fibroblasts and HeLa cells. Mutation analysis also showed that
the MyoD site is important for enhancer activity in myotubes. Mutation
of this site resulted in the loss of almost all of the enhancer
activity despite the presence of MEF2 and Mt sites. Mutation of
the MEF2 site resulted in a 90% loss of CAT activity, suggesting that
this site is also necessary for enhancer activity in myotubes. The fact
that mutation of one of these three sites resulted in dramatic loss of
reporter gene activity suggests the existence of a synergy among the
MyoD, MEF2, and Mt sites. It is interesting to note that the
70-bp fragment containing these three sites acts as a powerful
myotube-specific enhancer.
Mt Binding Factor Is Present in Cultured Skeletal Muscle and in
Nonmuscle Cells--
One Mt binding complex of similar mobility was
observed in myotubes, myoblasts, fibroblasts, and HeLa cells in a gel
shift mobility assay. Although one- and two-Mt motifs do not appear to
be active on their own, four-Mt sites arranged in tandem are active
only in myotubes. Interestingly, four Mt sites linked in a palindrome
can function as a wild-type desmin enhancer in myotubes. It is,
however, somewhat more active than the native sequence in myoblasts and
nonmuscle cells, suggesting that additional negative control elements
contributing to muscle specificity may be present within the complete
enhancer. The reason why a four-Mt site in a palindrome is more active
than that in tandem awaits determination and could be related to fact
that the Mt motif in a palindrome favors the spatial interaction of the
transactivators in the transcriptional machinery. It seems that this
could not be related to novel factors binding to the oligonucleotides
containing two or four Mt motifs in a palindrome, because they give a
DNA-protein complex similar to the oligonucleotide containing one Mt
site in gel shift assays (data not shown). MtBF is present in various
cell extracts; why then are four copies of Mt very active only in
myotubes? It is possible that MtBF's activity is regulated in these
cell types through several mechanisms, for example by
post-translational modification (e.g. phosphorylation) or by
interaction with ubiquitous or cell type-specific coactivators.
Considering the fact that Mt tetramers are very active in myotubes but
not in myoblasts, mitogen-regulated phosphorylation could be involved
in MtBF activity. In the case of the MyoD family,
cAMP-dependent kinase can inhibit the activity of myogenic
helix-loop-helix proteins (64). The alternative mechanism,
protein-protein interaction, could also be involved in MtBF activity.
In fact, it has been reported that MyoD and MEF2 proteins need the
coactivator p300 to activate gene expression (65). In addition,
protein-protein interaction mechanisms have been proposed for
regulation of the cardiac troponin T gene. In this gene, the ubiquitous
TEF-1 factor binds to an M-CAT control element (10), but its full
transcriptional activity requires intermediary factors, termed TIFs
(66). Coactivators of MtBF are perhaps present only in myotubes.
Post-translational modification and protein-protein interaction could
both be involved in the regulation of the MtBF. Current efforts in our
laboratory are directed at cloning this apparently unknown factor.
Understanding the mechanisms involved in regulating MtBF function
awaits its cloning and characterization.
Mt Site Is Present in Numerous Muscle-specific Regulatory Control
Regions--
We have established a preliminary consensus sequence
(G(G/C)(T/A)AT(T/C)T) for the Mt site from the competition analysis of gel retardation assays. Using the preliminary consensus, we were able
to identify several potential Mt sites in other muscle-specific control
regions (Fig. 6). All of these potential Mt sites are located within
regions that have been shown to be functionally important for
transcription of the associated genes; most of them overlapped with an
A/T-rich sequence or a potential MEF2 site. The consensus sequence of
MEF2 is (C/T)T(A/T)(A/T)AAATA(A/G) (67). The following sequence
CcTAAAATAGC bearing an imperfect MEF2 site can abolish the
Mt-protein complex (Fig. 4B, lanes 4 and
5). Some sequences, for example the MEF2-like site in the
desmin enhancer (18, 35), rat sTnI (54), chicken MLC1f/3f 5'-flanking
sequence (56), and -enolase first intron enhancer (63) containing an
imperfect MEF2 site (C/T)T(A/T)(A/T)AAATAcC can compete
with the Mt site (Fig. 4B, lanes 18 and
19). The sequence complementary to the Mt site is
underlined. However, the sequence ((C/T)T(A/T)(A/T)AAATAAC), bearing a
MEF2 site found in the MCK enhancer, cannot abolish the Mt-protein
complex (Fig. 4B, lanes 16 and 17).
These results indicate that there could be some subtle differences
between the different potential MEF2 sites present in the control
region of muscle-specific genes. The MEF2 site of the desmin enhancer
is capable of forming two complexes with the myotube nuclear extracts; one band is abolished by the unlabeled MCK MEF2 site and the other by
unlabeled Mt sequence, whereas the complex formed by the MCK MEF2 site
cannot be abolished by the addition of excess unlabeled Mt sequence
(Fig. 4B). The significance of this difference between the
MEF2 sites in the control of muscle-specific gene expression awaits
study. It is interesting to note that the common core regulatory sequences are found in skeletal slow and fast fiber-specific regulatory elements (54). This common core sequence contains some conserved regulatory elements such as an E-box, CCAC-box, and MEF2-like site.
Transgenic mice bearing this common core sequence of quail fast
fiber-specific troponin I express preferentially the transgene in fast
fibers (68), whereas transgenic mice containing the core element of rat
sTnI are preferentially in slow fibers. These transgenes contain
different MEF2 sites. The MEF2 site in the quail fast fiber-specific
troponin I control region is perfectly homologous to the MEF2 consensus
sequence and does not contain an Mt sequence, whereas the MEF2 site in
rat sTnI enhancer is an imperfect MEF2 site (one nucleotide difference)
and contains an Mt sequence. In addition, three sequences sharing the
homology (six bp out of seven; Fig. 6) with the Mt sequence are found
in the rat sTnI control region but not in quail fast fiber-specific troponin I.
The MtBF is different from that of Mhox, a mesodermally restricted
homeodomain protein that binds an A + T-rich element
(T(A/T)ATAAT(A/T)A) in the MCK enhancer. In experiments reported by
Cserjesi et al. (69), oligonucleotides containing an Mt
motif (mutant 10 and 12 GCTATTT) cannot abolish the MHox-protein
complex (69). The MtBF is also different from the TATA-box binding
factor, HMG-box-binding proteins, and Oct1-2 factors, because a
standard TATA-box sequence (70), HMG-box and Oct1-2 site was not able
to abolish the Mt-protein complex (Fig. 4, B and
C). A 35-kDa muscle-specific (ATF35) protein, able to bind
to a myoglobin A/T-rich (TCTGGAAGCTATTTTAGGGCAGG) sequence
overlapping a MEF2 site, has been described (43). The same
oligonucleotides (Fig. 4C, lanes 4 and
5) can abolish the Mt-protein complex, suggesting that the
MtBF and ATF35 could be the same or similar protein. Nevertheless,
there are some differences. ATF35 was reported to be a muscle-specific
protein, whereas our experiments show that the Mt binding factor is
present in nonmuscle cells like fibroblasts and HeLa cells.
 |
ACKNOWLEDGEMENTS |
We thank Drs. S. Tajbakhsh, D. Daegelen, and
J. Humbert for critical reading of the manuscript. We are
grateful to L. Gazzolo, S. König, J. Lavie, M. Mericskay, and P. Vicart for fruitful discussion.
 |
FOOTNOTES |
*
This work was supported by the Association Française
contre les Myopathies, the Ministère de la Recherche et de
l'Enseignement Supérieur, and the Fondation de France.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) M63391.
§
Recipient of a fellowship from the Association Française
contre les Myopathies.
Member of the Institut National de la Santé et de la
Recherche Médicale. To whom correspondence should be addressed:
Institut Pasteur, SCME, 25 Rue du Dr. Roux, 75015 Paris, France. Tel.: 33-1-45-68-84-93; Fax: 33-1-45-68-86-81; E-mail: zlli{at}pasteur.fr.
**
Professor at the Université Paris 7.
1
The abbreviations used are: bp, base pair(s);
sTnI, slow troponin I; CAT, chloramphenicol acetyltransferase; tk,
thymidine kinase; MCK, muscle creatine kinase.
 |
REFERENCES |
-
Davis, R. L.,
Weintraub, H.,
and Lassar, A. B.
(1987)
Cell
51,
987-1000[CrossRef][Medline]
[Order article via Infotrieve]
-
Blackwell, T. K.,
and Weintraub, H.
(1990)
Science
250,
1104-1110[Abstract/Free Full Text]
-
Funk, W. D.,
and Wright, W. E.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
9484-9488[Abstract/Free Full Text]
-
Buckingham, M. E.
(1994)
Curr. Opin. Genet. Dev.
4,
745-751[CrossRef][Medline]
[Order article via Infotrieve]
-
Molkentin, J. D.,
and Olson, E. N.
(1996)
Curr. Opin. Genet. Dev.
6,
445-453[CrossRef][Medline]
[Order article via Infotrieve]
-
Pollack, R.,
and Treisman, R.
(1991)
Genes Dev.
5,
2327-2341[Abstract/Free Full Text]
-
Yu, Y. T.,
Breitbart, R. E.,
Smoot, L. B.,
Lee, Y.,
Mahdavi, V.,
Nadal-Ginard, B.
(1992)
Genes Dev.
6,
1783-1798[Abstract/Free Full Text]
-
Martin, J. F.,
Schwarz, J. J.,
and Olson, E. N.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
5282-5286[Abstract/Free Full Text]
-
Andrés, V.,
Cervera, M.,
and Mahdavi, V.
(1995)
J. Biol. Chem.
270,
23246-23249[Abstract/Free Full Text]
-
Farrance, I. K. G.,
Mar, J. H.,
and Ordahl, C. P.
(1992)
J. Biol. Chem.
267,
17234-17240[Abstract/Free Full Text]
-
Stewart, A. F. R.,
Larkin, S. B.,
Farrance, I. K. G.,
Mar, J. H.,
Hall, D. E.,
Ordahl, C. P.
(1994)
J. Biol. Chem.
269,
3147-3150[Abstract/Free Full Text]
-
Yockey, C. E.,
Smith, G.,
Izumo, S.,
and Shimizu, N.
(1996)
J. Biol. Chem.
271,
3727-3736[Abstract/Free Full Text]
-
Mobun, T. J.,
Chambers, A. E.,
Towers, N.,
and Taylor, M. V.
(1991)
EMBO J.
10,
933-940[Medline]
[Order article via Infotrieve]
-
Fabre-Suver, C.,
and Hauschka, A. D.
(1996)
J. Biol. Chem.
271,
4646-4652[Abstract/Free Full Text]
-
Parmacek, M. S.,
Ip, H. S.,
Jung, F.,
Shen, T.,
Martin, J. F.,
Vora, A. J.,
Olson, E. N.,
Leiden, J. M.
(1994)
Mol. Cell. Biol.
14,
1870-1885[Abstract/Free Full Text]
-
Bassel-Duby, R.,
Hernandez, M. D.,
Gonzalez, M. A.,
Krueger, J. K.,
Williams, R. S.
(1992)
Mol. Cell. Biol.
12,
5024-5032[Abstract/Free Full Text]
-
Spitz, F.,
Salminen, M.,
Demignon, J.,
Kahn, A.,
Daegelen, D.,
and Maire, P.
(1997)
Mol. Cell. Biol.
17,
656-666[Abstract]
-
Li, Z.,
and Paulin, D.
(1993)
J. Biol. Chem.
268,
10403-10415[Abstract/Free Full Text]
-
Pieper, F. R.,
Slobbe, R. L. F.,
Ramaekers, C. S.,
Cuypers, H. T.,
Bloemendal, H.
(1987)
EMBO J.
6,
3611-3618[Medline]
[Order article via Infotrieve]
-
Li, Z.,
Lilienbaum, A.,
Butler-Browne, G.,
and Paulin, D.
(1989)
Gene (Amst.)
78,
243-254[CrossRef][Medline]
[Order article via Infotrieve]
-
Li, Z.,
Colucci-Guyon, E.,
Pinçon-Raymond, M.,
Mericskay, M.,
Pournin, S.,
Paulin, D.,
and Babinet, C.
(1996)
Dev. Biol.
175,
362-366[CrossRef][Medline]
[Order article via Infotrieve]
-
Kaufman, S. J.,
and Foster, R. F.
(1988)
Proc. Natl. Acad. Sci. U. S. A.
85,
9606-9610[Abstract/Free Full Text]
-
Fürst, D. O.,
Osborn, M.,
and Weber, K.
(1989)
J. Cell. Biol.
109,
517-527[Abstract/Free Full Text]
-
Lilienbaum, A.,
Li, Z.,
Butler-Browne, G.,
Bolmont, C.,
Grimaud, J. A.,
Paulin, D.
(1988)
Cell. Mol. Biol.
34,
663-672[Medline]
[Order article via Infotrieve]
-
Babai, F.,
Musevi-Aghdam, J.,
Schurch, W.,
Royal, A.,
and Gabbiani, G.
(1990)
Differentiation
44,
132-142[CrossRef][Medline]
[Order article via Infotrieve]
-
Allen, R. E.,
Rankin, L. L.,
Greene, E. A.,
Boxhorn, L. K.,
Johnson, S. E.,
Taylor, R. G.,
Pierce, P. R.
(1991)
J. Cell. Physiol.
149,
525-535[CrossRef][Medline]
[Order article via Infotrieve]
-
Li, Z.,
Marchand, P.,
Humbert, J.,
Babinet, C.,
and Paulin, D.
(1993)
Development
117,
947-959[Abstract]
-
Li, Z.,
and Paulin, D.
(1991)
J. Biol. Chem.
266,
6562-6570[Abstract/Free Full Text]
-
Lemaire, P.,
Vesque, C.,
Schmitt, J.,
Stunnenberg, H.,
Frank, R.,
and Charnay, P.
(1990)
Mol. Cell. Biol.
10,
3456-3467[Abstract/Free Full Text]
-
Kunkel, T. A.
(1985)
Proc. Natl. Acad. Sci. U. S. A.
82,
488-492[Abstract/Free Full Text]
-
Lucknow, B.,
and Schütz, G.
(1987)
Nucleic Acids. Res.
15,
5490[Free Full Text]
-
Pinset, C.,
Montarras, D.,
Chenevert, J.,
Minty, A.,
Barton, P.,
Laurent, C.,
and Gros, F.
(1988)
Differentiation
38,
28-34[CrossRef][Medline]
[Order article via Infotrieve]
-
Hazan, U.,
Thomas, D.,
Alcami, J.,
Bachelerie, F.,
Israel, N.,
Yssel, H.,
Virelizier, J. L.,
Arenzana-Seidedos, F.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
7861-7865[Abstract/Free Full Text]
-
van de Klundert, F. A.,
Jansen, H. J.,
Bloemendal, H.
(1994)
J. Biol. Chem.
269,
220-225[Abstract/Free Full Text]
-
Li, H.,
and Capetanaki, Y. G.
(1993)
Nucleic Acids Res.
21,
335-343[Abstract/Free Full Text]
-
Savetti, A.,
Lilienbaum, A.,
Li, Z.,
Paulin, D.,
and Gazzolo, L.
(1993)
Mol. Cell. Biol.
13,
89-97[Abstract/Free Full Text]
-
Larkin, S. B.,
Farrance, I. K. G.,
and Ordahl, C. P.
(1996)
Mol. Cell. Biol.
16,
3742-3755[Abstract]
-
Wright, W. E.,
Sassoon, D. A.,
and Lin, V. K.
(1989)
Cell
56,
607-617[CrossRef][Medline]
[Order article via Infotrieve]
-
Braun, T.,
Buschhausen-Denker, G.,
Bober, E.,
Tannich, E.,
and Arnold, H. H.
(1989)
EMBO J.
8,
701-709[Medline]
[Order article via Infotrieve]
-
Rhodes, S. J.,
and Konieczny, S. F.
(1989)
Genes Dev.
3,
2050-2061[Abstract/Free Full Text]
-
Yutzey, K. E.,
Kline, R. L.,
and Konieczny, S. F.
(1989)
Mol. Cell. Biol.
9,
1397-1405[Abstract/Free Full Text]
-
Weintraub, H.,
Davis, R.,
Lockshon, D.,
and Lassar, A.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
5623-5627[Abstract/Free Full Text]
-
Grayson, J.,
Williams, R. S.,
Yu, Y. T.,
Bassel-Duby, R.
(1995)
Mol. Cell. Biol.
15,
1870-1878[Abstract]
-
Boulikas, T.
(1994)
Gene Expression
4,
117-321
-
Dehesh, K.,
Hung, H.,
Tepperman, J. M.,
Quail, P. H.
(1992)
EMBO J.
11,
4131-4144[Medline]
[Order article via Infotrieve]
-
Gossett, L. A.,
Kelvin, D. J.,
Sternberg, E. A.,
Olson, E. N.
(1989)
Mol. Cell. Biol.
9,
5022-5033[Abstract/Free Full Text]
-
Sternberg, E.,
Spizz, G.,
Perry, W. M.,
Vizrad, D.,
Weil, T.,
Olson, E. N.
(1988)
Mol. Cell. Biol.
8,
2896-2909[Abstract/Free Full Text]
-
McGrew, M. J.,
Bogdanova, N.,
Hasegawa, K.,
Hughes, S. H.,
Kitsis, R. N.,
Rosenthal, N.
(1996)
Mol. Cell. Biol.
16,
4524-4534[Abstract]
-
Seidel, U.,
and Arnold, H. H.
(1989)
J. Biol. Chem.
264,
16109-16117[Abstract/Free Full Text]
-
Parmacek, M. S.,
Bengur, A. R.,
Vora, A. J.,
Leiden, J.
(1990)
J. Biol. Chem.
265,
15970-15976[Abstract/Free Full Text]
-
Kaestner, K. H.,
Christy, R. J.,
and Lane, M. D.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
251-255[Abstract/Free Full Text]
-
Ianello, R. C.,
Mar, J. H.,
and Ordahl, C. P.
(1991)
J. Biol. Chem.
266,
3309-3316[Abstract/Free Full Text]
-
Tsujino, S.,
Sakoda, S.,
Mizuno, R.,
Kobayashi, T.,
Suzuki, S.,
Kishimoto, S.,
Shanske, S.,
DiMauro, S.,
and Schon, E. A.
(1989)
J. Biol. Chem.
264,
15334-15337[Abstract/Free Full Text]
-
Nakayama, M.,
Stauffer, J.,
Cheng, J.,
Banerjee-Basu, S.,
Wawrousek, E.,
and Buonanno, A.
(1996)
Mol. Cell. Biol.
16,
2408-2417[Abstract]
-
Devlin, B. H.,
Wefald, F. C.,
Kraus, W. E.,
Bernard, T. S.,
Williams, R. S.
(1989)
J. Biol. Chem.
264,
13896-13901[Abstract/Free Full Text]
-
Shirakata, M.,
Nabeshima, Y. I.,
Konishi, K.,
and Fujii-Kuriyama, Y.
(1988)
Mol. Cell. Biol.
8,
2581-2588[Abstract/Free Full Text]
-
Papadopoulos, N.,
and Crow, M. T.
(1993)
Mol. Cell. Biol.
13,
6907-6918[Abstract/Free Full Text]
-
Gilgenkrantz, H.,
Hugnot, J. P.,
Lambert, M.,
Chafey, P.,
Kaplan, J. C.,
Kahn, A.
(1992)
J. Biol. Chem.
267,
10823-10830[Abstract/Free Full Text]
-
Schreier, T.,
Kedes, L.,
and Gahlmann, R.
(1990)
J. Biol. Chem.
265,
21247-21253[Abstract/Free Full Text]
-
Christensen, T. H.,
Prentice, H.,
Gahlmann, R.,
and Kedes, L.
(1993)
Mol. Cell. Biol.
13,
6752-6765[Abstract/Free Full Text]
-
Biben, C.,
Kirschbaum, B. J.,
Garner, I.,
and Buckingham, M.
(1994)
Mol. Cell. Biol.
14,
3504-3513[Abstract/Free Full Text]
-
Corin, S. J.,
Juhasz, O.,
Zhu, L.,
Conley, P.,
Kedes, L.,
and Wade, R.
(1994)
J. Biol. Chem.
269,
10651-10659[Abstract/Free Full Text]
-
Feo, S.,
Antona, V.,
Barbier, G.,
Passantino, R.,
Cali, L.,
and Giallongo, A.
(1995)
Mol. Cell. Biol.
15,
5991-6001[Abstract]
-
Li, L.,
Heller-Harrison, R.,
Czech, M.,
and Olson, E. N.
(1992)
Mol. Cell. Biol.
12,
4478-4485[Abstract/Free Full Text]
-
Sortorelli, V.,
Huang, J.,
Hamamori, Y.,
and Kedes, L.
(1997)
Mol. Cell. Biol.
17,
1010-1026[Abstract]
-
Xiao, J. H.,
Davidson, I.,
Matthes, H.,
Garnier, J. M.,
Chambon, P.
(1991)
Cell
65,
551-568[CrossRef][Medline]
[Order article via Infotrieve]
-
Cserjesi, P.,
and Olson, E. N.
(1991)
Mol. Cell. Biol.
11,
4854-4862[Abstract/Free Full Text]
-
Hallauer, P. L.,
Bradshaw, H. L.,
and Hastings, K. E. M.
(1993)
Development
119,
691-701[Abstract]
-
Cserjesi, P.,
Lilly, B.,
Bryson, L.,
Wang, Y.,
Sassoon, D.,
and Olson, E. N.
(1992)
Development
115,
1087-1101[Abstract]
-
Peterson, M. G.,
Tanese, N.,
Pugh, B. F.,
Tjian, R.
(1990)
Science
248,
1625-1650[Abstract/Free Full Text]
Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
R. L. Frock, B. A. Kudlow, A. M. Evans, S. A. Jameson, S. D. Hauschka, and B. K. Kennedy
Lamin A/C and emerin are critical for skeletal muscle satellite cell differentiation.
Genes & Dev.,
February 15, 2006;
20(4):
486 - 500.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Karasseva, G. Tsika, J. Ji, A. Zhang, X. Mao, and R. Tsika
Transcription Enhancer Factor 1 Binds Multiple Muscle MEF2 and A/T-Rich Elements during Fast-to-Slow Skeletal Muscle Fiber Type Transitions
Mol. Cell. Biol.,
August 1, 2003;
23(15):
5143 - 5164.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1998 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|