![]()
|
|
||||||||
J Biol Chem, Vol. 273, Issue 13, 7737-7742, March 27, 1998
From the The Ras and Rap1A proteins can bind to the
Raf and RalGDS families. Ras and Rap1A have Glu and Lys, respectively,
at position 31. In the present study, we analyzed the effects of
mutating the Glu at position 31 of the c-Ha-Ras protein to Asp, Ala,
Arg, and Lys on the interactions with Raf-1 and RalGDS. The Ras-binding domain (RBD) of Raf-1 binds the E31R and E31K Ras mutants less tightly
than the wild-type, E31A, and E31D Ras proteins; the introduction of
the positively charged Lys or Arg residue at position 31 specifically impairs the binding of Ras with the Raf-1 RBD. On the other hand, the
ability of the oncogenic RasG12V protein to activate
Raf-1 in HEK293 cells was only partially reduced by the E31R mutation
but was drastically impaired by the E31K mutation. Correspondingly,
RasG12V(E31K) as well as Rap1A, but not
RasG12V(E31R), exhibited abnormally tight binding with the
cysteine-rich domain of Raf-1. On the other hand, the E31A, E31R, and
E31K mutations, but not the E31D mutation, enhanced the RalGDS
RBD-binding activity of Ras, indicating that the negative charge at
position 31 of Ras is particularly unfavorable to the interaction with
the RalGDS RBD. RasG12V(E31K), RasG12V(E31A),
and Rap1A stimulate the RalGDS action more efficiently than the
wild-type Ras in the liposome reconstitution assay. All of these
results clearly show that the sharp contrast between the
characteristics of Ras and Rap1A, with respect to the interactions with
Raf-1 and RalGDS, depends on their residues at position 31.
The Ras protein in the GTP-bound form associates with and induces
the activation of the Raf-1 serine/threonine kinase (for a review, see
Ref. 1). The activated Raf-1 phosphorylates and activates the
MAPKK/MEKs,1 which in turn
activate the MAPK/ERKs (1, 2). The Ras-binding domain (RBD) was mapped
to amino acid residues 51-131 of Raf-1 (3, 4). In addition to this
domain, the cysteine-rich domain (CRD) of Raf-1 was recently found to
interact with Ras (5, 6). Both of these interactions of Ras with the
two domains of Raf-1 are necessary for transformation by Ras and for
the activation of Raf-1 (6, 7). Mutational analyses have shown that the effector region (amino acid residues 32-40) and the activator region
(amino acid residues 26-31 and 41-48) of Ras are involved in the
interactions with the Raf-1 RBD and the Raf-1 CRD, respectively (1,
6).
The guanine nucleotide exchange factors for the Ral proteins, such as
RalGDS and RGL, have been reported to associate with Ras in a
GTP-dependent manner; the interaction was abolished by mutations in the effector region of Ras (8-12). It has been shown that
Ras enhances the guanine nucleotide-exchange activity of RalGDS in COS
cells (13). The Ras-binding domain of RalGDS has been identified
(8-12), and there is no apparent sequence homology between the RBDs of
the Raf family and those of the RalGDS family. Recently, however, the
RalGDS RBD was shown to have a ubiquitin-like fold similar to that of
the Raf-1 RBD (14, 15).
The Rap1A (or Krev-1) protein belongs to the Ras superfamily, and has
the same amino acid sequence in the effector region as that of Ras
(16-18). However, at position 31, Rap1A has Lys, whereas Ras has Glu.
The RalGDS RBD prefers Rap1A to Ras, but the Raf-1 RBD prefers Ras to
Rap1A (19). The crystal structures of the complexes of the Raf-1 RBD
with Rap1A·GMPPNP (the wild-type and the E30D/K31E mutant) have been
solved by x-ray crystallography (20, 21). In these two complex
structures, Lys84 of the Raf-1 RBD is not involved in the
interaction with the wild-type Rap1A but forms strong and weak salt
bridges with Glu31 and Asp33, respectively, of
the E30D/K31E mutant Rap1A. The replacement of Lys by Glu at position
31 of Rap1A increased the affinity for the Raf-1 RBD and decreased that
for the RalGDS RBD (21). It was proposed, therefore, that the negative
charge of Glu31 creates a favorable complementary interface
for the Ras-Raf interaction (21). We have found that the Rap1A-type
E31K and D30E/E31K mutations impair the GAP-induced increase in the Ras
GTPase activity and the ability to induce neurite outgrowth of PC12
cells (22). Other groups have also reported that the E31K and D30E/E31K
mutations reduce the transforming activity of oncogenic Ras in NIH3T3
cells (23, 24). In the present study, to analyze in more detail how the
Glu residue at position 31 of Ras is involved in the interaction with
the two different targets, we tested more mutations at position 31 for
their effects on various Ras functions.
Plasmid Construction--
Mutations were introduced into a
synthetic human c-Ha-ras gene (25) by site-directed
mutagenesis with two PCR steps. The ras genes with the
mutations in the oncogenic G12V background were subcloned into pMAMneo
(CLONTECH) (22) for induced expression in PC12
cells and into pCMV5 (26) for transient expression in HEK293 cells. To
prepare the Raf-1 RBD as a GST fusion protein, the DNA fragment
corresponding to amino acid residues 51-131 was amplified by PCR from
the human full-length raf-1 gene (27, 28) and was subcloned
into pGEX-4T-3 (Amersham Pharmacia Biotech). The gene for the rat
RalGDS RBD was prepared by PCR with the primers, GCGCGGATCCTCACTGCCTCTCTACAACCAGCAGGTG and
GCGCGTCGACTTAGAAGATGCCTTTGGCAATCCTGAG, from a rat brain cDNA
library (CLONTECH). To prepare the GST fusion form
of the RalGDS RBD, the PCR product was digested with BamHI and SalI and was then inserted into the
BamHI-SalI sites of pGEX-4T-1.
Protein Purification--
The wild-type and mutant Ras proteins
were expressed in Escherichia coli and were purified by
chromatography on DEAE-Sephacel and Sephadex G-75 (Amersham Pharmacia
Biotech) columns as described (22). To obtain the post-translationally
modified forms of Ras, RasG12V(E31A),
RasG12V(E31R), and Rap1A, each protein was produced in
Sf9 cells infected with baculoviruses containing either the
ras, the rasG12V(E31A), the
rasG12V(E31R) or the rap1A gene and
was purified as described previously (29, 30). The GST fusion forms of
the Ras binding domains, GST-Raf-1-(51-131) and GST-RalGDS-(769-895),
were each expressed in E. coli at 30 °C and were purified
using a glutathione-Sepharose 4B (Amersham Pharmacia Biotech) according
to the manufacturer instructions. A recombinant Xenopus
kinase-negative MAPK (KN-MAPK) in a GST fusion form and a
histidine-tagged Xenopus MAPKK were purified from E. coli as described (31, 32). For the liposome reconstitution assay,
baculoviruses producing a GST-fused Ras (GST-Ras), GST-RalB, GST-Rap1A,
or GST-RasG12V(E31K) were generated as described (33, 34).
All procedures of passage, infection, and transfection of Sf9
cells and the isolation of recombinant baculoviruses were carried
out as described (35). The post-translationally modified form
of GST-Ras, GST-RalB, GST-Rap1A, and GST-RasG12V(E31K) were
purified from the membrane fraction of Sf9 cells as described (36). GST-RalGDSb was purified from E. coli as
described (33, 34).
In Vitro Binding Assays--
One µg of either
GST-Raf-1-(51-131) or GST-RalGDS-(769-895), in 150 µl of
phosphate-buffered saline containing 5 mM MgCl2 and 0.5% Triton X-100, was mixed with 10 µl of glutathione-Sepharose 4B beads suspended in phosphate-buffered saline. The mixture was incubated at 4 °C for 1 h with various amounts of either
wild-type or mutant Ras, which had been complexed with GTP Raf-1 Kinase Assays--
HEK293 cells were transfected with 0.8 µg of the vector pCMV5 (26), harboring a mutant ras gene,
by the calcium phosphate precipitation method. Ten h after
transfection, the cells were serum starved in Dulbecco's modified
Eagle's medium containing 1% bovine serum albumin. After a 24-hr
starvation, the cells were lysed in 300 µl of 20 mM Hepes
buffer (pH 7.4) containing 150 mM KCl, 10% glycerol, 0.5%
Triton X-100, 5 mM MgCl2, 1 mM
EDTA, 1 mM EGTA, 10 mM NaF, 1 mM
Na3VO4, 25 mM Transfection of PC12 Cells--
Each pMAMneo vector with a
mutant ras gene was transfected into PC12 cells as described
previously (39). Transfectants were selected in medium containing G418
(400 µg/ml), and mutant Ras expression was induced by the addition of
dexamethasone to a final concentration of 1 µM in the
culture medium. After 24 h, the number of cells with extended
neurites was counted.
MAPK Kinase Assays--
Cell extracts (20 µg/assay) were
electrophoresed in a 12% SDS-polyacrylamide gel, and were transferred
to a nitrocellulose membrane for Western blot analysis using an
anti-ERK antibody (Santa Cruz Biotechnology). The kinase detection
assay on polyacrylamide gels was also performed as described previously
(40). Briefly, the cell extracts were electrophoresed on
SDS-polyacrylamide gels (12%) containing myelin basic protein (0.5 mg/ml) as the substrate for ERK. After denaturation and renaturation,
the gels were incubated for the kinase reaction and were subjected to
autoradiography to detect the phosphorylation of myelin basic
protein.
RalGDS Assay Using Liposome Reconstitution System--
RalGDS
activity to stimulate the dissociation of GDP from Ral in the liposomes
was measured as described (36). Briefly, liposomes were made by
sonication of dried lipids containing phosphatidylserine, phosphatidylinositol, phosphatidylcholine, and
phosphatidylethanolamine. The post-translationally modified
[3H]GDP-bound form of GST-Ral and GTP To determine which properties of the amino acid residue at
position 31 of Ras are necessary for the interactions with its targets,
Raf-1 and RalGDS, we substituted the Glu31 of the c-Ha-Ras
protein by Asp, Ala, and Arg and analyzed the effects of these
mutations, as well as those of the previously reported Lys
mutation.
Binding to the Raf-1 RBD--
First, we examined the effects of
the E31D, E31A, E31R, and E31K mutations on the interaction of Ras with
the Raf-1 RBD (amino acid residues 51-131 of Raf-1). Various
concentrations of each mutant Ras protein in the GTP
Interactions of the Amino Acid Residue at Position 31 of the
c-Ha-Ras Protein with Raf-1 and RalGDS*
,
,
**
Cellular Signaling Laboratory, Institute of
Physical and Chemical Research (RIKEN), Hirosawa 2-1, Wako-shi,
Saitama 351-01, Japan, the § First Department of
Biochemistry, Hiroshima University School of Medicine, 1-2-3 Kasumi, Minami-ku, Hiroshima 734, Japan, the ¶ Department of
Physiology II, Kobe University School of Medicine, 7-5-1 Kusunoki-cho,
Chuo-ku, Kobe 650, Japan, and the
Department of Biophysics and
Biochemistry, Graduate School of Science, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113, Japan
![]()
ABSTRACT
Top
Abstract
Introduction
Procedures
Results & Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Procedures
Results & Discussion
References
![]()
EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results & Discussion
References
S as
described previously (37). After this incubation, the resin was washed with 20 mM Tris-HCl buffer (pH 7.5) containing 5 mM MgCl2 and 150 mM NaCl. The bound
proteins were eluted from the resin by boiling in Laemmli's buffer and
were fractionated by SDS-PAGE. The Raf-1 CRD binding assay was
performed as described previously (6). Briefly, MBP-Raf-1(136-206),
immobilized on the amylose resin, was incubated with 12 pmol of the
wild-type or mutant Ras or Rap1A bound with GTP
S in 20 mM Tris-HCl buffer (pH 7.5) containing 40 mM
NaCl, 1 mM EDTA, 1 mM DTT, 5 mM
MgCl2, and 0.1% Lubrol PX. After an incubation at 4 °C
for 2 h, the resin was washed, and the bound proteins were eluted
and subjected to SDS-PAGE. Immunoblots were probed with the anti-Ras
antibody RAS004 (38) or with an anti-Rap1A antibody (Santa Cruz
Biotechnology) and were developed using the ECL immunodetection system
(Amersham Pharmacia Biotech). Western blots were scanned and relative
band intensities were determined with a BioImage densitometer
(MilliGen).
-glycerophosphate,
20 µg/ml aprotinin, and 10 µg/ml leupeptin and were centrifuged at 18,500 × g for 10 min to remove the cell debris. From
the supernatant, the Raf-1 protein was immunoprecipitated with the
anti-Raf-1 antibody C12 (Santa Cruz Biotechnology) and protein
A-Sepharose (Amersham Pharmacia Biotech). The Raf-1 kinase activity was
determined by incubating the immunoprecipitates with 3 µg of the
histidine-tagged MAPKK and 6 µg of GST-KN-MAPK in 20 mM
Hepes-NaOH buffer (pH 7.5) containing 5 mM
MgCl2 and 0.16 mM [
-32P]ATP
(46.25 kBq/nmol) for 6 min at 30 °C. After the incubation, the
reaction was stopped by adding Laemmli's buffer and boiling. The
samples were fractionated by SDS-PAGE, and the phosphorylation of
KN-MAPK was measured with a Fuji BAS2000 Bio-imaging Analyzer.
S-bound form of
GST-Ras, GST-Rap1A, GST-RasG12V(E31K), or
RasG12V(E31A) were made, added to the liposomes, and
incubated for 10 min on ice in 400 µl of reaction mixture (20 mM Tris-HCl, pH 7.5, 5 mM MgCl2,
0.67 mM EDTA, 1 mM n-octylglucoside
(1/25 of critical micellar concentration), 1 mM DTT, and
0.06 mg/ml bovine serum albumin). The mixture was centrifuged on a
discontinuous sucrose density gradient at 100,000 × g
for 2 h at 4 °C, and the liposomes were recovered at the
0.15-1.2 M sucrose interface. GST-RalGDSb was incubated
with the liposomes that contained the [3H]GDP-bound form
of GST-Ral (0.5 pmol) and the GTP
S-bound form of GST-Ras, GST-Rap1A,
GST-RasG12V(E31K), or RasG12V(E31A) (1.5-2
pmol) in 80 µl of reaction mixture (50 mM Tris-HCl, pH
7.5, 5 mM MgCl2, 200 µM GTP,
0.031% CHAPS, and 1 mM DTT) for 30 min at 30 °C. Assays
were quantified by rapid filtration on nitrocellulose filters (41).
![]()
RESULTS AND DISCUSSION
Top
Abstract
Introduction
Procedures
Results & Discussion
References
S-bound form
were added to the GST-Raf-1(51-131) fusion protein mixed with
glutathione-Sepharose, and the amounts of the Ras protein in the
precipitates were analyzed by Western blotting (Fig.
1). The Ras(E31D) and Ras(E31A) mutant
proteins were found to bind the Raf-1 RBD as strongly as the wild-type Ras (Fig. 1). In contrast, the E31R and E31K mutations reduced the
extent of the Raf-1 RBD binding by about 5-fold (Fig. 1).

View larger version (20K):
[in a new window]
Fig. 1.
Association of the Ras mutants with the Raf-1
RBD. Various amounts of the E31D (
), E31A (
), E31R (
), or
E31K (
) mutant or the wild-type Ras (×) were loaded with GTP
S
and tested for GST-Raf-1(51-131) binding, as described under
"Experimental Procedures." The intensity of the Ras band was
estimated by densitometry. When GST was used instead of
GST-Raf-1(51-131), no bands were detected. The data represent the
average of at least three experiments.
Activation of Raf-1--
Next, to examine the effect of these
mutations on the ability of Ras to activate Raf-1, we transfected
HEK293 cells with each mutant ras gene in the oncogenic G12V
background. The anti-Raf-1 immunoprecipitate was incubated with
[
-32P]ATP in the presence of MAPKK and the KN-MAPK,
and the incorporation of 32P into the KN-MAPK was
quantitated (Fig. 2A). The
amounts of the mutant Ras proteins expressed in HEK293 cells were
nearly the same (Fig. 2B). The E31A and E31D mutations had
no effects on the stimulation of the MAPKK kinase activity of Raf-1. On
the other hand, the Raf-1 activation activity of Ras was partially impaired by the E31R mutation and, furthermore, was drastically decreased by the E31K mutation.
|
Activities in PC12 Cells-- To analyze the effects of these mutations on the activities of Ras in another cell type, pheochromocytoma (PC) 12 cells were stably transfected with pMAMneo vectors that conditionally express the RasG12V, RasG12V(E31D), RasG12V(E31A), RasG12V(E31R), or RasG12V (E31K) protein. The RasG12V(E31K)-expressing cells did not extend neurites, as reported (22), whereas the RasG12V(E31D)-, RasG12V(E31A)-, and RasG12V(E31R)-expressing cells extended neurites as well as the cells expressing RasG12V (Fig. 3). The expression levels of RasG12V, RasG12V(E31D), RasG12V(E31A), and RasG12V(E31R) were nearly the same (Fig. 4A). The level of RasG12V(E31K) was slightly lower than those of other mutants, probably because of its autoinhibitory activity (22), but was nevertheless sufficiently higher than that of the endogenous Ras (Fig. 4A). In conclusion, the neurite-inducing activity of RasG12V was abolished by the E31K mutation but not affected by the E31D, E31A, and E31R mutations (Fig. 3). It should be emphasized that the E31K mutation impairs this function of Ras much more drastically than the E31R mutation. Furthermore, the abilities of these RasG12V, RasG12V(E31A), RasG12V(E31D), RasG12V(E31R), and RasG12V(E31K) mutants to induce ERK activation in PC12 cells were examined from delayed mobility of the phosphorylated form on SDS-PAGE (Fig. 4B) and also by an in-gel kinase assay (data not shown). The ERK activities in the RasG12V(E31A)-, RasG12V(E31D)-, and RasG12V(E31R)-expressing cells were elevated as well as in the RasG12V-expressing cells (Fig. 4B). On the other hand, in the cell expressing RasG12V(E31K), the ERK activity was the same as in the control cell. In summary, the abilities of the Ras mutants to activate Raf-1 correlate with their abilities to induce ERK activation and also with the induction of neurite outgrowth in PC12 cells. Therefore, the inability of RasG12V(E31K) to induce neurite outgrowth is probably due to the inability to activate Raf.
|
|
Binding to Raf-1 CRD--
Ras activation of Raf-1 in both HEK293
and PC12 cells was decreased more severely by the E31K mutation than by
the E31R mutation, although Ras(E31R) and Ras(E31K) had nearly the same
Raf-1 RBD-binding activities. Recently, we found that Ras binds to the
Raf-1 CRD (amino acid residues 132-206) in a GTP-independent manner,
which is necessary for the activation of Raf-1 (6) while another group
reported a weak GTP-dependence of the binding of Ras with the Raf-1 CRD
(5). Furthermore, we found that RasG12V(E31K) as well as
Rap1A has an abnormally enhanced ability to bind the Raf-1 CRD (30). It
seems to be through this abnormal interaction of Lys31 with
the Raf-1 CRD that Rap1AG12V and RasG12V(E31K)
dominantly inhibit the Raf-1 activation by RasG12V, which
is related to the Ras-antagonizing activity of Rap1A (30). In this
study, we examined the ability of RasG12V(E31R) to bind to
the Raf-1 CRD. Since the binding of Ras to the CRD requires
post-translational modification of the C terminus of Ras, we purified
the modified form of RasG12V(E31R) from Sf9 cells,
and used it for the Raf-1 CRD binding assay. The
RasG12V(E31R) was shown to bind the Raf-1 CRD as strongly
as Ras (the GTP
S-bound forms, Fig. 5;
and the GDP-bound forms, data not shown). Therefore, it is likely that
the difference in the Raf-1 activation ability between the E31K and
E31R mutants is due to the difference in the ability to bind the Raf-1
CRD. The reason why the extent of Raf-1 activation by
RasG12V(E31K) is much lower than that by
RasG12V(E31R) may be that RasG12V(E31K)
autoinhibits the Raf-1 activation. The present mutagenesis analyses
indicate that the wild-type Glu31 residue of Ras is not
required for interaction with either RBD or CRD of Raf-1. In contrast,
the Lys residue replacing Glu31 appears to interact with
the Raf-1 CRD. It is interesting that the Raf-1 CRD very specifically
recognizes the amino acid at position 31 and prefers Lys to Arg.
|
Binding to the RalGDS RBD--
As in the case of the Raf-1 RBD,
we tested the Ras(E31D), Ras(E31A), Ras(E31R), and Ras(E31K) mutant
proteins in the GTP
S-bound form for their abilities to bind with a
GST fusion protein of the rat RalGDS RBD, the C-terminal 127 residues
corresponding to the mouse RalGDS RBD (10). Interestingly, the
Ras(E31A), Ras(E31R), and Ras(E31K) mutants bound the RalGDS RBD more
tightly than the wild-type Ras (Fig. 6).
In contrast, the E31D mutation did not affect the interaction of Ras
with the RalGDS RBD. This indicates that the negative charge at
position 31 of Ras particularly weakens the interaction with the RalGDS
RBD.
|
Binding Preference Switching-- The affinities of Ras for the Raf-1 RBD and Rap1A for the RalGDS RBD are 100 times higher than those of Ras for the RalGDS RBD and Rap1A for the Raf-1 RBD, respectively (19). Furthermore, the K31E mutation of Rap1A has been reported to cause a 15-fold increase in the affinity of Rap1A for the Raf-1 RBD and a 20-fold decrease in that for the RalGDS RBD (21). Symmetrically, in this study, the E31K mutation of Ras was found to decrease the Raf-1 RBD-binding (about 5-fold) and to increase the RalGDS RBD-binding (about 5-fold). Therefore, not only in the Rap1A background (21) but also in the Ras background, the residue at position 31 serves as the determinant for the preference of either the Raf-1 RBD or the RalGDS RBD. On the other hand, the modes of Ras binding are similar between the Raf-1 and RalGDS RBDs, in that only one type of charge at position 31 of Ras is particularly unfavorable; binding is weaker with positively and negatively charged side chains, respectively, than with oppositely charged (negatively and positively, respectively) and neutral side chains, at position 31. Actually, it has recently been reported that the RalGDS RBD has a fold similar to that of the Raf-1 RBD (14, 15).
Effects of RasG12V(E31A) and RasG12V(E31K)
on the RalGDS Action--
It has been reported that Ras, but not
Rap1A, can activate the GDP/GTP exchange activity of RalGDS toward
Ral in COS cells (13) and that RalGDS stimulated the dissociation of
GDP from Ral more strongly in the presence of Rap1A·GTP
S than
Ras·GTP
S in the reconstitution assay (36). The discrepancy of the
action of Rap1A on RalGDS between intact cell and cell-free
systems might be due to the different subcellular distribution of
Rap1A and Ral. In this study, we used this reconstitution system
to analyze the RalGDS-binding abilities of
RasG12V(E31A) and RasG12V(E31K). When the
GTP
S-bound form of RasG12V(E31A) or
RasG12V(E31K) was incorporated with Ral in the liposomes,
RalGDS stimulated the dissociation of GDP from Ral (Fig.
7). These Ras mutants, as well as Rap1A,
exhibited higher RalGDS activation activities than that of the
wild-type Ras. Thus, in the reconstitution assay system, the
RalGDS-activation activity of Ras/Rap1A depends on the RalGDS
RBD-binding activity.
|
| |
ACKNOWLEDGEMENTS |
|---|
The technical assistance of A. Kamiya and K. Hashimoto is gratefully acknowledged. The raf-1 gene was obtained from the Japanese Cancer Research Resources Bank. We thank Dr. E. Nishida for providing the histidine-tagged Xenopus MAPKK and the GST-KN-MAPK expression system. We also thank Dr. H. Koide for advice in measuring the Raf-1 kinase activity and Dr. T. Kigawa and T. Terada for helpful comments.
| |
FOOTNOTES |
|---|
* This work was supported in part by a Biodesign Grant from RIKEN, and Grants-in-aid for Scientific Research from the Ministry of Education, Science, Sports, and Culture of Japan.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
** To whom correspondence should be addressed. Tel.: 81-48-467-9427; Fax: 81-48-462-4675; E-mail: yokoyama{at}postman.riken.go.jp.
1
The abbreviations used are: MAPKK, MAPK kinase;
GAP, GTPase activating protein; ERK, extracellular signal-regulated
kinase; RBD, Ras binding domain; CRD, cysteine-rich domain; GST,
glutathione S-transferase; GTP
S, guanosine
5'-O-(3-thiotriphosphate); PAGE, polyacrylamide gel
electrophoresis; HEK, human embryo kidney; MBP, maltose-binding
protein; GMPPNP, guanosine 5'-O-(
,
-imidotriphosphate); PCR, polymerase chain reaction; DTT, dithiothreitol; MAPK,
mitogen-activated protein kinase; MEK, MAPK kinase/ERK kinase; CHAPS,
3-((3-cholamidopropyl)dimethylammonio)-1-propanesulfonate; KN-MAPK,
kinase-negative MAPK.
2 M. Shirouzu, K. Hashimoto, and S. Yokoyama, unpublished data.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. Endo, M. Shirouzu, and S. Yokoyama The Cdc42 Binding and Scaffolding Activities of the Fission Yeast Adaptor Protein Scd2 J. Biol. Chem., January 3, 2003; 278(2): 843 - 852. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Miki, M. Fukuda, E. Nishida, and T. Takenawa Phosphorylation of WAVE Downstream of Mitogen-activated Protein Kinase Signaling J. Biol. Chem., September 24, 1999; 274(39): 27605 - 27609. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Okada, C.-D. Hu, T.-G. Jin, K.-i. Kariya, Y. Yamawaki-Kataoka, and T. Kataoka The Strength of Interaction at the Raf Cysteine-Rich Domain Is a Critical Determinant of Response of Raf to Ras Family Small GTPases Mol. Cell. Biol., September 1, 1999; 19(9): 6057 - 6064. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Bauer, G. Mirey, I. R. Vetter, J. A. Garcia-Ranea, A. Valencia, A. Wittinghofer, J. H. Camonis, and R. H. Cool Effector Recognition by the Small GTP-binding Proteins Ras and Ral J. Biol. Chem., June 18, 1999; 274(25): 17763 - 17770. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |