JBC Focus on PI3-Kinase with Echelon

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ni, H.
Right arrow Articles by Wilkins, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ni, H.
Right arrow Articles by Wilkins, J. A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 273, Issue 14, 7981-7987, April 3, 1998

Integrin Activation by Dithiothreitol or Mn2+ Induces a Ligand-occupied Conformation and Exposure of a Novel NH2-terminal Regulatory Site on the beta 1 Integrin Chain*

Heyu NiDagger §, Anli LiDagger par , Neil Simonsenpar **, and John A. WilkinsDagger §par **Dagger Dagger

From the Dagger  RDU Research Laboratory and Departments of ** Medicine, § Immunology, and par  Medical Microbiology, University of Manitoba, Winnipeg MB R3A 1M4, Canada

    ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Integrins can be expressed in at least three functional states (i.e. latent, active, and ligand-occupied). However, the molecular bases for the transitions between these states are unknown. In the present study, changes in the accessibility of several beta 1 epitopes (e.g. N29, B44, and B3B11) were used to probe activation-related conformational changes. Dithiothreitol or Mn2+ activation of integrin-mediated adhesion in the human B cell line, IM9, resulted in a marked increase in the exposure of the B44 epitope, while N29 expression levels were most sensitive to dithiothreitol treatment. These results contrasted with the epitope expression patterns of spontaneously adherent K562 cells, where N29 was almost fully accessible and B44 was low. Addition of a soluble ligand resulted in a marked increase in B44 levels, suggesting that this antibody detected a ligand-induced binding site. The N29 epitope was mapped to a cysteine-rich region near the NH2 terminus of the integrin chain, thus defining a novel regulatory site.

These studies indicate that the activation of integrin function by different stimuli may involve related but nonidentical conformations. Both Mn2+ and dithiothreitol appear to induce localized conformational changes that mimic a ligand-occupied receptor. This differs from the "physiologically" activated integrins on K562 cells that display a marked increase in overall epitope accessibility without exposure of the ligand-induced binding site epitopes. The increased exposure of the N29 site on K562 cells may indicate a role for this region in the regulation of integrin function.

    INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Members of the integrin family mediate cellular interactions with elements of their microenvironment (1-3). These contacts can lead to cellular adhesion, migration, and activation (4-6). In a number of cell types, such as platelets and leukocytes, the activities of integrins are tightly regulated such that host cell activation is required before cell binding can proceed (7-9). This prerequisite ensures that integrin function is operative only at the appropriate anatomical or pathological sites.

Although the structural basis for the underlying changes associated with the acquisition of integrin functionality is unknown, data from a number of different biochemical and immunological approaches clearly demonstrate activation-associated alterations in integrin conformation (10-12). Antibody-binding studies and protease-susceptibility studies have shown that there are activation-associated changes in the accessibility of regions of the complex (10, 11). Fluorescent energy transfer studies on alpha IIbbeta 3 have also demonstrated that there are alterations in the spacing and interaction of alpha IIb and beta 3 in the activated integrin structure (12). Changes in epitope expression are also observed following receptor occupancy (13-16). Collectively the data suggest that the activated integrin complex acquires a more open conformation than is observed in the latent structure.

Recently models of integrin activation have been proposed that involve allosteric mechanisms for the acquisition of an adhesion-competent conformation (17, 18). Support for such a model derives from the observations that the binding of ligand to purified integrin inhibits the binding of an inhibitory antibody to the beta 1 chain (19). The pattern of inhibition displays characteristics that are most compatible with an allosteric mechanism. However, as pointed out by Mould (17), the situation with the integrins is more complex than a classical allosteric mechanism, as the "active" integrin does not necessarily acquire a conformation that approximates the ligand-bound receptor. Thus the existence of multiple intermediate conformations have been suggested.

Activation of integrin function can be achieved by a variety of stimuli (20-26). Mn2+ and the bifunctional reducing agent, DTT,1 have been shown to activate integrin binding in a number of systems (22-26). Since both of these agents activate purified integrins, it would appear that their effects on adhesion might be directly on the receptor complex (19, 24). These agents may provide useful probes for the analysis of the changes associated with integrin activation and ligand binding.

We have previously described a panel of regulatory antibodies to the human beta 1 integrin chain and localized their continuous epitopes (27-29). Three noncompeting groups of antibodies were identified, and one set of antibodies was shown to react with the membrane proximal beta 1 region (28). The present study localizes a novel stimulatory region to the cysteine-rich amino-terminal portion of the beta 1 chain. Furthermore, it is demonstrated that it is possible to generate functionally "activated" integrins with overlapping but nonidentical conformations.

    EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Materials-- Unless otherwise indicated, all chemicals were purchased from Sigma. Media, fetal bovine serum, and GRDS/GRES peptides were obtained from Life Technologies, Inc. Purified human plasma fibronectin was obtained from Chemicon Intl., Temecula, CA. Custom-synthesized peptides were purchased from Research Genetics, Huntsville, AL.

Antibodies-- The production, properties, and purification of the antibodies to beta 1 (Table I), JB1A (30), B3B11, B44, N29 (28), and 3S3 (31) have been previously described in detail. Dr. C. Damsky provided the anti-beta 1 AIIB2 (32).

                              
View this table:
[in this window]
[in a new window]
 
Table I
Antibodies

Cells and Culture-- The human cell lines IM9 (B cell), Jurkat (T leukemia), and K562 (erythroleukemia) were obtained from the ATCC. They were maintained in RPMI 1640 supplemented with 10% fetal bovine serum.

Cell Binding Assay-- The assays were performed as described previously (28). Nontissue culture treated microtiter wells were coated with purified plasma fibronectin (5 µg/ml) in bicarbonate buffer at 4 °C overnight. The wells were washed and blocked with 1% bovine serum albumin in RPMI. In studies involving Mn2+, the cells were washed and resuspended in Puck's saline A alone or in the presence of the indicated concentration of cation. When cells were pretreated with DTT, they were washed to remove the DTT prior to their addition to the binding assays.

Cells were preincubated with the indicated stimuli for 30 min at room temperature and then added (2 × 105 cell/well) to the coated wells and incubated for 60 min at 37 °C. The nonadherent cells were removed by centrifugation of the inverted plates for 5 min at 70 × g, and the supernatants were removed. The adherent cells were stained for 60 min with 0.5% crystal violet in a 30% solution of methanol in water. The plates were washed with tap water to remove unbound dye. The residual dye was solubilized in methanol, and the absorbance at 550 nm was determined. In all assays the adherence to bovine serum albumin (OD < 0.1) was subtracted from the values obtained for the fibronectin or antibody coated wells. Unless indicated otherwise, all assays were performed at least three times in sextuplicate.

Flow Cytometry Analysis-- Cells were preincubated with the indicated stimuli at room temperature and then incubated with the indicated antibody (5 µg/ml) for 30 min at 37 °C. The cells were washed twice with phosphate-buffered saline and incubated for 60 min at 4 °C with a fluorescein isothiocyanate-labeled goat anti-mouse immunoglobulin (Chemicon). All assays included cells incubated with the second antibody alone as a control for nonspecific binding. Fluorescence analysis was performed with a BD FACScaliber.

For the studies involving ligand binding to K562, the cells were preincubated with the indicated peptides (1 mM) or fibronectin (100 µg/ml) for 1 h at room temperature. Antibodies were then added to this mixture for 30 min at 37 °C, and the cells were processed for fluorescence-activated cell sorter analysis as described above.

Epitope Library Production and Screening-- Libraries were constructed using the Novatope System (Novagen Inc.) according to the manufacturer's instructions. The method based on the use of modified pET vectors for the expression of beta 1-T7 gene 10 fusion proteins consisted of digesting pFnRbeta (33) with DNase I in the presence of Mn2+ and size fractionating the random fragments. The 250-350-base pair fragments were flush ended with T4 DNA polymerase, single dA tailed and ligated into the EcoRV site of the pTOPE-1b(+) plasmid. Novablue (DE3) cells were transformed with the plasmid, and colonies were immunoscreened with anti-beta 1 monoclonal antibodies and an alkaline phosphatase-conjugated rabbit anti-mouse immunoglobulin. Positive colonies were subcloned and examined for reactivity with the antibodies. The inserts from individual colonies were sequenced using T7 gene 10 primers as described previously (28).

Expression of beta 1 Chain NH2-terminal 57-Amino Acid-containing Peptide-- Polymerase chain reaction amplifications were performed with the beta 1 chain primer pair GTGAATTCATATGCAAACAGATGAAAATAGATG/GAGGATCCATATGTCATGGAGGGCAACCCTTCTTTT using a plasmid isolated from the above library containing a beta 1 integrin 5' 315-base pair fragment. The products were digested with EcoRI and BamHI, ligated into pBS(+) phagemid to introduce an NdeI site (Stratagene, La Jolla, CA). The recombinant phagemid was expanded, purified, and digested with NdeI. The beta 1 fragment was purified and ligated to the expression vector pET-14b (Novagen). The resulting insert was predicted to code for residues Gln1 through Pro57 of the mature beta 1 chain. The corresponding fusion protein was expressed in competent Escherichia coli BLR(DE3)plyss strain, purified with Ni2+ columns, and visualized on 15% SDS-polyacrylamide gel electrophoresis gel by Coomassie Blue staining or immunoblots with the indicated antibodies.

Peptide Enzyme-linked Immunosorbent and Blocking Assays-- The purified fusion protein or a peptide corresponding to the first 14 residues of the mature beta 1 were suspended at 10 µg/ml in distilled water and allowed to dry overnight, 0.5 µg/well, in Nunc Maxisorb plates. The plates were washed three times with 0.5% Tween 20 in Tris-buffered saline and blocked for 2 h at room temperature with 1% bovine serum albumin in Tris-buffered saline. The indicated antibodies (5 µg/ml) were added to the wells, and the binding was quantitated with rabbit anti-mouse IgG alkaline phosphatase conjugate and developed with pNPP as substrate.

Blocking assays were performed by preincubating antibodies (1 µg/ml) with the indicated peptides (10 µM) at 4 °C overnight. The antibodies were then added to the wells of Nunc plates precoated with affinity-purified placental beta 1 integrin (28). The color was developed as per the peptide enzyme-linked immunosorbent assay.

    RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References

Differential Expression of beta 1 Epitopes on IM9 Cells-- A comparison of the binding levels of a panel of anti-beta 1 monoclonals to IM9 cells indicated that there were marked differences in their levels of expressions (Fig. 1). A calculation of their expression levels relative to the total beta 1 expression detected by JB1A or C30B indicated that B3B11, B44, and N29, respectively, were present on 18, 2, and 10% of the integrins. Previous studies had determined that these antibodies recognized continuous epitopes in the nonpolymorphic extracellular domain of the beta 1 chain (28). Thus it appeared that their low expression levels were indicative of a sequestration of the regions containing these epitopes. As IM9 cells express alpha 4beta 1 but do not spontaneously adhere to fibronectin, it was speculated that the negative correlation of expression of B44, B3B11, and N29 epitopes with adhesive function might indicate that they were reporters of integrin activity.


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 1.   The relative levels of beta 1 epitope expression on IM9 cells. IM9 cells were stained with the indicated antibodies and their relative levels of binding expressed as a percentage of JB1A MFI levels. The average and ranges of two representative experiments are provided.

Treatment of the cells with Mn2+ or DTT resulted in a marked increase in adherence. The half-maximal stimulatory concentration for Mn2+ was 70 µM (Fig. 2A). The situation with DTT was somewhat more complex with half-maximal activity at 2-5 mM and a loss in adhesion at concentrations in excess of 50 mM (Fig. 2B). The adhesion induced by both stimuli was inhibited by more than 60% by anti-alpha 4 and anti-beta 1, suggesting that alpha 4beta 1 was mediating a significant proportion of the induced binding (data not shown). Neither of the stimuli caused any change in total beta 1 levels, indicating that the adhesive changes related to altered integrin activity rather than increases in expression levels ( Figs. 3 and 4).


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 2.   The induction of IM9 adherence to fibronectin following treatment with either Mn2+ (A) or DTT (B). IM9 cells were incubated with the indicated concentration of stimulus and tested for adherence to immobilized fibronectin. Representative results of one of four independent experiments are shown. The standard errors for all samples were less than 15%.


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 3.   The effects of Mn2+ treatment of IM9 cells on beta 1 epitopes expression. Cells were treated with Mn2+ (1 mM), stained with the indicated antibodies and analyzed by flow cytometry. The control, untreated, and Mn2+-treated cell profiles are represented by the dashed, solid, and dotted lines, respectively. The arrows indicate the profiles of the Mn2+-treated cells.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 4.   The effects of DTT treatment of IM9 cells on beta 1 epitopes expression. Cells were treated with DTT (10 mM) and stained with the indicated antibodies. The control, untreated, and DTT cell profiles are represented by the dotted, solid, and dashed lines, respectively. The arrows indicate the profiles of the DTT-treated cells.

Cells treated with Mn2+ displayed a 40-50-fold increase in the levels of B44 expression such that 30-40% of the beta 1 displayed this epitope (Fig. 3). Although there was a doubling of the N29 levels, the majority of integrins did not express this epitope. The binding of B3B11 and 3S3 were relatively unaffected under these conditions. DTT treatment caused a comparable increase in the level of B44 binding (Fig. 4). However, unlike the case for the Mn2+- treated cells, there was almost 100% exposure of the N29 epitope and a small increase in B3B11 binding.

beta 1 Epitope Expression Patterns on K562 Cells-- The results of the above studies supported the concept that the expression of the B44 and possibly of the N29 epitope might relate to the activational status of the integrin. As an approach to testing this possibility K562 cells were examined for their antibody binding patterns. These cells spontaneously adhere to fibronectin, and their receptors have been shown to be in an intermediate affinity state (15). There were increases in the proportions of N29 and B3B11 expressed on these cells (Fig. 5). However, there was almost a complete absence of B44 binding, suggesting that this antibody was not a marker of integrin functionality.


View larger version (34K):
[in this window]
[in a new window]
 
Fig. 5.   The effects of ligand binding on the beta 1 epitope expression of K562 cells. Cells were treated with fibronectin or RGDS/RGES peptides, and stained with the indicated antibodies. The panel labeled B44* indicates the line patterns used for each treatment group. Note that the negative control cells are omitted from this panel for clarity. Control binding is indicated in all other panels by the line with large dashes.

Preliminary studies had indicated that Mn2+ induced the expression of the B44 epitope on K562 cells. Since it had been observed that this cation could induce conformational states which resembled those of a ligand-occupied integrin, the effects of ligand binding on B44 expression were examined. Treatment of the cells with fibronectin or RGDS-containing peptides resulted in a 2-3-fold increase in the B44 levels (Fig. 5). The expression levels of the other epitopes were not significantly changed by this treatment. Furthermore, the control peptide RGES did not induce these changes, indicating that the effects were specific to integrin ligands.

Location of the N29 Epitope-- A beta 1 epitope library was screened with N29 and B44 and a single N29 reactive clone, B105, was identified. DNA sequencing of B105 indicated that this clone contained the first 105 residues of the beta 1 chain (data not shown). Previous studies had determined that the JB1A epitope consisted of residues 82-87 and that a panel of monoclonal antibodies to the beta 1 chain including N29 did not react with fusion proteins containing a fragment spanning residues 55-105 (29).

Expression of beta 1 residues 1-57 as a fusion protein resulted in a product that was reactive with N29 under reducing conditions (Fig. 6). In contrast, N29 did not react with a gonococcal porin (1b) fusion protein expressed in the same vector system. The specificity of the reaction was also demonstrated by the fact that N29 but neither B3B11 nor JB1A reacted with the fusion protein (Fig. 7A). Furthermore, preincubation of N29 with the purified 1-57 fragment specifically inhibited the binding of N29 to purified beta 1 (Fig. 7B).


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 6.   The expression and reactivity of the beta 1 1-57 fusion protein. Panel A, Coomassie Blue-stained SDS-polyacrylamide gel electrophoresis gel; lanes 1, no vector; 2, vector only; 3, vector plus insert uninduced; 4-6, isopropyl-1-thio-beta -Dgalactopyranoside-induced cells containing the beta 1-57 insert at 1, 2, and 3 h postinduction. The arrow indicates the location of the fusion protein. Panel B, a Western blot of a replicate of panel A stained with N29. Panel C, lanes 1 and 3 contain purified beta 1-57 fusion protein, lanes 2 and 4 contain a gonococcal porin (1b) fusion protein produced in the same vector as a control. Lanes 1 and 2 were reacted with N29, lanes 3 and 4 were stained with Coomassie Blue.


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 7.   The specificity of antibody binding to beta 1-57 fusion protein. A, the binding of B3B11, JB1A, and N29 to immobilized beta 1-57 fusion protein or to purified beta 1 integrin were compared in an enzyme-linked immunosorbent assay. B, the capacity of beta 1-57 fusion protein to block the binding of the indicated antibodies to immobilized purified beta 1 integrin. The effects of a synthetic peptide containing beta 1 residues 1-14 on N29 binding were also determined.

Honda et al. (40) have described a stimulatory antibody to beta 3, AP-5, which recognized a cation-sensitive epitope containing residues 1-6 of the beta 3 integrin (34). It was therefore questioned if the N29 epitope might be located in a homologous region of the beta 1 chain. Pretreatment of N29 with a synthetic peptide containing residues 1-14 did not influence the ability of the antibody to bind to purified beta 1 (Fig. 7B). These results indicate that the N29 epitope was located between residues 15 and 54 of the beta 1 chain.

    DISCUSSION
Top
Abstract
Introduction
Procedures
Results
Discussion
References

The present studies provide several new pieces of data relevant to integrin activation. 1) The stimulatory antibody, N29, recognizes a new regulatory region located near the NH2 terminus of the beta 1 molecule. 2) The stimulatory antibody, B44, identifies an epitope, which is exposed on ligand binding. 3) Mn2+ and DTT induce changes in beta 1 epitope accessibility, which resemble those observed in the ligand occupied receptor. 4) The overall accessibility of epitopes in physiologically active integrins is increased relative to those on nonadherent cells or on Mn2+- and DTT-activated cells.

The initial assumption that N29 might identify an activation epitope does not appear to be fully supported by the results of this study. In the case of DTT-treated cells, there was an almost total exposure of the N29 epitope associated with activation of adhesion. However, the N29 levels on spontaneously adhesive cells such as K562 and Jurkat2 or following treatment with Mn2+ were elevated 2-4-fold, such that 20-30% of the integrins displayed this epitope. There were also low but detectable levels of N29 exposure on nonadherent cells. Thus the correlation between integrin functional status and N29 accessibility appeared to be semiquantitative rather than a qualitative one.

The antibody B44 identifies an epitope, which under normal conditions appears to be of very limited accessibility. Thus the expression levels of this epitope on adhesion competent cells such as Jurkat and K562 are significantly lower than the total integrin levels. However, occupancy of integrin by ligand or by an RGD-containing antagonist results in a marked increase in B44 expression. The B44 epitope is reduction resistant under SDS-polyacrylamide gel electrophoresis conditions, implying that the antibody detects a continuous peptide sequence. It appears that ligand binding exposes the cryptic epitope to the solvent and renders it antibody accessible. However, it is unlikely that this epitope represents a ligand contact site as B44 binding has been shown to induce adherence in Jurkat cells (28). The properties of B44 most resemble those of two other antibodies, 15/7 (35) and HUTS-21 (36), which detect integrins in a ligand-occupied or high affinity state. These antibodies have been shown to react with epitopes that are located in the cysteine rich region of the beta 1 (residues 355-425). However, to date it has not been possible to determine the location of the B44 epitope.

Treatment of IM9 cells with Mn2+ induces B44 epitope expression. The implication is that the Mn2+ induces alterations that resemble those caused by ligand binding to a competent integrin. It has been suggested that Mn2+ may stimulate adhesion by forming a co-ordination complex with residues in the cation binding domains of the integrin and the aspartate residue of the ligand (37, 38), or by facilitating the ligand entry to the binding site via an exchange mechanism (18). Recently it has been proposed that Mn2+ may induce a conformation resembling the ligand occupied receptor thus permitting ligand access to the binding region of the integrin (17). The binding pattern of B44 is compatible with the latter explanation of Mn2+ action. However, it does not address the issue of the relative contributions of Mn2+ to cation-facilitated exchange and ligand co-ordination.

Activation of adhesion by reducing agents has also been described in several systems. Edwards et al. (25) noted that there was an obligate requirement for a bifunctional thiol with a minimal spacing of four carbons between the two -SH groups. Early studies on the activation of platelet adhesion by DTT indicated that there were changes in alpha IIbbeta 3 electrophoretic mobility associated with activation by this agent (26). The DTT-dependent activation of mutant alpha IIbbeta 3 in platelets from a patient with Glanzmann's thrombasthenia by DTT was shown to be associated with the appearance of activation epitopes (39). However, DTT-induced activation of alpha Lbeta 2 mediated adhesion of natural killer cells to intercellular adhesion molecule 1-expressing target cells failed to reveal conformational changes using two reporter antibodies (25). Furthermore, these authors could not demonstrate the appearance of free thiol groups in the alpha Lbeta 2 complex, implying that the integrin chains were not directly modified by DTT treatment (25). The present data clearly indicate that significant conformational changes are induced by DTT as access to the B44 and the N29 epitopes are markedly increased.

The increased B3B11 and N29 expression on K562 cells implies that physiologically activated integrins undergo changes that allow an increased accessibility to the membrane proximal and NH2-terminal regions of the molecule. Although the integrins on these cells are in an adhesion competent state, ligand binding is required for B44 epitope expression. These results would seem to suggest that there is an intermediate conformation in which the integrin is adhesion-competent but unoccupied. The fact that agents such as Mn2+ and DTT induce conformations that resemble the ligand-occupied state suggests that they stimulate adhesion competence by generating integrin intermediates that are distinct from the native active forms observed in K562. Although different functional forms of integrins have been described or postulated (16, 17, 40), it is unclear at this point whether active forms such as those induced by DTT or Mn2+ are representative of physiological integrin intermediates. These observations suggest that caution should be exhibited when attempting to correlate competent states induced by these agents with those found in physiologically activated integrins.

The localization of the N29 epitope between residues 15 and 54 places it in a highly conserved cysteine-rich region (41). This area has not previously been identified as a regulatory site, although it is adjacent to region that has been shown to be a cation and ligand sensitive in the beta 3 chain (34). Unlike the beta 3 situation, the binding of N29 is relatively insensitive to the cationic composition of the extracellular milieu. Thus if a homologous region exists in the beta 1 chain it would appear that it is not located in the N29 reactive 15-54 sequence of the molecule.

The antibodies N29, B44, and B3B11/JB1B were originally identified because of their abilities to stimulate Jurkat adherence to collagen and fibronectin (28). It is noteworthy that in those cases where their corresponding epitopes have been identified (28, 29), the stimulatory epitopes map to regions that are in close proximity to residues that are predicted to be involved in disulfide bonds between sequentially distant cysteines (i.e. Cys7-Cys415 and Cys444-Cys671). The present results extend those of others employing interspecies beta 1 chimeras (16, 17, 42-44) and expands the locations of regulatory sites to include both the membrane proximal and the distal regions of the beta 1 (Fig. 8).


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 8.   The locations of regulatory epitopes on human beta 1. The relative positions of the epitopes recognized by regulatory antibodies (i.e. stimulatory (S) and inhibitory (I)). The positions of the two putative ligand contact sites (solid area), the cysteine-rich repeat region (gray area), and the transmembrane region (checkered area) are indicated. The relevant references are provided in the text.

It might be speculated that the NH2-terminal region of the beta 1 chain is involved in the normal control of integrin function. The increased N29 expression on K562 could reflect a situation in which physiologically activated integrins undergo a conformational change to expose this site. The exposure may indicate accessibility to the ligand-binding site. However, it seems unlikely that N29 contact is required for binding as Mn2+ induces adhesion competence with minimal effects on N29 exposure. Subsequent to ligand binding, the B44 epitope is expressed, and this presumably reflects a secondary change in the integrin conformation, perhaps as a consequence of ligand displacement of previously buried residues. It is important to bear in mind that, although the results of the antibody studies indicate changes in the accessibility of beta 1 integrin epitopes following activation, the basis for these changes are unknown. They could relate to integrin conformational changes, to alterations in the patterns of integrin-associated proteins, or to both of these mechanisms. Studies with purified integrin may permit the differentiation of these possibilities.

    ACKNOWLEDGEMENTS

We thank Drs. E. Ruoslahti and C. Damsky, respectively, for providing the pFnRbeta and AIIB2 antibody and Dr. Guangming Zhong for assistance with the fluorescence-activated cell sorter analysis.

    FOOTNOTES

* This work was supported by grants from the Medical Research Council and the Canadian Arthritis Society.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Recipient of a Manitoba Health Research Council Studentship.

Dagger Dagger To whom correspondence should be addressed: RDU Research Laboratory, RR014 800 Sherbrook St., Winnipeg, MB R3A 1M4, Canada. Tel.: 204-787-7021; Fax: 204-787-2420; E-mail: jwilkin{at}cc.umanitoba.ca.

1 The abbreviation used is: DTT, dithiothreitol.

2 H. Ni and J. A. Wilkins, unpublished results.

    REFERENCES
Top
Abstract
Introduction
Procedures
Results
Discussion
References

  1. Hynes, R. O. (1992) Cell 69, 11-25[CrossRef][Medline] [Order article via Infotrieve]
  2. Clark, E. A., and Brugge, J. S. (1995) Science 268, 233-239[Abstract/Free Full Text]
  3. Schwartz, M. A., Schaller, M. D., and Ginsberg, M. H. (1995) Ann. Rev. Cell Dev. Biol. 11, 549-599[CrossRef][Medline] [Order article via Infotrieve]
  4. Sjaastad, M. D., and Nelson, W. J. (1997) Bioessays 19, 47-55[CrossRef][Medline] [Order article via Infotrieve]
  5. Haazenberger, D., Klominek, J., Holgersson, J., Bergstrom, S.-E., and Sundqvist, K.-G. (1997) J. Immunol. 158, 76-84[Abstract]
  6. Pytela, R., Pierschbacher, M. D., and Ruoslahti, E. (1985) Cell 40, 191-198[CrossRef][Medline] [Order article via Infotrieve]
  7. Marguerie, G. A., and Plow, E. F. (1981) Biochemistry 20, 1074-1080[CrossRef][Medline] [Order article via Infotrieve]
  8. Wright, S. D., and Meyer, B. C. (1986) J. Immunol. 136, 1759-1764[Abstract]
  9. Shimizu, Y., Van Seventer, G. A., Morgan, K. J., and Shaw, S. (1990) Nature 345, 250-253[CrossRef][Medline] [Order article via Infotrieve]
  10. Calvette, J. J. (1994) Thromb. Haemostasis 72, 1-15[Medline] [Order article via Infotrieve]
  11. Calvette, J. J., Mann, K., Schafer, W., Fernandez-Lafuente, R., and Guisan, J. M. (1994) Biochem. J. 298, 1-7
  12. Sims, P. J., Ginsberg, M. H., Plow, E. F., and Shattil, S. J. (1991) J. Biol. Chem. 266, 7345-7352[Abstract/Free Full Text]
  13. Frelinger, A. L., III, Du, X., Plow, E. F., and Ginsberg, M. H. (1991) J. Biol. Chem. 266, 17106-17111[Abstract/Free Full Text]
  14. Mould, A. P., Garratt, A. N., Askari, J. A., Akiyama, S. K., and Humphries, M. J. (1995) FEBS Lett. 363, 118-122[CrossRef][Medline] [Order article via Infotrieve]
  15. Faull, R. J., Kovach, N. L., Harlan, J. M., and Ginsberg, M. H. (1993) J. Cell Biol. 121, 155-162[Abstract/Free Full Text]
  16. Bazzoni, G., Shih, D.-T, Buck, C. A., and Hemler, M. E. (1995) J. Biol. Chem. 270, 25570-25577[Abstract/Free Full Text]
  17. Mould, A. P. (1996) J. Cell Sci. 109, 2613-2618[Medline] [Order article via Infotrieve]
  18. Lee, O.-J, Rieu, P., Arnaout, M. A., and Liddington, R. (1995) Structure 3, 1333-1340[Medline] [Order article via Infotrieve]
  19. Mould, A. P., Akiyama, S. K., and Humphries, M. J. (1996) J. Biol. Chem. 271, 20365-20374[Abstract/Free Full Text]
  20. Wilkins, J. A., Stupack, D. G., Stewart, S., and Caixia, S. (1991) Eur. J. Immunol. 21, 517-522[Medline] [Order article via Infotrieve]
  21. Chan, B. M., Wong, J. G., Rao, A., and Hemler, M. E. (1991) J. Immunol. 147, 398-404[Abstract]
  22. Dransfield, I., Cabanas, C., Craig, A., and Hogg, N. (1992) J. Cell Biol. 116, 219-226[Abstract/Free Full Text]
  23. Elices, M. J., Urry, L. A., and Hemler, M. E. (1991) J. Cell Biol. 112, 169-181[Abstract/Free Full Text]
  24. Davis, G. E., and Camarillo, C. W. (1993) J. Immunol. 151, 7138-7156[Abstract]
  25. Edwards, B. S., Curry, M. S., Southon, E. A., Chong, A. S.-F., and Graf, L. H. (1995) Blood 86, 2288-2301[Abstract/Free Full Text]
  26. Peerschke, E. I. (1995) Thromb. Haemostasis 73, 862-867[Medline] [Order article via Infotrieve]
  27. Stupack, D. G., Shen, C., and Wilkins, J. A. (1994) Cell. Immunol. 155, 237-245[CrossRef][Medline] [Order article via Infotrieve]
  28. Wilkins, J. A., Li, A., Ni, H., Stupack, D. G., and Shen, C. (1996) J. Biol. Chem. 271, 3046-3051[Abstract/Free Full Text]
  29. Ni, H., and Wilkins, J. A. (1997) Cell Adhes. Commun., in press
  30. Stupack, D. G., Stewart, S., Carter, W. G., Wayner, E. A., and Wilkins, J. A. (1991) Scand. J. Immunol. 34, 761-769[CrossRef][Medline] [Order article via Infotrieve]
  31. Gao, J. X., Wilkins, J. A., and Issekutz, A. C. (1995) Cell. Immunol. 163, 178-197[CrossRef][Medline] [Order article via Infotrieve]
  32. Brown, D. L., Phillips, D. R., Danasky, C. H., and Charo, I. F. (1989) J. Clin. Invest. 84, 366-370
  33. Giancotti, F. G., and Ruoslahti, E. (1990) Cell 60, 849-859[CrossRef][Medline] [Order article via Infotrieve]
  34. Honda, S., Tomiyama, Y., Pelletier, A. J., Annis, D., Honda, Y., Orchekowski, R., Ruggeri, Z., and Kunicki, T. J. (1995) J. Biol. Chem. 270, 11947-11954[Abstract/Free Full Text]
  35. Puzon-McLaughlin, W., Yednock, T. A., and Takada, Y. (1996) J. Biol. Chem. 271, 16580-16585[Abstract/Free Full Text]
  36. Luque, A., Gomez, M., Puzon, W., Takada, Y., Sanchez-Madrid, F., and Cabanas, C. (1996) J. Biol. Chem. 271, 11067-11075[Abstract/Free Full Text]
  37. Bergelson, J. M., and Hemler, M. E. (1995) Curr. Biol. 5, 615-617[CrossRef][Medline] [Order article via Infotrieve]
  38. D'Souza, S. E., Haas, T. A., Piotrowicz, R. S., Byers-Ward, V., McGrath, D. E., Soule, H. R., Cierniewski, C., Plow, E. F., and Smith, J. W. (1994) Cell 79, 659-667[CrossRef][Medline] [Order article via Infotrieve]
  39. Kouns, W. C., Steiner, B., Kunicki, T. J., Moog, S., Jutzi, J., Jennings, L. K., Cazenave, J.-P., and Lanza, F. (1994) Blood 84, 1108-1115[Abstract/Free Full Text]
  40. Yednock, T. A., Cannon, C., Vandevert, C., Goldbach, E. G., Shaw, G., Ellis, D. K., Liau, C., Fritz, L. C., and Tanner, L. I. (1995) J. Biol. Chem. 270, 28740-28750[Abstract/Free Full Text]
  41. Calvette, J. J., Henschen, A., and Gonzalez-Rodriguez, J. (1991) Biochem. J. 274, 63-71
  42. Takada, Y., and Puzon, W. (1993) J. Biol. Chem. 268, 17597-17601[Abstract/Free Full Text]
  43. Faull, R. J., Wang, J., Leavesley, D. I., Puzon, W., Russ, G. R., Vestweber, D., and Takada, Y. (1996) J. Biol. Chem. 271, 25099-25106[Abstract/Free Full Text]
  44. Shih, D.-T, Edelman, J. M., Horowitz, A. F., Grunwald, G, B., and Buck, C. A. (1993) J. Cell Biol. 122, 1361-1371[Abstract/Free Full Text]


Copyright © 1998 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Cell Sci.Home page
H. Hirata, H. Tatsumi, and M. Sokabe
Mechanical forces facilitate actin polymerization at focal adhesions in a zyxin-dependent manner
J. Cell Sci., September 1, 2008; 121(17): 2795 - 2804.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. W. Johansson, E. A. B. Kelly, W. W. Busse, N. N. Jarjour, and D. F. Mosher
Up-Regulation and Activation of Eosinophil Integrins in Blood and Airway after Segmental Lung Antigen Challenge
J. Immunol., June 1, 2008; 180(11): 7622 - 7635.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
S. R. Barthel, M. W. Johansson, D. M. McNamee, and D. F. Mosher
Roles of integrin activation in eosinophil function and the eosinophilic inflammation of asthma
J. Leukoc. Biol., January 1, 2008; 83(1): 1 - 12.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Leveille, M. Bouillon, W. Guo, J. Bolduc, E. Sharif-Askari, Y. El-Fakhry, C. Reyes-Moreno, R. Lapointe, Y. Merhi, J. A. Wilkins, et al.
CD40 Ligand Binds to {alpha}5beta1 Integrin and Triggers Cell Signaling
J. Biol. Chem., February 23, 2007; 282(8): 5143 - 5151.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. R. Barthel, D. S. Annis, D. F. Mosher, and M. W. Johansson
Differential Engagement of Modules 1 and 4 of Vascular Cell Adhesion Molecule-1 (CD106) by Integrins {alpha}4beta1 (CD49d/29) and {alpha}Mbeta2 (CD11b/18) of Eosinophils
J. Biol. Chem., October 27, 2006; 281(43): 32175 - 32187.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
J.-C. Kuo, W.-J. Wang, C.-C. Yao, P.-R. Wu, and R.-H. Chen
The tumor suppressor DAPK inhibits cell motility by blocking the integrin-mediated polarity pathway.
J. Cell Biol., February 13, 2006; 172(4): 619 - 631.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. R. Van de Walle, K. Vanhoorelbeke, Z. Majer, E. Illyes, J. Baert, I. Pareyn, and H. Deckmyn
Two Functional Active Conformations of the Integrin {alpha}2{beta}1, Depending on Activation Condition and Cell Type
J. Biol. Chem., November 4, 2005; 280(44): 36873 - 36882.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
X. Meng, K. Cheng, O. Krohkin, A. P. Mould, M. J. Humphries, W. Ens, K. Standing, and J. A. Wilkins
Evidence for the presence of a low-mass {beta}1 integrin on the cell surface
J. Cell Sci., September 1, 2005; 118(17): 4009 - 4016.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. L. Schaefer, K. Wada, H. Takahashi, N. Matsuhashi, S. Ohnishi, M. M. Wolfe, J. R. Turner, A. Nakajima, S. C. Borkan, and L. J. Saubermann
Peroxisome Proliferator-Activated Receptor {gamma} Inhibition Prevents Adhesion to the Extracellular Matrix and Induces Anoikis in Hepatocellular Carcinoma Cells
Cancer Res., March 15, 2005; 65(6): 2251 - 2259.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. P. Mould, M. A. Travis, S. J. Barton, J. A. Hamilton, J. A. Askari, S. E. Craig, P. R. MacDonald, R. A. Kammerer, P. A. Buckley, and M. J. Humphries
Evidence That Monoclonal Antibodies Directed against the Integrin {beta} Subunit Plexin/Semaphorin/Integrin Domain Stimulate Function by Inducing Receptor Extension
J. Biol. Chem., February 11, 2005; 280(6): 4238 - 4246.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. P. Mould, S. J. Barton, J. A. Askari, P. A. McEwan, P. A. Buckley, S. E. Craig, and M. J. Humphries
Conformational Changes in the Integrin beta A Domain Provide a Mechanism for Signal Transduction via Hybrid Domain Movement
J. Biol. Chem., May 2, 2003; 278(19): 17028 - 17035.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
W.-J. Wang, J.-C. Kuo, C.-C. Yao, and R.-H. Chen
DAP-kinase induces apoptosis by suppressing integrin activity and disrupting matrix survival signals
J. Cell Biol., October 14, 2002; 159(1): 169 - 179.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K. G. Leong, X. Hu, L. Li, M. Noseda, B. Larrivee, C. Hull, L. Ho