![]()
|
|
||||||||
J Biol Chem, Vol. 273, Issue 14, 7981-7987, April 3, 1998
From the Integrins can be expressed in at least three
functional states (i.e. latent, active, and
ligand-occupied). However, the molecular bases for the transitions
between these states are unknown. In the present study, changes in the
accessibility of several These studies indicate that the activation of integrin function by
different stimuli may involve related but nonidentical conformations.
Both Mn2+ and dithiothreitol appear to induce localized
conformational changes that mimic a ligand-occupied receptor. This
differs from the "physiologically" activated integrins on K562
cells that display a marked increase in overall epitope accessibility
without exposure of the ligand-induced binding site epitopes. The
increased exposure of the N29 site on K562 cells may indicate a role
for this region in the regulation of integrin function.
Members of the integrin family mediate cellular interactions with
elements of their microenvironment (1-3). These contacts can lead to
cellular adhesion, migration, and activation (4-6). In a number of
cell types, such as platelets and leukocytes, the activities of
integrins are tightly regulated such that host cell activation is
required before cell binding can proceed (7-9). This prerequisite
ensures that integrin function is operative only at the appropriate
anatomical or pathological sites.
Although the structural basis for the underlying changes associated
with the acquisition of integrin functionality is unknown, data from a
number of different biochemical and immunological approaches clearly
demonstrate activation-associated alterations in integrin conformation
(10-12). Antibody-binding studies and protease-susceptibility studies
have shown that there are activation-associated changes in the
accessibility of regions of the complex (10, 11). Fluorescent energy
transfer studies on Recently models of integrin activation have been proposed that involve
allosteric mechanisms for the acquisition of an adhesion-competent conformation (17, 18). Support for such a model derives from the
observations that the binding of ligand to purified integrin inhibits
the binding of an inhibitory antibody to the Activation of integrin function can be achieved by a variety of stimuli
(20-26). Mn2+ and the bifunctional reducing agent,
DTT,1 have been shown to
activate integrin binding in a number of systems (22-26). Since both
of these agents activate purified integrins, it would appear that their
effects on adhesion might be directly on the receptor complex (19, 24).
These agents may provide useful probes for the analysis of the changes
associated with integrin activation and ligand binding.
We have previously described a panel of regulatory antibodies to the
human Materials--
Unless otherwise indicated, all chemicals were
purchased from Sigma. Media, fetal bovine serum, and GRDS/GRES
peptides were obtained from Life Technologies, Inc. Purified human
plasma fibronectin was obtained from Chemicon Intl., Temecula, CA.
Custom-synthesized peptides were purchased from Research
Genetics, Huntsville, AL.
Antibodies--
The production, properties, and purification of
the antibodies to
Integrin Activation by Dithiothreitol or Mn2+ Induces
a Ligand-occupied Conformation and Exposure of a Novel
NH2-terminal Regulatory Site on the
1
Integrin Chain*
§¶,
,
**, and
§
**
RDU Research Laboratory and Departments of
** Medicine, § Immunology, and
Medical Microbiology,
University of Manitoba, Winnipeg MB R3A 1M4, Canada
![]()
ABSTRACT
Top
Abstract
Introduction
Procedures
Results
Discussion
References
1 epitopes (e.g.
N29, B44, and B3B11) were used to probe activation-related conformational changes. Dithiothreitol or Mn2+ activation
of integrin-mediated adhesion in the human B cell line, IM9, resulted
in a marked increase in the exposure of the B44 epitope, while N29
expression levels were most sensitive to dithiothreitol treatment.
These results contrasted with the epitope expression patterns of
spontaneously adherent K562 cells, where N29 was almost fully
accessible and B44 was low. Addition of a soluble ligand resulted in a
marked increase in B44 levels, suggesting that this antibody detected a
ligand-induced binding site. The N29 epitope was mapped to a
cysteine-rich region near the NH2 terminus of the integrin
chain, thus defining a novel regulatory site.
![]()
INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
IIb
3 have also demonstrated that there are alterations in the spacing and interaction of
IIb and
3 in the activated integrin
structure (12). Changes in epitope expression are also observed
following receptor occupancy (13-16). Collectively the data suggest
that the activated integrin complex acquires a more open conformation
than is observed in the latent structure.
1 chain (19). The pattern of inhibition displays characteristics that are most
compatible with an allosteric mechanism. However, as pointed out by
Mould (17), the situation with the integrins is more complex than a
classical allosteric mechanism, as the "active" integrin does not
necessarily acquire a conformation that approximates the ligand-bound
receptor. Thus the existence of multiple intermediate conformations
have been suggested.
1 integrin chain and localized their continuous epitopes (27-29). Three noncompeting groups of antibodies were identified, and one set of antibodies was shown to react with the
membrane proximal
1 region (28). The present study
localizes a novel stimulatory region to the cysteine-rich
amino-terminal portion of the
1 chain. Furthermore, it
is demonstrated that it is possible to generate functionally
"activated" integrins with overlapping but nonidentical
conformations.
![]()
EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References
1 (Table
I), JB1A (30), B3B11, B44, N29 (28), and 3S3 (31) have been previously described in detail. Dr. C. Damsky provided the anti-
1 AIIB2 (32).
Antibodies
Cells and Culture-- The human cell lines IM9 (B cell), Jurkat (T leukemia), and K562 (erythroleukemia) were obtained from the ATCC. They were maintained in RPMI 1640 supplemented with 10% fetal bovine serum.
Cell Binding Assay-- The assays were performed as described previously (28). Nontissue culture treated microtiter wells were coated with purified plasma fibronectin (5 µg/ml) in bicarbonate buffer at 4 °C overnight. The wells were washed and blocked with 1% bovine serum albumin in RPMI. In studies involving Mn2+, the cells were washed and resuspended in Puck's saline A alone or in the presence of the indicated concentration of cation. When cells were pretreated with DTT, they were washed to remove the DTT prior to their addition to the binding assays.
Cells were preincubated with the indicated stimuli for 30 min at room temperature and then added (2 × 105 cell/well) to the coated wells and incubated for 60 min at 37 °C. The nonadherent cells were removed by centrifugation of the inverted plates for 5 min at 70 × g, and the supernatants were removed. The adherent cells were stained for 60 min with 0.5% crystal violet in a 30% solution of methanol in water. The plates were washed with tap water to remove unbound dye. The residual dye was solubilized in methanol, and the absorbance at 550 nm was determined. In all assays the adherence to bovine serum albumin (OD < 0.1) was subtracted from the values obtained for the fibronectin or antibody coated wells. Unless indicated otherwise, all assays were performed at least three times in sextuplicate.Flow Cytometry Analysis-- Cells were preincubated with the indicated stimuli at room temperature and then incubated with the indicated antibody (5 µg/ml) for 30 min at 37 °C. The cells were washed twice with phosphate-buffered saline and incubated for 60 min at 4 °C with a fluorescein isothiocyanate-labeled goat anti-mouse immunoglobulin (Chemicon). All assays included cells incubated with the second antibody alone as a control for nonspecific binding. Fluorescence analysis was performed with a BD FACScaliber.
For the studies involving ligand binding to K562, the cells were preincubated with the indicated peptides (1 mM) or fibronectin (100 µg/ml) for 1 h at room temperature. Antibodies were then added to this mixture for 30 min at 37 °C, and the cells were processed for fluorescence-activated cell sorter analysis as described above.Epitope Library Production and Screening--
Libraries were
constructed using the Novatope System (Novagen Inc.) according to the
manufacturer's instructions. The method based on the use of modified
pET vectors for the expression of
1-T7 gene 10 fusion
proteins consisted of digesting pFnR
(33) with DNase I in the
presence of Mn2+ and size fractionating the random
fragments. The 250-350-base pair fragments were flush ended with T4
DNA polymerase, single dA tailed and ligated into the EcoRV
site of the pTOPE-1b(+) plasmid. Novablue (DE3) cells were transformed
with the plasmid, and colonies were immunoscreened with
anti-
1 monoclonal antibodies and an alkaline
phosphatase-conjugated rabbit anti-mouse immunoglobulin. Positive
colonies were subcloned and examined for reactivity with the
antibodies. The inserts from individual colonies were sequenced using
T7 gene 10 primers as described previously (28).
Expression of
1 Chain NH2-terminal
57-Amino Acid-containing Peptide--
Polymerase chain reaction
amplifications were performed with the
1 chain primer
pair
GTGAATTCATATGCAAACAGATGAAAATAGATG/GAGGATCCATATGTCATGGAGGGCAACCCTTCTTTT using a plasmid isolated from the above library containing a
1 integrin 5' 315-base pair fragment. The products were
digested with EcoRI and BamHI, ligated into
pBS(+) phagemid to introduce an NdeI site (Stratagene, La
Jolla, CA). The recombinant phagemid was expanded, purified, and
digested with NdeI. The
1 fragment was
purified and ligated to the expression vector pET-14b (Novagen). The
resulting insert was predicted to code for residues Gln1
through Pro57 of the mature
1 chain. The
corresponding fusion protein was expressed in competent
Escherichia coli BLR(DE3)plyss strain, purified with
Ni2+ columns, and visualized on 15% SDS-polyacrylamide gel
electrophoresis gel by Coomassie Blue staining or immunoblots with the
indicated antibodies.
Peptide Enzyme-linked Immunosorbent and Blocking Assays--
The
purified fusion protein or a peptide corresponding to the first 14 residues of the mature
1 were suspended at 10 µg/ml in
distilled water and allowed to dry overnight, 0.5 µg/well, in Nunc
Maxisorb plates. The plates were washed three times with 0.5% Tween 20 in Tris-buffered saline and blocked for 2 h at room temperature
with 1% bovine serum albumin in Tris-buffered saline. The indicated
antibodies (5 µg/ml) were added to the wells, and the binding was
quantitated with rabbit anti-mouse IgG alkaline phosphatase conjugate
and developed with pNPP as substrate.
1 integrin (28). The
color was developed as per the peptide enzyme-linked immunosorbent
assay.
| |
RESULTS |
|---|
|
|
|---|
Differential Expression of
1 Epitopes on IM9
Cells--
A comparison of the binding levels of a panel of
anti-
1 monoclonals to IM9 cells indicated that there
were marked differences in their levels of expressions (Fig.
1). A calculation of their expression
levels relative to the total
1 expression detected by
JB1A or C30B indicated that B3B11, B44, and N29, respectively, were
present on 18, 2, and 10% of the integrins. Previous studies had
determined that these antibodies recognized continuous epitopes in the
nonpolymorphic extracellular domain of the
1 chain (28). Thus it appeared that their low expression levels were indicative of a
sequestration of the regions containing these epitopes. As IM9 cells
express
4
1 but do not spontaneously
adhere to fibronectin, it was speculated that the negative correlation
of expression of B44, B3B11, and N29 epitopes with adhesive function
might indicate that they were reporters of integrin activity.
|
4 and anti-
1, suggesting that
4
1
was mediating a significant proportion of the induced binding (data not
shown). Neither of the stimuli caused any change in total
1 levels, indicating that the adhesive changes
related to altered integrin activity
rather than increases in expression levels ( Figs. 3 and
4).
|
|
|
1
displayed this epitope (Fig. 3). Although there was a doubling of the
N29 levels, the majority of integrins did not express this epitope. The
binding of B3B11 and 3S3 were relatively unaffected under these
conditions. DTT treatment caused a comparable increase in the level of
B44 binding (Fig. 4). However, unlike the case for the
Mn2+- treated cells, there was almost 100% exposure of the
N29 epitope and a small increase in B3B11 binding.
1 Epitope Expression Patterns on K562
Cells--
The results of the above studies supported the concept that
the expression of the B44 and possibly of the N29 epitope might relate
to the activational status of the integrin. As an approach to testing
this possibility K562 cells were examined for their antibody binding
patterns. These cells spontaneously adhere to fibronectin, and their
receptors have been shown to be in an intermediate affinity state (15).
There were increases in the proportions of N29 and B3B11 expressed on
these cells (Fig. 5). However, there was
almost a complete absence of B44 binding, suggesting that this antibody
was not a marker of integrin functionality.
|
Location of the N29 Epitope--
A
1 epitope
library was screened with N29 and B44 and a single N29 reactive clone,
B105, was identified. DNA sequencing of B105 indicated that this clone
contained the first 105 residues of the
1 chain (data
not shown). Previous studies had determined that the JB1A epitope
consisted of residues 82-87 and that a panel of monoclonal antibodies
to the
1 chain including N29 did not react with fusion
proteins containing a fragment spanning residues 55-105 (29).
1 residues 1-57 as a fusion protein
resulted in a product that was reactive with N29 under reducing
conditions (Fig. 6). In contrast, N29 did
not react with a gonococcal porin (1b) fusion protein expressed in the
same vector system. The specificity of the reaction was also
demonstrated by the fact that N29 but neither B3B11 nor JB1A reacted
with the fusion protein (Fig.
7A). Furthermore,
preincubation of N29 with the purified 1-57 fragment specifically
inhibited the binding of N29 to purified
1 (Fig. 7B).
|
|
3, AP-5, which recognized a cation-sensitive epitope
containing residues 1-6 of the
3 integrin (34). It was
therefore questioned if the N29 epitope might be located in a
homologous region of the
1 chain. Pretreatment of N29
with a synthetic peptide containing residues 1-14 did not influence
the ability of the antibody to bind to purified
1 (Fig.
7B). These results indicate that the N29 epitope was located
between residues 15 and 54 of the
1 chain.
| |
DISCUSSION |
|---|
|
|
|---|
The present studies provide several new pieces of data relevant to
integrin activation. 1) The stimulatory antibody, N29, recognizes a new
regulatory region located near the NH2 terminus of the
1 molecule. 2) The stimulatory antibody, B44, identifies an epitope, which is exposed on ligand binding. 3) Mn2+ and
DTT induce changes in
1 epitope accessibility, which
resemble those observed in the ligand occupied receptor. 4) The overall accessibility of epitopes in physiologically active integrins is
increased relative to those on nonadherent cells or on
Mn2+- and DTT-activated cells.
The initial assumption that N29 might identify an activation epitope does not appear to be fully supported by the results of this study. In the case of DTT-treated cells, there was an almost total exposure of the N29 epitope associated with activation of adhesion. However, the N29 levels on spontaneously adhesive cells such as K562 and Jurkat2 or following treatment with Mn2+ were elevated 2-4-fold, such that 20-30% of the integrins displayed this epitope. There were also low but detectable levels of N29 exposure on nonadherent cells. Thus the correlation between integrin functional status and N29 accessibility appeared to be semiquantitative rather than a qualitative one.
The antibody B44 identifies an epitope, which under normal conditions
appears to be of very limited accessibility. Thus the expression levels
of this epitope on adhesion competent cells such as Jurkat and K562 are
significantly lower than the total integrin levels. However, occupancy
of integrin by ligand or by an RGD-containing antagonist results in a
marked increase in B44 expression. The B44 epitope is reduction
resistant under SDS-polyacrylamide gel electrophoresis conditions,
implying that the antibody detects a continuous peptide sequence. It
appears that ligand binding exposes the cryptic epitope to the solvent
and renders it antibody accessible. However, it is unlikely that this
epitope represents a ligand contact site as B44 binding has been shown
to induce adherence in Jurkat cells (28). The properties of B44 most
resemble those of two other antibodies, 15/7 (35) and HUTS-21 (36), which detect integrins in a ligand-occupied or high affinity state. These antibodies have been shown to react with epitopes that are located in the cysteine rich region of the
1 (residues
355-425). However, to date it has not been possible to determine the
location of the B44 epitope.
Treatment of IM9 cells with Mn2+ induces B44 epitope expression. The implication is that the Mn2+ induces alterations that resemble those caused by ligand binding to a competent integrin. It has been suggested that Mn2+ may stimulate adhesion by forming a co-ordination complex with residues in the cation binding domains of the integrin and the aspartate residue of the ligand (37, 38), or by facilitating the ligand entry to the binding site via an exchange mechanism (18). Recently it has been proposed that Mn2+ may induce a conformation resembling the ligand occupied receptor thus permitting ligand access to the binding region of the integrin (17). The binding pattern of B44 is compatible with the latter explanation of Mn2+ action. However, it does not address the issue of the relative contributions of Mn2+ to cation-facilitated exchange and ligand co-ordination.
Activation of adhesion by reducing agents has also been described in
several systems. Edwards et al. (25) noted that there was an
obligate requirement for a bifunctional thiol with a minimal spacing of
four carbons between the two -SH groups. Early studies on the
activation of platelet adhesion by DTT indicated that there were
changes in
IIb
3 electrophoretic mobility
associated with activation by this agent (26). The
DTT-dependent activation of mutant
IIb
3 in platelets from a patient with
Glanzmann's thrombasthenia by DTT was shown to be associated with the
appearance of activation epitopes (39). However, DTT-induced activation of
L
2 mediated adhesion of natural killer
cells to intercellular adhesion molecule 1-expressing target cells
failed to reveal conformational changes using two reporter antibodies
(25). Furthermore, these authors could not demonstrate the appearance
of free thiol groups in the
L
2 complex,
implying that the integrin chains were not directly modified by DTT
treatment (25). The present data clearly indicate that significant
conformational changes are induced by DTT as access to the B44 and the
N29 epitopes are markedly increased.
The increased B3B11 and N29 expression on K562 cells implies that physiologically activated integrins undergo changes that allow an increased accessibility to the membrane proximal and NH2-terminal regions of the molecule. Although the integrins on these cells are in an adhesion competent state, ligand binding is required for B44 epitope expression. These results would seem to suggest that there is an intermediate conformation in which the integrin is adhesion-competent but unoccupied. The fact that agents such as Mn2+ and DTT induce conformations that resemble the ligand-occupied state suggests that they stimulate adhesion competence by generating integrin intermediates that are distinct from the native active forms observed in K562. Although different functional forms of integrins have been described or postulated (16, 17, 40), it is unclear at this point whether active forms such as those induced by DTT or Mn2+ are representative of physiological integrin intermediates. These observations suggest that caution should be exhibited when attempting to correlate competent states induced by these agents with those found in physiologically activated integrins.
The localization of the N29 epitope between residues 15 and 54 places
it in a highly conserved cysteine-rich region (41). This area has not
previously been identified as a regulatory site, although it is
adjacent to region that has been shown to be a cation and ligand
sensitive in the
3 chain (34). Unlike the
3 situation, the binding of N29 is relatively
insensitive to the cationic composition of the extracellular milieu.
Thus if a homologous region exists in the
1 chain it
would appear that it is not located in the N29 reactive 15-54 sequence
of the molecule.
The antibodies N29, B44, and B3B11/JB1B were originally identified
because of their abilities to stimulate Jurkat adherence to collagen
and fibronectin (28). It is noteworthy that in those cases where their
corresponding epitopes have been identified (28, 29), the stimulatory
epitopes map to regions that are in close proximity to residues that
are predicted to be involved in disulfide bonds between sequentially
distant cysteines (i.e. Cys7-Cys415
and Cys444-Cys671). The present results extend
those of others employing interspecies
1 chimeras (16,
17, 42-44) and expands the locations of regulatory sites to include
both the membrane proximal and the distal regions of the
1 (Fig. 8).
|
It might be speculated that the NH2-terminal region of the
1 chain is involved in the normal control of integrin
function. The increased N29 expression on K562 could reflect a
situation in which physiologically activated integrins undergo a
conformational change to expose this site. The exposure may indicate
accessibility to the ligand-binding site. However, it seems unlikely
that N29 contact is required for binding as Mn2+ induces
adhesion competence with minimal effects on N29 exposure. Subsequent to
ligand binding, the B44 epitope is expressed, and this presumably
reflects a secondary change in the integrin conformation, perhaps as a
consequence of ligand displacement of previously buried residues. It is
important to bear in mind that, although the results of the antibody
studies indicate changes in the accessibility of
1
integrin epitopes following activation, the basis for these changes are
unknown. They could relate to integrin conformational changes, to
alterations in the patterns of integrin-associated proteins, or to both
of these mechanisms. Studies with purified integrin may permit the
differentiation of these possibilities.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Drs. E. Ruoslahti and C. Damsky,
respectively, for providing the pFnR
and AIIB2 antibody and Dr.
Guangming Zhong for assistance with the fluorescence-activated cell
sorter analysis.
| |
FOOTNOTES |
|---|
* This work was supported by grants from the Medical Research Council and the Canadian Arthritis Society.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
¶ Recipient of a Manitoba Health Research Council Studentship.

To whom correspondence should be addressed: RDU Research
Laboratory, RR014 800 Sherbrook St., Winnipeg, MB R3A 1M4,
Canada. Tel.: 204-787-7021; Fax: 204-787-2420; E-mail:
jwilkin{at}cc.umanitoba.ca.
1 The abbreviation used is: DTT, dithiothreitol.
2 H. Ni and J. A. Wilkins, unpublished results.
| |
REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
H. Hirata, H. Tatsumi, and M. Sokabe Mechanical forces facilitate actin polymerization at focal adhesions in a zyxin-dependent manner J. Cell Sci., September 1, 2008; 121(17): 2795 - 2804. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. W. Johansson, E. A. B. Kelly, W. W. Busse, N. N. Jarjour, and D. F. Mosher Up-Regulation and Activation of Eosinophil Integrins in Blood and Airway after Segmental Lung Antigen Challenge J. Immunol., June 1, 2008; 180(11): 7622 - 7635. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Barthel, M. W. Johansson, D. M. McNamee, and D. F. Mosher Roles of integrin activation in eosinophil function and the eosinophilic inflammation of asthma J. Leukoc. Biol., January 1, 2008; 83(1): 1 - 12. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Leveille, M. Bouillon, W. Guo, J. Bolduc, E. Sharif-Askari, Y. El-Fakhry, C. Reyes-Moreno, R. Lapointe, Y. Merhi, J. A. Wilkins, et al. CD40 Ligand Binds to {alpha}5beta1 Integrin and Triggers Cell Signaling J. Biol. Chem., February 23, 2007; 282(8): 5143 - 5151. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Barthel, D. S. Annis, D. F. Mosher, and M. W. Johansson Differential Engagement of Modules 1 and 4 of Vascular Cell Adhesion Molecule-1 (CD106) by Integrins {alpha}4beta1 (CD49d/29) and {alpha}Mbeta2 (CD11b/18) of Eosinophils J. Biol. Chem., October 27, 2006; 281(43): 32175 - 32187. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-C. Kuo, W.-J. Wang, C.-C. Yao, P.-R. Wu, and R.-H. Chen The tumor suppressor DAPK inhibits cell motility by blocking the integrin-mediated polarity pathway. J. Cell Biol., February 13, 2006; 172(4): 619 - 631. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. R. Van de Walle, K. Vanhoorelbeke, Z. Majer, E. Illyes, J. Baert, I. Pareyn, and H. Deckmyn Two Functional Active Conformations of the Integrin {alpha}2{beta}1, Depending on Activation Condition and Cell Type J. Biol. Chem., November 4, 2005; 280(44): 36873 - 36882. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Meng, K. Cheng, O. Krohkin, A. P. Mould, M. J. Humphries, W. Ens, K. Standing, and J. A. Wilkins Evidence for the presence of a low-mass {beta}1 integrin on the cell surface J. Cell Sci., September 1, 2005; 118(17): 4009 - 4016. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Schaefer, K. Wada, H. Takahashi, N. Matsuhashi, S. Ohnishi, M. M. Wolfe, J. R. Turner, A. Nakajima, S. C. Borkan, and L. J. Saubermann Peroxisome Proliferator-Activated Receptor {gamma} Inhibition Prevents Adhesion to the Extracellular Matrix and Induces Anoikis in Hepatocellular Carcinoma Cells Cancer Res., March 15, 2005; 65(6): 2251 - 2259. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. P. Mould, M. A. Travis, S. J. Barton, J. A. Hamilton, J. A. Askari, S. E. Craig, P. R. MacDonald, R. A. Kammerer, P. A. Buckley, and M. J. Humphries Evidence That Monoclonal Antibodies Directed against the Integrin {beta} Subunit Plexin/Semaphorin/Integrin Domain Stimulate Function by Inducing Receptor Extension J. Biol. Chem., February 11, 2005; 280(6): 4238 - 4246. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. P. Mould, S. J. Barton, J. A. Askari, P. A. McEwan, P. A. Buckley, S. E. Craig, and M. J. Humphries Conformational Changes in the Integrin beta A Domain Provide a Mechanism for Signal Transduction via Hybrid Domain Movement J. Biol. Chem., May 2, 2003; 278(19): 17028 - 17035. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-J. Wang, J.-C. Kuo, C.-C. Yao, and R.-H. Chen DAP-kinase induces apoptosis by suppressing integrin activity and disrupting matrix survival signals J. Cell Biol., October 14, 2002; 159(1): 169 - 179. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. G. Leong, X. Hu, L. Li, M. Noseda, B. Larrivee, C. Hull, L. Ho |